KR101861081B1 - Composition for Preventing or Treating Inflammatory Disease, Allergic Disease or Cancer Comprising Melatonin Derivative - Google Patents

Abstract

The present invention relates to a pharmaceutical composition comprising a melatonin derivative, a health food or a cosmetic composition, wherein the melatonin derivative is treated with an inflammatory model to exhibit anti-inflammatory activity inhibiting the production of NO and the expression of an inflammatory cytokine, (AKT) and extracellular signal-regulated kinases (ERK) signaling pathways in the treatment of cancer cells, and inhibit histamine-mediated allergic responses by inhibiting histamine- Since it has an anticancer activity inhibiting the expression of Hypoxia-inducible factor-1 alpha (HIF-1 alpha), it is useful as a therapeutic agent, cosmetic composition or health food in the treatment of inflammatory diseases, allergic diseases or cancer diseases .

Description

TECHNICAL FIELD [0001] The present invention relates to a composition for preventing or treating inflammatory diseases, allergic diseases or cancer diseases comprising melatonin derivatives,

The present invention relates to a composition for preventing or treating an inflammatory disease, an allergic disease, and a composition for preventing or treating cancer, which comprises a melatonin derivative.

Inflammation is the expression of a normal and protective in vivo defense that occurs locally in response to physical trauma, harmful chemicals, microbial infections, or tissue damage caused by irritants in the body's metabolites. These inflammations are triggered by various chemical mediators produced from damaged tissues and migrating cells, and these chemical mediators are known to have a wide variety of types depending on the type of inflammation process. In normal cases, the organism reverses normal structure and function by neutralizing or eliminating the onset factor and regenerating the upper tissue through the inflammatory reaction.

However, when such an inflammatory reaction occurs abnormally, it may progress to a disease such as chronic inflammation, and when the inflammation is improperly induced by an autoimmune reaction such as a harmless substance such as pollen, asthma or rheumatoid arthritis, Rather, it damages the tissue and causes various diseases.

In general, inflammatory reactions can be observed in almost all clinical diseases. Among these inflammatory diseases, there are bacterial diseases that can be cured by antibiotic treatment, but most of them are due to tissue damage due to autoimmune reaction. It is known as an incurable disease. As a cause of such inflammation, various biochemical phenomena are involved, and various techniques for inhibiting the inflammation have been studied.

Macrophages, for example, are cells that play important roles in the inflammatory response by producing a variety of cytokines and NOs in response to chemical stimuli. In particular, inducible nitric oxide synthase (iNOS) expressed by cytokine stimuli such as lipopolysaccharide (LPS), interferon γ, and tumor necrosis factor-α (TNF-α) (NF), which is a nuclear factor kappa-light-chain-enhancer of activated B cells (NF), which is a transcription factor of the inflammatory response inhibited by IκB < / RTI > B) activity. Activated NF-κB translocates to the nucleus and induces the inducible NO synthase (iNOS), prostaglandin-endoperoxide synthase-2 (COX-2) and interleukin- 1β, IL-1β) and TNF-α, and it is known that inhibition of these factors inhibits the inflammatory response (Baeuerle et al. Annu. Rev. Immunol., 12: 141-179, 1994).

Nitric oxide (NO) is produced by three major nitrogen oxide synthase (NOS) isomers, neuronal NOS (nNOS), endothelial NOS (eNOS) and inducible NOS (iNOS) (L-arginine). While nNOS and eNOS are regulated by Ca ²⁺ / calmodulin, iNOS is regulated at the transcription level by inflammatory stimuli such as interleukin, interferon, and LPS. Nitric oxide produced by nNOS or eNOS is responsible for normal physiological function such as vasodilation, neurotransmission, cell destruction to pathogen, etc. However, overexpressed nitrogen oxide by macrophage iNOS causes various pathologies including inflammation and cancer When peroxynitrite is formed by reacting with superoxide, NF-κB acts as a strong oxidizing agent and damages the cells. In macrophages activated by inflammatory stimuli, NF-κB (Rice et al., 2002), and the presence of atherosclerotic plaques in the brain, as well as in inflammatory responses, cancer, and arteriosclerosis (Lawrence et al., Nat Med., 7: 1291-1297, 2001; Riehemann et al. 94, 1999; Stamler et al., Science, 258: 1898-1902, 1992).

IL-6, a multimodal pleiotropic cytokine, has been implicated in inflammatory bowel disease, arthritis, experimental autoimmune encephalomyelitis, multicentric Castleman's disease, Induced lupus and plasmacytomas. COX-2 is thought to be a major cause of arthritis and lupus. Thus, selective inhibitors for these can be widely used.

