KR101945716B1 - Composition for Preventing or Treating Inflammatory Disease, Allergic Disease or Cancer Comprising Melatonin Derivative - Google Patents

Abstract

The present invention relates to a pharmaceutical composition comprising a melatonin derivative, a health food or a cosmetic composition, wherein the melatonin derivative is treated with an inflammatory model to exhibit anti-inflammatory activity inhibiting the production of NO and the expression of an inflammatory cytokine, (AKT) and extracellular signal-regulated kinases (ERK) signaling pathways in the treatment of cancer cells, and inhibit histamine-mediated allergic responses by inhibiting histamine- Since it has an anticancer activity inhibiting the expression of Hypoxia-inducible factor-1 alpha (HIF-1 alpha), it is useful as a therapeutic agent, cosmetic composition or health food in the treatment of inflammatory diseases, allergic diseases or cancer diseases .

Description

Composition for preventing or treating inflammatory diseases, allergic diseases, or cancer diseases containing melatonin derivatives {Composition for Preventing or Treating Inflammatory Disease, Allergic Disease or Cancer Comprising Melatonin Derivative}

The present invention relates to a composition for preventing or treating inflammatory diseases, allergic diseases, and a composition for preventing or treating cancer diseases, including melatonin derivatives.

Inflammation is the expression of a normal, protective in vivo defense mechanism that appears locally in response to physical trauma, harmful chemicals, infection by microorganisms, or tissue damage caused by irritants in metabolites in vivo. Such inflammation is triggered by various chemical mediators produced from damaged tissues and migrating cells, and these chemical mediators are known to be of a wide variety according to the type of inflammatory process. In a normal case, the living body neutralizes or removes pathogenic factors through an inflammatory reaction and regenerates damaged tissues to restore normal structure and function.

However, if such an inflammatory reaction is abnormal, it may progress to a disease such as chronic inflammation, and if the inflammation is inappropriately triggered by an autoimmune reaction such as asthma or rheumatoid arthritis, or a harmless substance such as pollen, the defense response itself Rather, it damages tissues and causes various diseases.

In general, inflammatory reactions can be observed in almost all clinical diseases. Among these inflammatory diseases, there are bacterial diseases that can be etiologically treated with antibiotics, but most of them are due to tissue damage caused by autoimmune reactions, so specific treatments are not required. There is no known incurable disease. Various biochemical phenomena are involved as causes of such inflammation, and various techniques for suppressing them have been studied.

For example, macrophages are cells that play an important role in inflammatory reactions by producing various cytokines and nitrogen oxides (NO) in response to chemical stimuli. In particular, in macrophages, inducible nitrogen oxide synthase (iNOS) is expressed by stimulation of cytokines such as lipopolysaccharide (LPS), interferon γ, and tumor necrosis factor-α (TNF-α). A large amount of nitrogen oxides (NO) is produced for a long time, and this oxidative stress is the nuclear factor kappa-light-chain-enhancer of activated B cells, NF, which is a transcription factor of the inflammatory response that is inhibited by IκB. It is known to promote -κB) activity. Activated NF-κB migrates to the nucleus and moves to the inducible NO synthase (iNOS), prostaglandin-endoperoxide synthase-2 (COX-2), and interleukin-1β (Interleukin- 1β, IL-1β) and various cytokines such as TNF-α promote the expression of genes that induce inflammatory reactions, and it is known that inhibition of these factors can suppress the inflammatory response (Baeuerle et al., Annu. Rev. Immunol., 12:141-179, 1994).

Nitrogen oxide (NO) is L-arginine by three major nitrogen oxide synthase (NOS) isomers: neuronal NOS (nNOS), endothelial NOS (eNOS), and inducible NOS (iNOS). It is produced from (L-arginine). nNOS and eNOS are ^{regulated by Ca 2+} /calmodulin, but iNOS is regulated at the transcription level by inflammatory stimuli such as interleukin, interferon, and LPS. Nitrogen oxides produced in small amounts by nNOS or eNOS are responsible for normal physiological functions such as vasodilation, neurotransmission, and cell destruction of pathogens, but nitrogen oxides produced in excess by iNOS in macrophages are various pathologies including inflammation and cancer. It is involved in physiological processes, and when it reacts with superoxide to form peroxynitrite, it acts as a strong oxidizing agent to damage cells, and NF-κB in macrophages activated by inflammatory stimulation. It is known to be related to chronic diseases such as inflammatory response, cancer, and arteriosclerosis by activating (Lawrence et al., Nat Med., 7:1291-1297, 2001; Riehemann et al., FEBS Lett., 442:89- 94, 1999; Stamler et al., Science, 258:1898-1902, 1992).

IL-6, a pleiotropic cytokine, is found in inflammatory bowel disease, arthritis, experimental autoimmune encephalomyelitis, multicentric Castleman's disease, and Pristane. It is thought to be a major causative molecule in pristane-induced lupus and plasmacytomas, and COX-2 is considered to be a causative molecule mainly for arthritis and lupus. Therefore, selective inhibitors for them can be widely used.

However, as the most common inflammatory disease prophylactic or therapeutic agent for treating inflammatory diseases so far, however, steroidal and nonsteroidal inflammatory diseases prophylactic or therapeutic agents are largely used, among which synthetic or therapeutic solutions are mostly used for various side effects other than the main action. There is a problem in that it is often accompanied by.

Therefore, there is an urgent need for the development of a new inflammatory disease with excellent effect and less side effects.

1. Korean Patent Registration No. 10-0597211.

An object of the present invention is to provide a pharmaceutical composition comprising novel compounds derived from melatonin, a biological hormone, in order to effectively prevent or treat inflammatory diseases, allergic diseases and cancer diseases.

Another object of the present invention is to provide a health food or cosmetic composition comprising a novel compound derived from melatonin, a biological hormone, in order to effectively prevent or improve inflammatory diseases, allergic diseases and cancer diseases.

In order to achieve the above object, the present invention provides a pharmaceutical composition for preventing or treating inflammatory diseases comprising a melatonin derivative as an active ingredient.

In addition, in order to achieve the above other object, the present invention provides a health food for preventing or improving inflammatory diseases comprising a melatonin derivative as an active ingredient.

In order to achieve the above another object, the present invention provides a cosmetic composition for preventing or improving inflammatory diseases comprising a melatonin derivative as an active ingredient.

In order to achieve the above another object, the present invention provides a pharmaceutical composition for preventing or treating allergic diseases comprising a melatonin derivative as an active ingredient.

In order to achieve the above another object, the present invention provides a health food for preventing or improving allergic diseases comprising a melatonin derivative as an active ingredient.

In order to achieve the above another object, the present invention provides a cosmetic composition for preventing or treating allergic diseases comprising a melatonin derivative as an active ingredient.

In order to achieve the above another object, the present invention provides a pharmaceutical composition for preventing or treating cancer diseases comprising a melatonin derivative as an active ingredient.

In order to achieve the above another object, the present invention provides a health food for preventing or improving cancer diseases comprising a melatonin derivative as an active ingredient.

The melatonin derivative is represented by the following formula (1) or formula (2).

[Formula 1]

R ¹ is at least one selected from the group consisting of hydrogen, (C2 ~ C4) alkylcarbonyl, benzoyl (Benzoyl) and (C1 ~ C4) alkoxycarbonyl,

[Formula 2]

The R ² is at least one selected from the group consisting of hydrogen, (C1 ~ C4) alkylcarbonyl, benzoyl (Benzoyl) and (C1 ~ C4) alkoxycarbonyl.

The melatonin derivative according to the present invention exhibits anti-inflammatory activity that inhibits the production of NO and the expression of inflammatory cytokines when treated in an inflammation model, and suppresses histamine secreted from mast cells, thereby inhibiting histamine-mediated allergic reactions. , When treated in cancer cells, it inhibits the signaling system of protein kinase B (AKT) and extracellular signal-regulated kinases (ERK), and hypoxia-inducible factor-1 alpha, As it shows anticancer activity that inhibits the expression of HIF-1α), it can be usefully used as a therapeutic agent, cosmetic composition, or health food with low side effects and excellent effect in the treatment of inflammatory diseases, allergic diseases or cancer diseases.

1 shows the structural formula of melatonin and melatonin derivatives synthesized in the present invention;
Figure 2 is a bar graph showing the NO production inhibitory effect of a melatonin derivative according to an embodiment of the present invention;
Figure 3 shows the inhibitory effect of the inflammatory factor of the melatonin derivative according to the embodiment of Figure 2;
4 is a bar graph showing the histamine inhibitory effect of a melatonin derivative according to another embodiment of the present invention;
5 is a table showing the anticancer effect of a melatonin derivative in colon cancer cells according to another embodiment of the present invention;
6 is a table showing the anticancer effect of the melatonin derivative according to the embodiment of FIG. 5 in cervical cancer, breast cancer, lung cancer, and colon cancer cells;
Figure 7 shows the results of analyzing the anticancer effect mechanism of the melatonin derivative according to the embodiment of Figure 5; And
8 shows the effect of inhibiting the expression of hypoxia-inducible factor 1-alpha (HIF-1α) in colon cancer cells of the melatonin derivative according to the embodiment of FIG. 5.

The inventors of the present invention synthesized a derivative having a side chain at position 3 and a side chain at position 2 of the melatonin indole nucleus, and confirmed that the derivative showed anti-inflammatory, anti-allergic and anti-cancer effects, thereby completing the present invention. .

The present invention provides a pharmaceutical composition for preventing or treating inflammatory diseases comprising the melatonin derivative of Formula 1 or Formula 2 as an active ingredient.

[Formula 1]

R ¹ is at least one selected from the group consisting of hydrogen, (C2 ~ C4) alkylcarbonyl, benzoyl (Benzoyl) and (C1 ~ C4) alkoxycarbonyl,

[Formula 2]

The R ² is at least one selected from the group consisting of hydrogen, (C1 ~ C4) alkylcarbonyl, benzoyl (Benzoyl) and (C1 ~ C4) alkoxycarbonyl.

According to an embodiment of the present invention, when the melatonin derivative is treated in an LPS-induced inflammation model, NO production and inflammatory cytokine monocyte chemoattractant protein-1 (MCP-1), interleukin The expression of -6 (Interleukin-6), COX-2 and TNF-α was greatly suppressed. That is, the melatonin derivative can be used as an effective pharmaceutical composition capable of alleviating inflammatory diseases.

At this time, the melatonin derivative may be included in an amount of 0.1 to 50 parts by weight, based on a total of 100 parts by weight of the pharmaceutical composition.When it is included in less than 0.1 parts by weight, the anti-inflammatory effect of the melatonin derivative does not appear properly, and when it is included in excess of 50 parts by weight It is not preferable because the anti-inflammatory effect is significantly reduced compared to the increased amount of the melatonin derivative.

The inflammatory diseases to which the pharmaceutical composition can be applied include edema, dermatitis, conjunctivitis, periodontitis, rhinitis, otitis media, pharyngitis, tonsillitis, pneumonia, gastric ulcer, gastritis, Crohn's disease, colitis, hemorrhoids, gout, ankylosing spondylitis, rheumatic fever, lupus. , Fibromyalgia, psoriatic arthritis, osteoarthritis, rheumatoid arthritis, peri-shoulderitis, tendinitis, tendonitis, peritonitis, myositis, hepatitis, cystitis, nephritis, sjogren's syndrome, multiple sclerosis and acute or chronic inflammatory diseases It may be one or more selected from, but is not limited thereto.

In addition, the present invention provides a health food for preventing or improving inflammatory diseases comprising the melatonin derivative of the following Formula 1 or Formula 2 as an active ingredient.

[Formula 1]

R ¹ is at least one selected from the group consisting of hydrogen, (C2 ~ C4) alkylcarbonyl, benzoyl (Benzoyl) and (C1 ~ C4) alkoxycarbonyl,

[Formula 2]

The R ² is at least one selected from the group consisting of hydrogen, (C1 ~ C4) alkylcarbonyl, benzoyl (Benzoyl) and (C1 ~ C4) alkoxycarbonyl.

In addition, the present invention provides a cosmetic composition for preventing or improving inflammatory diseases comprising the melatonin derivative of the formula (1) or (2) as an active ingredient.

[Formula 1]

R ¹ is at least one selected from the group consisting of hydrogen, (C2 ~ C4) alkylcarbonyl, benzoyl (Benzoyl) and (C1 ~ C4) alkoxycarbonyl,

[Formula 2]

The R ² is at least one selected from the group consisting of hydrogen, (C1 ~ C4) alkylcarbonyl, benzoyl (Benzoyl) and (C1 ~ C4) alkoxycarbonyl.

In addition, the present invention provides a pharmaceutical composition for preventing or treating allergic diseases comprising the melatonin derivative of the following formula (1) or (2) as an active ingredient.

[Formula 1]

R ¹ is at least one selected from the group consisting of hydrogen, (C2 ~ C4) alkylcarbonyl, benzoyl (Benzoyl) and (C1 ~ C4) alkoxycarbonyl,

[Formula 2]

The R ² is at least one selected from the group consisting of hydrogen, (C1 ~ C4) alkylcarbonyl, benzoyl (Benzoyl) and (C1 ~ C4) alkoxycarbonyl.

According to another embodiment of the present invention, when the melatonin derivative according to the present invention is treated on mast cells, it has the effect of inhibiting the secretion of histamine induced by Compound 48/80. Compound 48/80, when treated on human mast cells, causes degranulation, and not only histamine or serotonin, which mast cells originally possess, but also inflammatory factors such as newly synthesized pro-inflammatory cytokines, prostaglandins, and leukotriene. It is a low-molecular multimer that emits. Among them, histamine is one of the main causes of allergic diseases, and the pharmaceutical composition comprising the melatonin derivative of the present invention can alleviate allergic diseases by inhibiting the production or release of histamine.