However, until now, the most common inflammatory diseases for the treatment of inflammatory diseases are steroidal and non-steroidal inflammatory disease preventive or therapeutic agents, and synthetic or therapeutic agents are mainly used for various side effects In many cases.

Therefore, there is an urgent need to develop a novel inflammatory disease with excellent efficacy and few side effects.

1. Korean Patent No. 10-0597211.

It is an object of the present invention to provide a pharmaceutical composition comprising novel compounds derived from melatonin, which is a biological hormone, for effectively preventing or treating inflammatory diseases, allergic diseases and cancer diseases.

Another object of the present invention is to provide a health food or cosmetic composition comprising a novel compound derived from melatonin, which is a biohormone, in order to effectively prevent or ameliorate inflammatory diseases, allergic diseases and cancer diseases.

In order to achieve the above object, the present invention provides a pharmaceutical composition for preventing or treating an inflammatory disease comprising a melatonin derivative as an active ingredient.

In order to accomplish the above-mentioned other objects, the present invention provides a health food for preventing or ameliorating an inflammatory disease comprising melatonin derivative as an active ingredient.

In order to achieve still another object of the present invention, there is provided a cosmetic composition for preventing or improving an inflammatory disease, comprising a melatonin derivative as an active ingredient.

In order to accomplish still another object of the present invention, there is provided a pharmaceutical composition for preventing or treating an allergic disease comprising a melatonin derivative as an active ingredient.

According to another aspect of the present invention, there is provided a health food for preventing or ameliorating an allergy disease comprising melatonin derivative as an active ingredient.

In order to accomplish still another object of the present invention, there is provided a cosmetic composition for preventing or treating an allergic disease comprising a melatonin derivative as an active ingredient.

In order to accomplish the above-mentioned further object, the present invention provides a pharmaceutical composition for preventing or treating cancer diseases comprising melatonin derivative as an active ingredient.

In order to achieve the above-mentioned further object, the present invention provides a health food for preventing or ameliorating cancer diseases, which comprises a melatonin derivative as an active ingredient.

The melatonin derivative is represented by the following formula (1) or (2).

[Chemical Formula 1]

Wherein R ¹ is at least one member selected from the group consisting of hydrogen, (C 2 -C 4) alkylcarbonyl, benzoyl and (C 1 -C 4) alkoxycarbonyl,

(2)

Wherein R ² is at least one selected from the group consisting of hydrogen, (C 1 -C 4) alkylcarbonyl, benzoyl and (C 1 -C 4) alkoxycarbonyl.

The melatonin derivative according to the present invention exhibits an anti-inflammatory activity that inhibits the production of NO and the expression of inflammatory cytokines when treated with an inflammation model and inhibits histamine mediated allergy by inhibiting histamine secreted from mast cells Inhibits the signal transduction pathway of protein kinase B (AKT) and extracellular signal-regulated kinases (ERK) during treatment with cancer cells. Hypoxia-inducible factor-1 alpha, HIF-1?). Therefore, it can be effectively used as a therapeutic agent, a cosmetic composition, or a health food, which has a small side effect in the treatment of an inflammatory disease, an allergic disease or a cancer disease.

1 shows the structural formulas of melatonin and melatonin derivatives synthesized in the present invention;
2 is a bar graph showing the NO production inhibitory effect of a melatonin derivative according to one embodiment of the present invention;
FIG. 3 shows the inflammatory factor inhibitory effect of the melatonin derivative according to the embodiment of FIG. 2;
4 is a histogram showing the histamine inhibitory effect of melatonin derivatives according to another embodiment of the present invention;
FIG. 5 is a table showing the antitumor effect of melatonin derivatives in colorectal cancer cells according to another embodiment of the present invention;
FIG. 6 is a table showing antitumor effects of melatonin derivatives according to the embodiment of FIG. 5 in cervical cancer, breast cancer, lung cancer, and colorectal cancer cells;
FIG. 7 shows the results of analysis of the antitumor effect mechanism of the melatonin derivatives according to the embodiment of FIG. 5; And
FIG. 8 shows the effect of the melatonin derivative according to the embodiment of FIG. 5 on the expression of Hypoxia-inducible factor 1-alpha (HIF-1α) in colorectal cancer cells.

The inventors of the present invention synthesized a derivative having a side chain at position 3 of the melatonin indole nucleus and a derivative having a side chain at position 2, and found that the derivative exhibited anti-inflammatory, anti-allergic and anti-cancer effects. .