At this time, the melatonin derivative may be included in an amount of 0.1 to 50 parts by weight based on a total of 100 parts by weight of the pharmaceutical composition.When it is contained in an amount of less than 0.1 parts by weight beyond the above range, the anti-allergic effect of the melatonin derivative cannot be properly exhibited, If it exceeds 50 parts by weight, it is not preferable because the anti-allergic effect is significantly reduced compared to the amount of increase in the melatonin derivative.

The allergic diseases are bronchial asthma (asthma), urticaria (urticaria), anaphylaxis (anaphylaxis), food allergy (food allergy), drug allergy (drug allergy), allergic non-blood transfusion reaction, atopic dermatitis (atopic dermatitis). It may be one or more selected from the group consisting of allergic rhinitis, allergic conjunctivitis, allergic dermatitis, allergic contact dermatitis, and dammargin, but is not limited thereto.

In addition, the present invention provides a health food for preventing or improving allergic diseases comprising the melatonin derivative of Formula 1 or Formula 2 as an active ingredient.

[Formula 1]

R ¹ is at least one selected from the group consisting of hydrogen, (C2 ~ C4) alkylcarbonyl, benzoyl (Benzoyl) and (C1 ~ C4) alkoxycarbonyl,

[Formula 2]

The R ² is at least one selected from the group consisting of hydrogen, (C1 ~ C4) alkylcarbonyl, benzoyl (Benzoyl) and (C1 ~ C4) alkoxycarbonyl.

In addition, it provides a cosmetic composition for preventing or improving allergic diseases comprising the melatonin derivative of the formula (1) or (2) as an active ingredient.

[Formula 1]

R ¹ is at least one selected from the group consisting of hydrogen, (C2 ~ C4) alkylcarbonyl, benzoyl (Benzoyl) and (C1 ~ C4) alkoxycarbonyl,

[Formula 2]

The R ² is at least one selected from the group consisting of hydrogen, (C1 ~ C4) alkylcarbonyl, benzoyl (Benzoyl) and (C1 ~ C4) alkoxycarbonyl.

In addition, the present invention provides a pharmaceutical composition for preventing or treating cancer diseases comprising the melatonin derivative of the following formula (1) or formula (2) as an active ingredient.

[Formula 1]

R ¹ is at least one selected from the group consisting of hydrogen, (C2 ~ C4) alkylcarbonyl, benzoyl (Benzoyl) and (C1 ~ C4) alkoxycarbonyl,

[Formula 2]

The R ² is at least one selected from the group consisting of hydrogen, (C1 ~ C4) alkylcarbonyl, benzoyl (Benzoyl) and (C1 ~ C4) alkoxycarbonyl.

According to another embodiment of the present invention, when the melatonin derivative according to the present invention is treated on lung or colon cancer cells, the melatonin derivative is protein kinase B (AKT) and extracellular signal-regulated kinases. , ERK) showed a significant anticancer effect by inhibiting the signaling system. Therefore, the melatonin derivative according to the present invention can be used as a pharmaceutical composition for preventing or treating cancer having an excellent therapeutic effect.

At this time, the melatonin derivative may be included in an amount of 0.1 to 50 parts by weight based on a total of 100 parts by weight of the pharmaceutical composition.If it is out of the above range, the anticancer effect of the melatonin derivative does not appear properly, or the amount of increase in the therapeutic effect relative to the amount of increase is insignificant Not desirable.

The cancer is brain tumor, benign astrocytoma, malignant astrocytoma, pituitary adenoma, meningioma, cerebral lymphoma, oligodendroma, endocranial tumor, episiocytoma, brain stem tumor, head and neck tumor, laryngeal cancer, oropharyngeal cancer, nasal/sinus cancer, nasopharyngeal cancer, salivary gland Cancer, hypopharyngeal cancer, thyroid cancer, oral cancer, chest tumor, small cell lung cancer, non-small cell lung cancer, thymus cancer, mediastinal tumor, esophageal cancer, breast cancer, male breast cancer, abdominal tumor, gastric cancer, liver cancer, gallbladder cancer, biliary tract cancer, pancreatic cancer, small intestine cancer, Colon cancer, rectal cancer, anal cancer, bladder cancer, kidney cancer, male genital tumor, penile cancer, prostate cancer, female genital tumor, cervical cancer, endometrial cancer, ovarian cancer, uterine sarcoma, vaginal cancer, female external genital cancer, female urethral cancer And it may be one or more selected from the group consisting of skin cancer, but is not limited thereto.

In addition, the present invention provides a health food for preventing or improving cancer diseases comprising the melatonin derivative of the following Formula 1 or Formula 2 as an active ingredient.

[Formula 1]

R ¹ is at least one selected from the group consisting of hydrogen, (C2 ~ C4) alkylcarbonyl, benzoyl (Benzoyl) and (C1 ~ C4) alkoxycarbonyl,

[Formula 2]

The R ² is at least one selected from the group consisting of hydrogen, (C1 ~ C4) alkylcarbonyl, benzoyl (Benzoyl) and (C1 ~ C4) alkoxycarbonyl.

The pharmaceutical composition may be provided in one or more formulations selected from the group consisting of gels, emulsions, injections, powders, granules, aerosols, pastes, transdermal absorbers, and patches according to a conventional method, but is not limited thereto.

In a specific embodiment of the present invention, the pharmaceutical composition is a suitable carrier, excipient, disintegrant, sweetener, coating agent, swelling agent, lubricant, lubricant, flavoring agent, antioxidant, buffer solution, bacteriostatic agent commonly used in the manufacture of pharmaceutical compositions. , A diluent, a dispersant, a surfactant, a binder, and a lubricant may further include one or more additives selected from the group consisting of.

Specifically, carriers, excipients and diluents are lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, undecided Vaginal cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil can be used, and solid preparations for oral administration include tablets, pills, powders, granules, Capsules and the like are included, and such solid preparations may be prepared by mixing at least one excipient, for example, starch, calcium carbonate, sucrose or lactose, gelatin, and the like in the composition. In addition to simple excipients, lubricants such as magnesium stearate and talc can also be used. Liquid preparations for oral use include suspensions, liquid solutions, emulsions, syrups, etc.In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as humectants, sweeteners, fragrances, and preservatives may be included. Preparations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, suppositories, and the like. As the non-aqueous solvent and suspension, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like may be used. As a base material for suppositories, witepsol, macrogol, tween 61, cacao butter, laurin paper, glycerogelatin, and the like may be used.

The preferred dosage of the melatonin derivative may vary depending on the condition and weight of the subject, the type and extent of the disease, the form of the drug, the route and duration of administration, and may be appropriately selected by those skilled in the art. According to an embodiment of the present invention, although not limited thereto, the daily dosage may be 0.01 to 200 mg/kg, specifically 0.1 to 200 mg/kg, and more specifically 0.1 to 100 mg/kg. Administration may be administered once a day or may be divided into several doses, whereby the scope of the present invention is not limited.

In the present invention, the'subject' may be a mammal including a human, but is not limited to these examples.

The health food may be provided in the form of powder, granule, tablet, capsule, syrup or beverage, and the health food is used with other foods or food additives in addition to the melatonin derivative as an active ingredient, and is appropriately used according to a conventional method. I can. The mixing amount of the active ingredient may be appropriately determined according to the purpose of use, for example, prevention, health or therapeutic treatment.

The effective dose of the melatonin derivative contained in the health food may be used in accordance with the effective dose of the pharmaceutical composition, but in the case of long-term intake for the purpose of health and hygiene or health control, it may be less than the above range. , It is clear that the active ingredient can be used in an amount beyond the above range because there is no problem in terms of safety.

There is no particular limitation on the kind of health food, for example, meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups, beverages, tea, Drinks, alcoholic beverages, and vitamin complexes.

The cosmetic composition may be provided for use such as skin ointment, basic cosmetics, makeup cosmetics, body cosmetics or shaving cosmetics, and examples of the basic cosmetics include essences, lotions, creams, gels, lotions, packs, massage creams, There may be emulsions, and examples of the makeup cosmetics may include foundation, lipstick, eye shadow, eye liner, mascara, eyebrow pencil, and makeup base, and body cosmetics include soap, liquid detergent, bath agent, and sunscreen. There may be creams and sun oils, and shaving cosmetics include aftershave lotions and shaving creams.

In addition, the cosmetic composition may further include a functional substance, an excipient for improving physical properties, a diluent, etc. in addition to the melatonin derivative.

Specifically, fragrances, pigments, disinfectants, antioxidants, preservatives, moisturizers, thickeners, inorganic salts or synthetic polymer substances may be additionally added to the cosmetic composition in order to improve physical properties. In addition, as a blending component that may be added, it may be a fat or oil component, an emollient agent, a surfactant, an organic pigment, an inorganic pigment, an organic powder, an ultraviolet absorber, a pH adjuster, an alcohol, a blood circulation accelerator, a cooling agent, a limiting agent, or purified water.

The ingredients that may be added other than the active ingredient are not limited, and any of the ingredients may be blended within a range that does not impair the object and effect of the present invention.

In addition, the cosmetic composition may take the shape of a solution, emulsion, viscous mixture, etc., and may be any formulation commonly manufactured in the art. For example, spray, emulsion, cream, lotion, pack, foundation, lotion, essence , It may be a formulation such as hair cosmetics.

More specifically, the cosmetic composition of the present invention is spray, soap, cleansing foam, cleansing lotion, cleansing cream, body lotion, body cleanser, skin lotion, skin softener, skin toner, astrigent, lotion, milk lotion, moisture lotion, nutrition lotion , Massage cream, nutritional cream, moisture cream, hand cream, foundation, essence, nutritional essence, and may include the formulation of the pack.

For example, when the formulation of the present invention is a spray or powder, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component, and in particular, when the formulation of the present invention is a spray. May additionally contain propellants such as chlorofluorohydrocarbon, propane/butane or dimethyl ether.

When the formulation of the present invention is a paste, cream or gel, animal fiber, plant fiber, wax, paraffin, starch, tracant, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc, or zinc oxide may be used as a carrier component. I can.

When the formulation of the present invention is a solution or emulsion, a solvent, a solvating agent, or an emulsifying agent is used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, 1,3 -It may be butyl glycol oil, glycerol aliphatic ester, polyethylene glycol or fatty acid ester of sorbitan.

When the formulation of the present invention is a suspension, as a carrier component, a liquid diluent such as water, ethanol or propylene glycol, an ethoxylated isostearyl alcohol, a suspending agent such as polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, microcrystalline Cellulose, aluminum metahydroxide, bentonite, agar or tracant, and the like may be used.

When the formulation of the present invention is a surfactant containing cleansing, as a carrier component, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyltaurate, sarcosinate, fatty acid amide Ether sulfates, alkylamidobetaines, fatty alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, linoline derivatives or ethoxylated glycerol fatty acid esters may be used.

Hereinafter, examples will be described in detail to aid understanding of the present invention. However, the following examples are merely illustrative of the content of the present invention, and the scope of the present invention is not limited to the following examples, and is provided to more completely describe the present invention to those with average knowledge in the art. will be.

<Example 1> Preparation of melatonin and synthesis of melatonin derivatives

In order to prepare compounds which are melatonin derivatives shown in FIG. 1, Compound 1 was purchased from Tokyo Chemical Industry/Japan, and then reacted according to the following Scheme 1 to synthesize Compounds 3 to 5. In addition, melatonin ( compound 2 ) was prepared by purchasing from Sigam Aldrich.

[Scheme 1]

1. Synthesis of compound 3

According to Scheme 1, triethylamine and butylchloride (butylchloride, 0.83 mL, 0.79 mmol) were added to compound 1, 5-methoxytryptamine, 100 mg, 0.53 mmol, for an hour. After reacting at room temperature during the period, extraction was performed with ethyl acetate and brine _{, dried over anhydrous MgSO 4} , and filtered. The filtrate was concentrated and purified by column chromatography (silica gel, Hx: EtOAC = 1: 1) to obtain compound 3 (121.5 mg, 88.1% yield).

¹ H-NMR (500 MHz, CDCl ₃ ) δ 7.26~7.24 (m, 1H), 7.02~7.00 (m, 2H), 6.86~6.85 (m, 1H), 3.84 (s, 3H), 3.60~3.56 ( m, 2H), 2.93~2.91 (m, 2H), 2.09~2.06 (m, 2H,), 1.63~ 1.58 (m, 2H), 0.91~0.88 (m, 2H) ppm.

2. Synthesis of compound 4

Following Reaction Scheme 1, triethylamine and benzoylchloride (0.92 mL, 0.79 mmol) were added to compound 1, 5-methoxytryptamine (5-Methoxytryptamine, 100 mg, 0.53 mmol) for an hour. During the reaction at room temperature, extraction was performed with ethyl acetate and brine _{, dried over anhydrous MgSO 4} , and filtered. The filtrate was concentrated and purified by column chromatography (silica gel, Hx: EtOAC = 1: 1) to obtain compound 4 (111.6 mg, 73% yield).

¹ H-NMR (500 MHz, CDCl ₃ ) δ 7.87~7.86 (m, 2H), 7.67~7.64 (m, 1H), 7.59~7.56 (m, 2H), 7.47~7.45 (m, 1H), 7.25 ( m, 1H), 7.08~7.05 (m, 1H), 6.49~6.47 (s, 1H), 4.01~3.98 (m, 2H), 3.97 (s, 3H), 3.27~3.25 (m, 2H,) ppm.

3. Synthesis of compound 5

According to Scheme 1, compound 1 of 5-methoxy-tryptamine (5-Methoxytryptamine, 100 mg, 0.53 mmol) in triethyl amine (triethylamine) and di-tert-butyl dicarbonate (di- tert -butyl dicarbonate, 172 mg, 0.79 mmol) was added and reacted at room temperature for one hour, extracted with ethyl acetate and brine _{, dried over anhydrous MgSO 4} , and filtered. The filtrate was concentrated and purified by column chromatography (silica gel, Hx: EtOAC = 1: 1) to obtain compound 5 (142.9 mg, 93% yield).