The present invention provides a pharmaceutical composition for preventing or treating an inflammatory disease comprising a melatonin derivative represented by the following general formula (1) or (2) as an active ingredient.

[Chemical Formula 1]

Wherein R ¹ is at least one member selected from the group consisting of hydrogen, (C 2 -C 4) alkylcarbonyl, benzoyl and (C 1 -C 4) alkoxycarbonyl,

(2)

Wherein R ² is at least one selected from the group consisting of hydrogen, (C 1 -C 4) alkylcarbonyl, benzoyl and (C 1 -C 4) alkoxycarbonyl.

According to one embodiment of the present invention, when the inflammatory model induced by LPS is treated with the melatonin derivative, production of NO and inflammatory cytokines such as monocyte chemoattractant protein-1 (MCP-1), interleukin 6 (Interleukin-6), COX-2 and TNF-a. That is, the melatonin derivative can be used as an effective pharmaceutical composition capable of alleviating inflammatory diseases.

The melatonin derivative may be contained in an amount of 0.1 to 50 parts by weight based on 100 parts by weight of the total amount of the pharmaceutical composition. When the content of the melatonin derivative is less than 0.1 part by weight, the melatonin derivative does not exhibit the anti-inflammatory effect. Is not preferable because the anti-inflammatory effect is significantly reduced compared to the content of the melatonin derivative.

The inflammatory diseases to which the pharmaceutical composition can be applied include sweat, dermatitis, conjunctivitis, periodontitis, rhinitis, otitis, sore throat, tonsillitis, pneumonia, gastric ulcer, gastritis, Crohn's disease, colitis, hemorrhoids, gout, ankylosing spondylitis, rheumatic fever, , Fibromyalgia, psoriatic arthritis, osteoarthritis, rheumatoid arthritis, shoulder inflammation, nephritis, hay fever, tendinitis, myositis, hepatitis, cystitis, nephritis, sjogren's syndrome, multiple sclerosis and acute or chronic inflammatory diseases , But is not limited thereto.

The present invention also provides a health food for preventing or ameliorating an inflammatory disease comprising a melatonin derivative represented by the following general formula (1) or (2) as an active ingredient.

[Chemical Formula 1]

Wherein R ¹ is at least one member selected from the group consisting of hydrogen, (C 2 -C 4) alkylcarbonyl, benzoyl and (C 1 -C 4) alkoxycarbonyl,

(2)

Wherein R ² is at least one selected from the group consisting of hydrogen, (C 1 -C 4) alkylcarbonyl, benzoyl and (C 1 -C 4) alkoxycarbonyl.

The present invention also provides a cosmetic composition for preventing or improving an inflammatory disease, comprising a melatonin derivative represented by the following general formula (1) or (2) as an active ingredient.

[Chemical Formula 1]

Wherein R ¹ is at least one member selected from the group consisting of hydrogen, (C 2 -C 4) alkylcarbonyl, benzoyl and (C 1 -C 4) alkoxycarbonyl,

(2)

Wherein R ² is at least one selected from the group consisting of hydrogen, (C 1 -C 4) alkylcarbonyl, benzoyl and (C 1 -C 4) alkoxycarbonyl.

The present invention also provides a pharmaceutical composition for preventing or treating an allergic disease comprising a melatonin derivative represented by the following general formula (1) or (2) as an active ingredient.

[Chemical Formula 1]

Wherein R ¹ is at least one member selected from the group consisting of hydrogen, (C 2 -C 4) alkylcarbonyl, benzoyl and (C 1 -C 4) alkoxycarbonyl,

(2)

Wherein R ² is at least one selected from the group consisting of hydrogen, (C 1 -C 4) alkylcarbonyl, benzoyl and (C 1 -C 4) alkoxycarbonyl.

According to another embodiment of the present invention, when the melatonin derivative according to the present invention is treated in a mast cell, the effect of suppressing the secretion of histamine induced by Compound 48/80 is shown. Compound 48/80 causes degranulation when treated with human mast cells, which inhibits inflammatory factors such as histamine and serotonin originally possessed by mast cells, as well as newly synthesized proinflammatory cytokines, prostaglandins, and leukotrienes Is a low molecular weight polymer that emits light. As histamine is one of the major causes of allergic diseases, the pharmaceutical composition containing the melatonin derivative of the present invention can alleviate allergic diseases by inhibiting the production or release of histamine.