¹ H-NMR (500 MHz, CDCl ₃ ) δ 7.24~7.22 (m, 1H), 6.86~6.85 (m, 2H), 6.84 (m, 1H), 3.85 (s, 3H), 3.45~3.44 (m, 2H), 2.91-2.89 (m, 2H), 1.42 (s, 9H) ppm.

4. Synthesis of compound 6

Compound 6 was synthesized according to the known literature (G. Spadoni et al. 11, J. Pineal Res . 2006, 40 , 259269.), and based on this, compounds 7 to 10 were synthesized according to Scheme 2 below.

[Scheme 2]

4. Synthesis of compound 7

Following Reaction Scheme 2, triethylamine and acetylchloride (acetylchloride, 0.56 mL, 0.79 mmol) were added to Compound 6 (100 mg, 0.53 mmol) and reacted at room temperature for an hour, and then ethyl acetate ( ethyl acetate) and brine _{, dried over anhydrous MgSO 4} , and filtered. The filtrate was concentrated and purified by column chromatography (silica gel, Hx: EtOAC = 1: 1) to obtain compound 7 (95.4 mg, 77.5% yield).

¹ H-NMR (500 MHz, CDCl ₃ ) δ 7.21~7.19 (m, 1H), 7.00~6.99 (m, 1H), 6.99~6.97 (m, 1H), 6.19 (s, 1H), 3.82 (s, 3H), 3.60~3.56 (m, 2H), 2.96~2.94 (m, 2H), 1.93 (s, 3H) ppm.

5. Synthesis of compound 8

Following Reaction Scheme 2, triethylamine and butyl chloride (butylchloride, 0.83 mL, 0.79 mmol) were added to Compound 6 (100 mg, 0.53 mmol) and reacted at room temperature for an hour, and then ethyl acetate (ethyl acetate). acetate) and brine _{, dried over anhydrous MgSO 4} , and filtered. The filtrate was concentrated and purified by column chromatography (silica gel, Hx: EtOAC = 1: 1) to obtain compound 8 (99.3 mg, 72% yield).

¹ H-NMR (500 MHz, CDCl ₃ ) δ 7.20~7.18 (m, 1H), 6.99 (m, 1H), 6.78~6.77 (m, 1H), 6.18 (s, 1H), 3.82 (s, 3H) , 3.61~3.57 (m, 2H), 2.96~2.93 (m, 2H), 2.11~2.08 (m, 2H), 1.64~1.57 (m, 2H), 0.90~0.87 (m, 3H) ppm.

6. Synthesis of compound 9

Following Reaction Scheme 2, triethylamine and benzoylchloride (benzoylchloride, 0.92 mL, 0.79 mmol) were added to Compound 6 (100 mg, 0.53 mmol) and reacted at room temperature for an hour, and then ethyl acetate ( ethyl acetate) and brine _{, dried over anhydrous MgSO 4} , and filtered. The filtrate was concentrated and purified by column chromatography (silica gel, Hx: EtOAC = 1: 1) to obtain compound 9 (138.5 mg, 87% yield).

¹ H-NMR (500 MHz, CDCl ₃ ) δ 7.69~7.67 (m, 2H), 7.48~7.46 (m, 1H), 7.40~7.37 (m, 2H), 7.20~7.19 (m, 1H), 7.00 ( m, 1H), 6.79~6.77 (m, 1H), 6.24 (s, 1H), 3.82 (s, 3H), 3.80~3.77 (m, 2H), 3.08~3.05 (m, 2H) ppm.

7. Synthesis of compound 10

According to Scheme 2, the compound 6 (100 mg, 0.53 mmol) in triethyl amine (triethylamine), di-tert-butyl dicarbonate was added to one hour (di- tert -butyl dicarbonate, 172 mg , 0.79 mmol) After reacting at room temperature during the period, extraction was performed with ethyl acetate and brine _{, dried over anhydrous MgSO 4} , and filtered. The filtrate was concentrated and purified by column chromatography (silica gel, Hx: EtOAC = 1: 1) to obtain compound 10 (131 mg, 85% yield).

¹ H-NMR (500 MHz, CDCl ₃ ) δ 7.19~7.14 (m, 1H), 7.00 (m, 1H), 6.78~6.76 (m, 1H), 6.19 (s, 1H), 3.82 (s, 3H) , 3.47-3.45 (m, 2H), 2.94-2.92 (m, 2H), 1.41 (s, 9H) ppm.

8. Synthesis of control compounds

Control compounds MB-2 and MB-3 were synthesized according to Scheme 3 below.

[Scheme 3]

8-1) Synthesis of compound MB-2

Following Reaction Scheme 3, tetrahydrofuran (THF, 5 mL) and lithium aluminum hydride (lithium aluminum hydride, 1.4 mL, 1.35 mmol) were added to Compound 2 (157 mg, 0.67 mmol) for an hour. After the reaction was carried out by stirring while heating, water (2.5 mL) was added to terminate the reaction. This was extracted with ethyl acetate and brine _{, dried over anhydrous MgSO 4} , and filtered. The filtrate was concentrated and purified by column chromatography (silica gel, dichloromethane (CH ₂ Cl ₂ ): methanol (MeOH) = 9: 1 (1% ammonia (NH ₃ OH))) to form a white solid MB-2 (89.7 mg, 61% yield) was obtained.

¹ H-NMR (500 MHz, CDCl ₃ ) δ 7.22 (s, 1H), 7.21 (s, 1H) 7.06 (m, 1H) 7.01 (m, 1H), 6.81~6.79 (m, 1H), 3.26~3.23 (m, 2H), 3.14~3.11 (m, 2H), 2.98~ 2.93 (m, 2H), 1.36~1.33 (m, 3H) ppm.

8-2) Synthesis of compound MB-3

Following Reaction Scheme 3, tetrahydrofuran (THF, 5 mL) and lithium aluminum hydride (lithium aluminum hydride, 1.4 mL, 2.94 mmol) were added to Compound 3 (386 mg, 1.48 mmol) for an hour. After the reaction was stirred while heating, water (2.5 mL) was added to terminate the reaction. This was extracted with ethyl acetate and brine _{, dried over anhydrous MgSO 4} , and filtered. The filtrate was concentrated and purified by column chromatography (silica gel, CH ₂ Cl ₂ : MeOH = 9: 1 (1% NH ₃ OH)) to give MB-3 (231.4 mg, 63.4% yield) as a white solid. .

¹ H-NMR (500 MHz, CDCl ₃ ) δ 7.18 (s, 1H), 7.24~7.20 (m, 2H), 7.04~6.75 (m, 1H), 6.85 (s, 1H), 6.75~6.73(m, 1H), 3.73(s, 1H), 3.12~3.11(m, 2H), 2.98~2.95(m, 2H), 2.70~2.67(m, 2H), 1.63~1.56(m, 2H), 1.24~1.20( m, 4H), 0.79 to 0.76 (m, 3H) ppm.

In addition, control compounds MLB-2 and MLB-3 were synthesized according to Scheme 4 below.

[Scheme 4]

8-3) Synthesis of compound MLB-2

Following Scheme 4, tetrahydrofuran (THF, 5 mL) and lithium aluminum hydride (lithium aluminum hydride, 1.3 mL, 1.29 mmol) were added to Compound 7 (150 mg, 0.64 mmol) for an hour. After the reaction was stirred while heating, water (2.5 mL) was added to terminate the reaction. This was extracted with ethyl acetate and brine _{, dried over anhydrous MgSO 4} , and filtered. The filtrate was concentrated and purified by column chromatography (silica gel, CH ₂ Cl ₂ : MeOH = 9: 1 (1% NH ₃ OH)) to give MLB-2 as a brown solid (84 mg, 60% yield). .

¹ H-NMR (500 MHz, CDCl ₃ ) δ 7.24~7.19 (m, 2H), 7.04 (s, 1H), 6.93 (s, 1H), 6.77~6.75 (m, 1H), 3.75 (s, 3H) , 3.20-3.18 (m, 2H), 3.08-3.07 (m, 2H), 2.91-2.90 (m, 2H), 1.32-1.30 (m, 3H) ppm.

8-4) Synthesis of compound MLB-3

Following Scheme 4, tetrahydrofuran (THF, 5 mL) and lithium aluminum hydride (lithium aluminum hydride, 1.5 mL, 1.52 mmol) were added to Compound 8 (200 mg, 0.76 mmol) for one hour. After the reaction was stirred while heating, water (2.5 mL) was added to terminate the reaction. This was extracted with ethyl acetate and brine _{, dried over anhydrous MgSO 4} , and filtered. The filtrate was concentrated and purified by column chromatography (silica gel, CH ₂ Cl ₂ : MeOH = 9: 1 (1% NH ₃ OH)) to give MLB-3 (109.9 mg, 63.4% yield) as a brown solid. .

¹ H-NMR (500 MHz, CDCl ₃ ) δ 7.23 (s, 1H), 7.10~7.09 (m, 1H), 7.04 (s, 1H), 3.81 (s, 3H), 3.34~3.32 (m, 2H) , 3.21~3.17 (m, 2H), 2.93~2.89 (m, 2H), 1.34~1.30 (m, 4H), 0.85~0.82 (m, 3H) ppm.

8-5) Synthesis of compound MC-1

[Scheme 5]

According to Scheme 5, compound 1, 5-methoxytryptamine (5-Methoxytryptamine, 500 mg, 2.63 mmol), N-carbobenzoyloxyglycine (N-carbobenzoxyglycine, 1.1 g, 5.3 mmol), 1-ethyl-3 -(3-dimethylaminopropyl)carbodiimide (1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide, EDCI, 1.0 g, 5.3 mmol), triethylamine (364.3 μl, 2.6 mmol), 4-dimethyl Aminopyridine (4-dimethylaminopyridine, DMAP, 32.1 mg, 0.26 mmol) and dichloromethane (13 mL) were added and reacted at room temperature for 30 minutes. Then, it was extracted with ethyl acetate and brine _{, dried over anhydrous MgSO 4} , and filtered. The filtrate was concentrated and purified by column chromatography (silica gel, Hx: EtOAC = 1: 1) to obtain a brown solid compound 11 (901 mg, 90% yield).

The compound 11 (300 mg, 0.79 mmol) and Pd(OH) _{2 /} C (11.1 mg, 0.08 mmol) were mixed, and methanol (2.6 mL) and hydrogen (H ₂ ) were injected. After 2 hours, Celite was filled in a vacuum filtration funnel, and filtered under reduced pressure with MeOH (100 mL). After the filtrate was concentrated under vacuum conditions, hydrogen chloride (1 mL) prepared by stirring dichloromethane (5 mL), methanol (1 mL), and acetyl chloride (1 mL) was slowly injected. Then, it was filtered under reduced pressure with ethyl acetate (100 mL) once more to obtain MC-1 (189.4 mg, 97% yield) as a white solid.

<Example 2> Confirmation of anti-inflammatory effects of melatonin and melatonin derivatives

In order to confirm the anti-inflammatory effect of the melatonin and the melatonin derivative synthesized in Example 1, Raw 264.7 cells were first obtained from Korean Cell Line Bank (KCLB) and 10% fetal bovine serum (FBS, Gibco BRL), penicillin 100 U / ml / streptomycin 100 μg / ml) was cultured in a medium (Dulbecco's Modified Eagle's, DMEM, Gibco BRL) containing. Lipopolysaccharide (LPS) and Grease reagents were purchased from Sigma-Aldrich and used. In the presence of 1 μg/mL LPS, Raw 264.7 cells were separated into a reagent-treated group and a non-treated group, and the melatonin and the melatonin derivative synthesized in Example 1 were treated in the treatment group for 24 hours to prepare an inflammation model.

1. Confirmation of NO production inhibitory effect and cytotoxicity

In the inflammation model prepared above, the melatonin and melatonin derivatives prepared in Example 1 were treated by concentration, and the amount of nitrite in the culture medium was measured at 540 nm absorbance using a Grease reagent to confirm the anti-inflammatory effect. . The analysis of nitric oxide (NO) production is a known method (Hwang, SJ, YW Kim, Y. Park, HJ Lee, KW Kim. 2014 Anti-inflammatory effects of chlorogenic acid in lipopolysaccharide-stimulated RAW 264.7 cells.Inflammation research 63 :81-90.).

As a result, as shown in FIG. 2, all melatonin derivatives except for melatonin, which is compound 2 of FIG. 1, were more effective in inhibiting NO production in a concentration-dependent manner than conventional melatonin.

In addition, in order to confirm whether the NO production inhibitory effect of the melatonin derivative is due to cytotoxicity, cell viability was confirmed. Cells by a known method (Hwang, SJ, YW Kim, Y. Park, HJ Lee, KW Kim. 2014 Anti-inflammatory effects of chlorogenic acid in lipopolysaccharide-stimulated RAW 264.7 cells.Inflammation research 63:81-90.) Viability analysis was performed. Cell viability at 490 nm absorbance by adding 20 μl cell titer 96 Aqueous One Solution Reagent (celltiter 96 Aqueous One Solution Reagent, Promega, Madison, WI) 24 hours after treating Raw 264.7 cells with the desired amount of melatonin derivative for each experiment. Was measured. As a result, cytotoxicity of melatonin derivatives 4, 5, 6, 8, 9 and 10 was observed. Therefore, it was confirmed that melatonin derivatives 1, 3, and 7 exhibit the inhibitory effect of NO production without cytotoxicity.

2. Confirmation of inhibitory effect on inflammatory factors

After treatment with melatonin derivatives 1, 3 or 7 in the inflammation model prepared in Example 2, inflammatory cytokines, monocyte chemoattractant protein-1 (MCP-1), IL-6, IL-1β, Expression of COX-2 and TNF-α was confirmed by RT-PCR.