In this case, the melatonin derivative may be contained in an amount of 0.1 to 50 parts by weight based on 100 parts by weight of the total amount of the pharmaceutical composition. When the amount of the melatonin derivative is more than the above range and less than 0.1 part by weight, the melatonin derivative may not exhibit anti- When the amount of the melatonin derivative is more than 50 parts by weight, the antiallergic effect is significantly decreased compared to the content of the melatonin derivative.

The above-mentioned allergic diseases include asthma, urticaria, anaphylaxis, food allergy, drug allergy, allergy-free blood transfusion reaction, and atopic dermatitis. But are not limited to, one or more selected from the group consisting of allergic rhinitis, allergic conjunctivitis, allergic dermatitis, allergic contact dermatitis and dermatitis.

The present invention also provides a health food for preventing or ameliorating allergic diseases, comprising a melatonin derivative represented by the following general formula (1) or (2) as an active ingredient.

[Chemical Formula 1]

Wherein R ¹ is at least one member selected from the group consisting of hydrogen, (C 2 -C 4) alkylcarbonyl, benzoyl and (C 1 -C 4) alkoxycarbonyl,

(2)

Wherein R ² is at least one selected from the group consisting of hydrogen, (C 1 -C 4) alkylcarbonyl, benzoyl and (C 1 -C 4) alkoxycarbonyl.

The present invention also provides a cosmetic composition for preventing or improving an allergic disease, which comprises a melatonin derivative represented by the following general formula (1) or (2) as an active ingredient.

[Chemical Formula 1]

Wherein R ¹ is at least one member selected from the group consisting of hydrogen, (C 2 -C 4) alkylcarbonyl, benzoyl and (C 1 -C 4) alkoxycarbonyl,

(2)

Wherein R ² is at least one selected from the group consisting of hydrogen, (C 1 -C 4) alkylcarbonyl, benzoyl and (C 1 -C 4) alkoxycarbonyl.

The present invention also provides a pharmaceutical composition for preventing or treating cancer, comprising a melatonin derivative represented by the following general formula (1) or (2) as an active ingredient.

[Chemical Formula 1]

Wherein R ¹ is at least one member selected from the group consisting of hydrogen, (C 2 -C 4) alkylcarbonyl, benzoyl and (C 1 -C 4) alkoxycarbonyl,

(2)

Wherein R ² is at least one selected from the group consisting of hydrogen, (C 1 -C 4) alkylcarbonyl, benzoyl and (C 1 -C 4) alkoxycarbonyl.

According to another embodiment of the present invention, when the melatonin derivative according to the present invention is treated to lung cancer or colon cancer cells, the melatonin derivative may inhibit protein kinase B (AKT) and extracellular signal-regulated kinases , ERK) signaling system. Therefore, the melatonin derivative according to the present invention can be used as a pharmaceutical composition for preventing or treating cancer having an excellent therapeutic effect.

The melatonin derivative may be contained in an amount of 0.1 to 50 parts by weight based on 100 parts by weight of the total amount of the pharmaceutical composition. If the amount of the melatonin derivative is out of the above range, the antitumor effect of the melatonin derivative may not be exhibited or the increase in the therapeutic effect may be insignificant It is not preferable.

Wherein the cancer is selected from the group consisting of brain tumor, benign astrocytoma, malignant astrocytoma, pituitary adenoma, meningioma, brain lymphoma, oligodendroglioma, intracranial lesion, ependymoma, brain tumor, head and neck tumor, laryngeal cancer, Cancer, breast cancer, breast cancer, gastric cancer, liver cancer, gallbladder cancer, biliary cancer, pancreatic cancer, small bowel cancer, pancreatic cancer, breast cancer, pancreatic cancer, cancer, hypopharyngeal cancer, thyroid cancer, oral cancer, thoracic tumor, small cell lung cancer, non- Ovarian cancer, uterine sarcoma, vaginal cancer, female germ cell cancer, female urethral cancer, colon cancer, colon cancer, rectal cancer, anal cancer, bladder cancer, kidney cancer, male genital tumor, penile cancer, prostate cancer, female genital tumor, cervical cancer, And skin cancer, but the present invention is not limited thereto.

The present invention also provides a health food for preventing or ameliorating cancer diseases, which comprises a melatonin derivative represented by the following general formula (1) or (2) as an active ingredient.

[Chemical Formula 1]

Wherein R ¹ is at least one member selected from the group consisting of hydrogen, (C 2 -C 4) alkylcarbonyl, benzoyl and (C 1 -C 4) alkoxycarbonyl,

(2)

Wherein R ² is at least one selected from the group consisting of hydrogen, (C 1 -C 4) alkylcarbonyl, benzoyl and (C 1 -C 4) alkoxycarbonyl.

The pharmaceutical composition may be provided in one or more formulations selected from the group consisting of gels, emulsions, injections, powders, granules, aerosols, pastes, percutaneous absorbers and patches according to a conventional method, but is not limited thereto.

In a specific embodiment of the present invention, the pharmaceutical compositions may be formulated with suitable carriers, excipients, disintegrants, sweeteners, coatings, swelling agents, lubricants, lubricants, flavors, antioxidants, buffers, , A diluent, a dispersant, a surfactant, a binder, and a lubricant.

Specifically, carriers, excipients and diluents include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, The solid formulations for oral administration may be in the form of tablets, pills, powders, granules, powders, granules, powders, granules, powders, granules, Capsules and the like. These solid preparations can be prepared by mixing at least one excipient such as starch, calcium carbonate, sucrose or lactose, gelatin and the like in the composition. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. Examples of the liquid preparation for oral use include suspensions, solutions, emulsions, syrups and the like, and various excipients such as wetting agents, sweeteners, fragrances, preservatives and the like may be included in addition to water and liquid paraffin which are commonly used simple diluents. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, suppositories, and the like. Examples of the suspending agent include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like. As the suppository base, witepsol, macrogol, tween 61, cacao paper, laurin, glycerogelatin and the like can be used.

The preferred dose of the melatonin derivative may vary depending on the condition and body weight of the subject, the type and degree of the disease, the drug form, the administration route and the period, and may be appropriately selected by those skilled in the art. According to one embodiment of the present invention, the daily dosage may be, but is not limited to, 0.01 to 200 mg / kg, specifically 0.1 to 200 mg / kg, more particularly 0.1 to 100 mg / kg. The administration may be performed once a day or divided into several times, and thus the scope of the present invention is not limited thereto.

In the present invention, the 'subject' may be a mammal including a human, but is not limited thereto.

The health food may be provided in the form of a powder, a granule, a tablet, a capsule, a syrup or a drink. The health food may be used in combination with other food or food additives other than the melatonin derivative as an active ingredient, . The amount of the active ingredient to be mixed can be suitably determined according to its use purpose, for example, prevention, health or therapeutic treatment.

The effective dose of the melatonin derivative contained in the health food may be used in accordance with the effective dose of the pharmaceutical composition, but may be less than the above range for health and hygiene purposes or long-term intake for health control purposes , It is clear that the active ingredient can be used in an amount exceeding the above range since there is no problem in terms of safety.

There is no particular limitation on the type of the health food, and examples thereof include meat, sausage, bread, chocolate, candy, snack, confectionery, pizza, ramen, other noodles, gums, dairy products including ice cream, Drinks, alcoholic beverages and vitamin complexes.

The cosmetic composition may be used for external ointment for skin, foundation cosmetic, makeup cosmetic, body cosmetic or shaving cosmetic. Examples of the cosmetic cosmetic include essence, lotion, cream, gel, lotion, Such as foundation, lipstick, eye shadow, eye liner, mascara, eyebrow pencil, make-up base, etc. The body cosmetics may include soap, liquid cleanser, bath powder, sunscreen Cream, sun oil, etc., and shaving cosmetics include aftershave lotion and shaving cream.

In addition to the melatonin derivative, the cosmetic composition may further contain a functional material, an excipient for improving physical properties, or a diluent.

Specifically, the cosmetic composition may further contain a perfume, a coloring agent, a bactericide, an antioxidant, an antiseptic, a moisturizing agent, a thickening agent, an inorganic salt, or a synthetic high molecular substance to improve physical properties. An organic pigment, an organic pigment, an ultraviolet absorber, a pH adjuster, an alcohol, a blood circulation accelerator, a cold agent, a limiting agent, or purified water may be used as a blending component that may be added.

The compounding ingredient to be added other than the above-mentioned effective ingredient is not limited, and any of the above-mentioned ingredients can be compounded within a range that does not impair the purpose and effect of the present invention.

The cosmetic composition may be in the form of a solution, an emulsion, a viscous mixture, and the like, and may be any of the formulations conventionally produced in the art. Examples thereof include a spray, a milky lotion, a cream, a lotion, a pack, a foundation, , Hair cosmetics, and the like.