RT-PCR analysis is a known method (Hwang, SJ, YW Kim, Y. Park, HJ Lee, KW Kim. 2014 Anti-inflammatory effects of chlorogenic acid in lipopolysaccharide-stimulated RAW 264.7 cells.Inflammation research 63:81- 90.). The PCR primers used in the present invention are shown in Table 1 below, and were purchased from Bioneer.

designation direction sequence Sequence number IL-1β forward (forward) aagggctgcttccaaacctttgac One reverse tgcctgaagctcttgttgatgtgc 2 TNF-α forward (forward) catcttctcaaaattcgagtgacaa 3 reverse tgggagtagacaaggtacaaccc 4 COX-2 forward (forward) ttcaaaagaagtgctggaaaaggt 5 reverse gatcatctctacctgagtgtcttt 6 IL-6 forward (forward) gaggataccactcccaacagacc 7 reverse aagtgcatcatcgttgttcataca 8 MCP-1 forward (forward) cttctgggcctgctgttca 9 reverse ccagcctactcattgggatca 10 GAPDH forward (forward) gagctgaacgggaagctactgg 11 reverse ccaccttcttgatgtcatcat 12

To confirm PCR amplification, the PCR product was separated on a 1.5% agarose gel using β-actin as an internal control, visualized with RedSafe nucleic acid staining (Intron, Korea) and confirmed by UV irradiation. .

As a result, as shown in Figure 3, it was found that the expression of MCP-1, IL-6, COX-2, TNF-α significantly decreased. Therefore, it was confirmed that the melatonin derivatives according to the present invention exhibit excellent anti-inflammatory effects compared to melatonin.

<Example 3> Confirmation of histamine secretion inhibitory effect induced by Compound 48/80 in mast cells

In order to investigate the inhibitory effect of the melatonin derivative on histamine, the human mast cell line HMC-1 was first distributed in the Department of Immunology, Chonbuk National University College of Medicine, and 10% fetal bovine serum (FBS) and 1% penicillin/strepto. IMEM (Iscove's Modified Dulbecco's Media) containing mycin (penicillin/streptomycin) was used as a culture medium and cultured at 37°C and 5% CO₂.

^{The melatonin and melatonin derivatives prepared in Example 1 were treated with 3×10 6} HMC-1s thus cultured, incubated at 37°C for 30 minutes, and then Compound 48/80 was added by 300 μg/ml for 20 minutes. Reacted. The cells treated with Compound 48/80 were lightly centrifuged to collect the supernatant, and the histamine contained in the supernatant was measured after reacting with O-phthaladehyde (OPT).

That is, in order to measure the amount of histamine contained in the supernatant _{, 2 ml of 0.5N perchloric acid (HClO 4} ) was added to 500 μl of the supernatant, mixed, and centrifuged at 12,000 rpm for 20 minutes. To 2 ml of the centrifuged supernatant, 0.2 ml of 6N sodium hydroxide (NaOH), 3.3 ml of buthanol-chloroform (3:2), and sodium chloride (NaCl) were added, followed by centrifugation at 3,000 rpm for 10 minutes. Thereafter, 3 ml of n-heptane and 1.2 ml of 0.1N hydrogen chloride (HCl) were added to the upper 3 ml of the centrifuged supernatant, mixed, boiled at 100°C for 10 minutes, and then centrifuged at 3,000 rpm for 5 minutes. The lower layer was collected with a Pasteur pipette. Add 1 ml of 0.1N HCl, 0.3 ml of 1N NaOH, and 0.2 ml of 0.2% OPT to the collected solution, react in a cool and dark place for 45 minutes, and then _{add 0.28 ml of 0.5N sulfuric acid (H 2} SO ₄ ) to terminate the reaction, and then fluorescence. The amount of fluorescence was measured using a quartz cuvette at excitation 350 nm and emission 440 nm with a photometer (Spectrofluorophotometer, Shimadzu, Japan).

As a result, as shown in FIG. 4, the histamine inhibitory effect of melatonin derivatives 1, 3, and 7 was observed, and in particular, it was confirmed that the melatonin derivative 7 exhibited a histamine inhibitory effect superior to that of melatonin.

<Example 4> Confirmation of anticancer effect of melatonin and melatonin derivatives

1. Confirmation of anticancer effect in HCT116, a colon cancer cell line, in vitro

In order to verify the anticancer effect of the melatonin and melatonin derivatives prepared in Example 1 on the HCT-116 colorectal cancer cell line, the cell viability was measured by the Thiazolyl Blue Tetrazolium Bromide (MTT) assay, and known for this purpose. The experiment was performed as follows by applying the method described in the document (Lee HY et al., (2013) Cancer Lett. 332:102-109). The colorectal cancer cell line HCT-116 was purchased from the Korean Cell Line Bank. HCT-116 cells were heat-inactivated 10% fetal bovine serum (FBS), 100 units/mL penicillin, 100 μg/mL streptomycin and 250 ng/mL amphotericin B. Using RPMI 1640 medium containing (amphotericin B), it was subcultured 1 to 2 times a week at _{37° C. and 5% carbon dioxide (CO 2 ).} All cells were dissolved in liquid nitrogen, passed through three or more passages, and used in the experiment.

The colon cancer cell line was dispensed into each well of a 96-well plate by 200 µl (2 x 10 ⁴ cells/ml) and cultured for one day. The next day, melatonin and a melatonin derivative were added to dimethyl sulfoxide (DMSO) at a concentration of 0.125 mM to 2 mM, and cultured for 3 days. However, DMSO was used so as not to exceed 10% of the medium. The group treated with only DMSO without a sample was used as a negative control (zero-day control). The cultured cells were treated with 20 μl of 5 mg/ml MTT solution and cultured for an additional 4 hours, after which the medium was removed, impurities were removed with phosphate buffered saline (PBS), and then 200 μl of DMSO was added. After stirring in a stirrer for 15 minutes, the absorbance was measured at 590 nm. When cultured in 10% DMSO was used as a control, the cell viability according to the treatment of each test substance was measured using Equation 1 below.

[Equation 1]

% Survival rate = (OD(sample)-OD(0-day))/ (OD(10% DMSO)-OD(0-day)) X 100

When 100% of the control group was not treated with the sample, the value of the sample treatment group was expressed as a percentage of the control group, and each test substance treatment was calculated as the mean value ± SEM of the double or triple test. The IC ₅₀ value is the concentration of the test substance for 50% survival.

As a result, as shown in FIG. 5, except for melatonin derivatives 7, MB-2, and MC-1, all of them showed superior anticancer effects than conventional melatonin. In particular, it showed significant anticancer activity even at a low concentration of 1 mM or less, of which derivative No. 10 showed significant anticancer activity.