More particularly, the cosmetic composition of the present invention can be used as a cosmetic composition in the form of a spray, a soap, a cleansing foam, a cleansing lotion, a cleansing cream, a body lotion, a body cleanser, a skin lotion, a skin softener, a skin toner, an astigmant, a lotion, , Massage cream, nutritional cream, moisturizing cream, hand cream, foundation, essence, nutritional essence and pack.

For example, when the formulation of the present invention is a spray or powder, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as the carrier component, particularly when the formulation of the present invention is a spray Can additionally include propellants such as chlorofluorohydrocarbons, propane / butane or dimethyl ether.

When the formulation of the present invention is a paste, cream or gel, animal fiber, plant fiber, wax, paraffin, starch, tracant, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide may be used as the carrier component .

When the formulation of the present invention is a solution or an emulsion, a solvent, a solvent or an emulsifier is used as a carrier component, and examples thereof include water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, -Butyl glycol oil, glycerol aliphatic esters, polyethylene glycols or fatty acid esters of sorbitan.

When the formulation of the present invention is a suspension, a carrier such as water, a liquid diluent such as ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, Cellulose, aluminum metahydroxide, bentonite, agar or tracant, etc. may be used.

When the formulation of the present invention is an interfacial active agent-containing cleansing, the carrier component may include aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyltaurate, sarcosinate, fatty acid amide Ether sulfates, alkylamidobetaines, aliphatic alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, linolenic derivatives or ethoxylated glycerol fatty acid esters.

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail with reference to the following examples. It is to be understood, however, that the invention is not limited to the disclosed embodiments, but, on the contrary, is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims. will be.

Example 1 Preparation of Melatonin and Synthesis of Melatonin Derivative

In order to prepare the compounds which are the melatonin derivatives shown in Fig. 1, Compound 1 was purchased from Tokyo Chemical Industry / Japan and then reacted according to the following Reaction Scheme 1 to synthesize the compounds 3 to 5. Melatonin ( Compound 2 ) was also purchased from Sigma Aldrich.

[Reaction Scheme 1]

1. Synthesis of Compound 3

Triethylamine and butylchloride (0.83 mL, 0.79 mmol) were added to 5-methoxytryptamine (100 mg, 0.53 mmol) according to Reaction Scheme 1, The reaction was carried out at room temperature, extracted with ethyl acetate and brine, dried over anhydrous MgSO ₄ and filtered. The filtrate was concentrated and purified by column chromatography (silica gel, Hx: EtOAC = 1: 1) to give compound 3 (121.5 mg, 88.1% yield).

^{1 H-NMR (500 MHz,} CDCl 3) δ 7.26 ~ 7.24 (m, 1H), 7.02 ~ 7.00 (m, 2H), 6.86 ~ 6.85 (m, 1H), 3.84 (s, 3H), 3.60 ~ 3.56 ( (m, 2H), 2.93-2.91 (m, 2H), 2.09-2.06 (m, 2H), 1.63-1.58 (m, 2H), 0.91-0.88

2. Synthesis of Compound 4

Following the above reaction scheme 1, triethylamine and benzoylchloride (0.92 mL, 0.79 mmol) were added to 5-methoxytryptamine (100 mg, 0.53 mmol) The reaction mixture was extracted with ethyl acetate and brine, dried over anhydrous MgSO ₄ and filtered. The filtrate was concentrated and purified by column chromatography (silica gel, Hx: EtOAC = 1: 1) to give compound 4 (111.6 mg, 73% yield).

^{1 H-NMR (500 MHz,} CDCl 3) δ 7.87 ~ 7.86 (m, 2H), 7.67 ~ 7.64 (m, 1H), 7.59 ~ 7.56 (m, 2H), 7.47 ~ 7.45 (m, 1H), 7.25 ( 1H), 7.08-7.55 (m, 1H), 6.49-6.47 (s, 1H), 4.01-3.98 (m, 2H), 3.97 (s, 3H), 3.27-3.25 (m, 2H,

3. Compound 5 Synthesis

According to Scheme 1, compound 1 of 5-methoxy-tryptamine (5-Methoxytryptamine, 100 mg, 0.53 mmol) in triethyl amine (triethylamine) and di-tert-butyl dicarbonate (di- tert -butyl dicarbonate, 172 mg, 0.79 mmol) was added thereto. The mixture was reacted at room temperature for 1 hour, extracted with ethyl acetate and brine, dried over anhydrous MgSO ₄ and filtered. The filtrate was concentrated and purified by column chromatography (silica gel, Hx: EtOAC = 1: 1) to give Compound 5 (142.9 mg, 93% yield).

^{1 H-NMR (500 MHz,} CDCl 3) δ 7.24 ~ 7.22 (m, 1H), 6.86 ~ 6.85 (m, 2H), 6.84 (m, 1H), 3.85 (s, 3H), 3.45 ~ 3.44 (m, 2H), 2.91 ~ 2.89 (m, 2H), 1.42 (s, 9H) ppm.

4. Synthesis of Compound 6

Compound 6 was synthesized according to a known document (G. Spadoni et al., 11, J. Pineal Res . 2006, 40 , 259269.), and compounds 7 to 10 were synthesized on the basis of Reaction Scheme 2 below.

[Reaction Scheme 2]

4. Compound 7 Synthesis

Following the above reaction scheme 2, triethylamine, acetylchloride (0.56 mL, 0.79 mmol) was added to the compound 6 (100 mg, 0.53 mmol), and the mixture was reacted at room temperature for one hour. ethyl acetate) and brine, dried over anhydrous MgSO ₄ and filtered. The filtrate was concentrated and purified by column chromatography (silica gel, Hx: EtOAC = 1: 1) to give compound 7 (95.4 mg, 77.5% yield).

^{1 H-NMR (500 MHz,} CDCl 3) δ 7.21 ~ 7.19 (m, 1H), 7.00 ~ 6.99 (m, 1H), 6.99 ~ 6.97 (m, 1H), 6.19 (s, 1H), 3.82 (s, 3H), 3.60-3.56 (m, 2H), 2.96-2.94 (m, 2H), 1.93 (s, 3H) ppm.

5. Compound 8 Synthesis

Triethylamine, butylchloride (0.83 mL, 0.79 mmol) was added to the compound 6 (100 mg, 0.53 mmol) according to Reaction Scheme 2 and allowed to react at room temperature for 1 hour. Ethyl acetate acetate and brine, dried over anhydrous MgSO ₄ and filtered. The filtrate was concentrated and purified by column chromatography (silica gel, Hx: EtOAC = 1: 1) to give compound 8 (99.3 mg, 72% yield).

^{1 H-NMR (500 MHz,} CDCl 3) δ 7.20 ~ 7.18 (m, 1H), 6.99 (m, 1H), 6.78 ~ 6.77 (m, 1H), 6.18 (s, 1H), 3.82 (s, 3H) (M, 2H), 3.61-3.57 (m, 2H), 2.96-2.93 (m, 2H), 2.11-2.08 (m, 2H), 1.64-1.57

6. Compound 9 Synthesis

Following the above reaction scheme 2, triethylamine, benzoylchloride (0.92 mL, 0.79 mmol) was added to the compound 6 (100 mg, 0.53 mmol), and the mixture was reacted at room temperature for 1 hour. ethyl acetate) and brine, dried over anhydrous MgSO ₄ and filtered. The filtrate was concentrated and purified by column chromatography (silica gel, Hx: EtOAC = 1: 1) to give compound 9 (138.5 mg, 87% yield).

^{1 H-NMR (500 MHz,} CDCl 3) δ 7.69 ~ 7.67 (m, 2H), 7.48 ~ 7.46 (m, 1H), 7.40 ~ 7.37 (m, 2H), 7.20 ~ 7.19 (m, 1H), 7.00 ( (m, 2H), 3.08-3.05 (m, 2H) ppm. < RTI ID = 0.0 >

7. Compound 10 Synthesis

According to Scheme 2, the compound 6 (100 mg, 0.53 mmol) in triethyl amine (triethylamine), di-tert-butyl dicarbonate was added to one hour (di- tert -butyl dicarbonate, 172 mg , 0.79 mmol) The reaction was carried out at room temperature, extracted with ethyl acetate and brine, dried over anhydrous MgSO ₄ and filtered. The filtrate was concentrated and purified by column chromatography (silica gel, Hx: EtOAC = 1: 1) to give compound 10 (131 mg, 85% yield).

^{1 H-NMR (500 MHz,} CDCl 3) δ 7.19 ~ 7.14 (m, 1H), 7.00 (m, 1H), 6.78 ~ 6.76 (m, 1H), 6.19 (s, 1H), 3.82 (s, 3H) , 3.47-3.45 (m, 2H), 2.94-2.92 (m, 2H), 1.41 (s, 9H) ppm.

8. Control compound synthesis

MB-2 and MB-3, which are control compounds, were synthesized according to Reaction Scheme 3 below.