2. Confirmation of anticancer effect on cervical cancer, breast cancer, lung cancer, and colon cancer cell lines

The anticancer effect on human cervical cancer, breast cancer, lung cancer, and colon cancer cell lines with respect to the melatonin derivative No. 10 identified in the above Example was confirmed by the MTT (Thiazolyl Blue Tetrazolium Bromide) analysis method of Example 4 above. Human cervical cancer cell line HeLa, lung cancer cell line A549 and breast cancer cell line MDA-MB-231 were pre-sale from the American cell line bank (ATCC, Manassas, VA, USA). HCT116, HeLa, A549 and MDA-MB-231 cells were thermally inactivated with 10% Fetal Bovine Serum (FBS), 100 units/mL penicillin, 100 μg/mL streptomycin and Using RPMI 1640 medium containing 250 ng/mL amphotericin B, it was subcultured once to twice a week at _{37°C and 5% CO 2.} All cells were dissolved in liquid nitrogen, passed through three or more passages, and used in the experiment.

As a result, as shown in FIG. 6, the melatonin 10 derivative showed a broad anticancer effect. In particular, the rest of the cell lines for colon cancer, breast cancer, and cervical cancer excluding lung cancer cell lines showed significantly superior anticancer activity compared to melatonin.

3. Molecular mechanism analysis of anticancer effects of melatonin derivatives

In order to analyze the molecular mechanism of the anticancer effect exhibited by the melatonin derivative, the colon cancer cell line HCT-116 was treated with the melatonin and melatonin derivatives 1 to 10 prepared in Example 1, and its anticancer effect was confirmed by western blot. I did. Western analysis was performed by a known method (2014, Inflammation research 63:81-90.). Specifically, Western blot was performed as follows: a primary antibody specific for phosphorylated protein kinase B (phospho-AKT, pAKT, Cell Signaling) and AKT (Cell Signaling) protein was used. Anti-rabbit horseradish peroxidase binding secondary antibody was purchased from Pierce Chemical Co., and was used as an electrogenerated chemiLuminescence plus reagent (ECL Plus reagent, Amersham Biosciences, USA). After color development, it was detected using a Fusion equipment (Vilber Lourmat, FR). Ponceau S solution was purchased from Sigma.

As a result, as shown in FIG. 7, it was confirmed that the anticancer effect of the melatonin derivative is because it inhibits the signaling system of protein kinase B (AKT), which plays a role in inhibiting apoptosis and promoting cell proliferation. In particular, derivative No. 10, which showed the most excellent anticancer activity, also showed the best ability to inhibit phosphorylation of AKT.

In many cancer cells, the activity of HIF-1α is increased regardless of hypoxia. Although some cancer cells become hypoxic due to rapid proliferation, and their adaptation increases the activity of HIF-1α, even if they are not in a hypoxic state, the proliferation signal transduction system is constantly increased due to genetic mutation, etc. It shows a state of increased activity. Therefore, it is very important to reduce the expression of HIF-1α in the treatment of cancer cells.

After treating the melatonin derivatives 1, 3, 7, 8, which were shown to have relatively low anticancer activity in FIG. 3 of the above example, on the HCT-116 cell line, hypoxia-inducible factor-1 alpha, HIF-1α ) Was confirmed.

Specifically, Western blot was performed as follows: HIF-1a (BD), tubulin (Tubulin, Santa Cruz) protein-specific primary antibodies were used. Anti-mouse horseradish peroxidase-binding secondary antibody was purchased from Pierce Chemical Co., and developed with Electrogenerated ChemiLuminescence Plus reagent (ECL Plus reagent, Amersham Biosciences, USA). Then, it was detected using a fusion equipment (Vilber Lourmat, FR). Ponceau S solution was purchased from Sigma.

As a result, as shown in FIG. 8, when the melatonin derivative was treated, the expression of HIF-1α was significantly reduced, and in particular, derivatives 3 and 8 inhibited the expression of HIF-1α more than the existing melatonin.

As described above, specific parts of the present invention have been described in detail, and for those of ordinary skill in the art, it will be apparent that these specific techniques are only preferred embodiments, and the scope of the present invention is not limited thereby. will be. Therefore, it will be said that the practical scope of the present invention is defined by the appended claims and their equivalents.

<110> inje university industry-academic cooperation foundation <120> Composition for Preventing or Treating Inflammatory Disease, Allergic Disease or Cancer Comprising Melatonin Derivative <130> ADP-2018-0135 <160> 12 <170> KoPatentIn 3.0 <210> 1 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 aagggctgct tccaaacctt tgac 24 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 tgcctgaagc tcttgttgat gtgc 24 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 catcttctca aaattcgagt gacaa 25 <210> 4 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 tgggagtaga caaggtacaa ccc 23 <210> 5 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 ttcaaaagaa gtgctggaaa aggt 24 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 gatcatctct acctgagtgt cttt 24 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 gaggatacca ctcccaacag acc 23 <210> 8 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 aagtgcatca tcgttgttca taca 24 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 cttctgggcc tgctgttca 19 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 ccagcctact cattgggatc a 21 <210> 11 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 gagctgaacg ggaagctact gg 22 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 ccaccttctt gatgtcatca t 21

Claims (4)

A pharmaceutical composition for preventing or treating cancer diseases, which comprises a melatonin derivative represented by the following formula (1) or (2) as an active ingredient:
[Chemical Formula 1]

Wherein R &lt; ¹ &gt; is at least one selected from the group consisting of benzoyl and (C1-C4) alkoxycarbonyl,
(2)

Wherein R ² is at least one selected from the group consisting of hydrogen, (C ² -C 4) alkylcarbonyl, benzoyl and (C 1 -C 4) alkoxycarbonyl. The method according to claim 1,
Wherein the melatonin derivative is contained in an amount of 0.1 to 50 parts by weight based on 100 parts by weight of the total amount of the pharmaceutical composition. The method according to claim 1,
Wherein the cancer is selected from the group consisting of brain tumor, benign astrocytoma, malignant astrocytoma, pituitary adenoma, meningioma, brain lymphoma, oligodendroglioma, intracranial lesion, ependymoma, brain tumor, head and neck tumor, laryngeal cancer, Cancer, breast cancer, breast cancer, gastric cancer, liver cancer, gallbladder cancer, biliary cancer, pancreatic cancer, small bowel cancer, pancreatic cancer, breast cancer, pancreatic cancer, cancer, hypopharyngeal cancer, thyroid cancer, oral cancer, thoracic tumor, small cell lung cancer, non- Ovarian cancer, uterine sarcoma, vaginal cancer, female germ cell cancer, female urethral cancer, colon cancer, colon cancer, rectal cancer, anal cancer, bladder cancer, kidney cancer, male genital tumor, penile cancer, prostate cancer, female genital tumor, cervical cancer, And skin cancer. &Lt; RTI ID = 0.0 &gt; 11. &lt; / RTI &gt; A health food for preventing or ameliorating cancer diseases, comprising a melatonin derivative represented by the following formula (1) or (2) as an active ingredient:
[Chemical Formula 1]

Wherein R &lt; ¹ &gt; is at least one selected from the group consisting of benzoyl and (C1-C4) alkoxycarbonyl,
(2)

Wherein R ² is at least one selected from the group consisting of hydrogen, (C ² -C 4) alkylcarbonyl, benzoyl and (C 1 -C 4) alkoxycarbonyl.

Images