[Reaction Scheme 3]

8-1) Compound MB-2 Synthesis

Tetrahydrofuran (THF, 5 mL) and lithium aluminum hydride (1.4 mL, 1.35 mmol) were added to the compound 2 (157 mg, 0.67 mmol) according to Reaction Scheme 3 for one hour After stirring and reacting with heating, water (2.5 mL) was added to terminate the reaction. It was extracted with ethyl acetate and brine, dried over anhydrous MgSO ₄ and filtered. The filtrate was concentrated and purified by column chromatography (dichloromethane (CH ₂ Cl ₂ ): methanol (MeOH) = 9: 1 (1% ammonia (NH ₃ OH))) to obtain MB- (89.7 mg, 61% yield).

^{1 H-NMR (500 MHz,} CDCl 3) δ 7.22 (s, 1H), 7.21 (s, 1H) 7.06 (m, 1H) 7.01 (m, 1H), 6.81 ~ 6.79 (m, 1H), 3.26 ~ 3.23 (m, 2H), 3.14-3.11 (m, 2H), 2.98-2.93 (m, 2H), 1.36-1.33 (m, 3H) ppm.

8-2) Synthesis of compound MB-3

Tetrahydrofuran (THF, 5 mL) and lithium aluminum hydride (1.4 mL, 2.94 mmol) were added to the compound 3 (386 mg, 1.48 mmol) according to Reaction Scheme 3 for one hour The reaction was allowed to proceed with stirring while heating, and then water (2.5 mL) was added to terminate the reaction. It was extracted with ethyl acetate and brine, dried over anhydrous MgSO ₄ and filtered. The filtrate was concentrated and purified by column chromatography (silica gel, CH ₂ Cl ₂ : MeOH = 9: 1 (1% NH ₃ OH)) to give MB-3 (231.4 mg, 63.4% yield) as a white solid .

^{1 H-NMR (500 MHz,} CDCl 3) δ 7.18 (s, 1H), 7.24 ~ 7.20 (m, 2H), 7.04 ~ 6.75 (m, 1H), 6.85 (s, 1H), 6.75 ~ 6.73 (m, 2H), 1.63-1.56 (m, 2H), 1.24-1.20 (m, 2H), 2.70-2.67 m, 4H), 0.79-0.76 (m, 3H) ppm.

In addition, MLB-2 and MLB-3, which are control compounds, were synthesized according to Reaction Scheme 4 below.

[Reaction Scheme 4]

8-3) Compound MLB-2 Synthesis

Tetrahydrofuran (THF, 5 mL) and lithium aluminum hydride (1.3 mL, 1.29 mmol) were added to the compound 7 (150 mg, 0.64 mmol) according to Reaction Scheme 4 for one hour The reaction was allowed to proceed with stirring while heating, and then water (2.5 mL) was added to terminate the reaction. It was extracted with ethyl acetate and brine, dried over anhydrous MgSO ₄ and filtered. The filtrate was concentrated and purified by column chromatography (silica gel, CH ₂ Cl ₂ : MeOH = 9: 1 (1% NH ₃ OH)) to give MLB-2 as a brown solid (84 mg, 60% yield) .

^{1 H-NMR (500 MHz,} CDCl 3) δ 7.24 ~ 7.19 (m, 2H), 7.04 (s, 1H), 6.93 (s, 1H), 6.77 ~ 6.75 (m, 1H), 3.75 (s, 3H) , 3.20-3.18 (m, 2H), 3.08-3.07 (m, 2H), 2.91-2.90 (m, 2H), 1.32-1.30 (m, 3H) ppm.

8-4) Compound MLB-3 Synthesis

Tetrahydrofuran (THF, 5 mL) and lithium aluminum hydride (1.5 mL, 1.52 mmol) were added to the compound 8 (200 mg, 0.76 mmol) according to Reaction Scheme 4 for one hour The reaction was allowed to proceed with stirring while heating, and then water (2.5 mL) was added to terminate the reaction. It was extracted with ethyl acetate and brine, dried over anhydrous MgSO ₄ and filtered. The filtrate was concentrated and purified by column chromatography (silica gel, CH ₂ Cl ₂ : MeOH = 9: 1 (1% NH ₃ OH)) to give MLB-3 as a brown solid (109.9 mg, 63.4% yield) .

^{1 H-NMR (500 MHz,} CDCl 3) δ 7.23 (s, 1H), 7.10 ~ 7.09 (m, 1H), 7.04 (s, 1H), 3.81 (s, 3H), 3.34 ~ 3.32 (m, 2H) , 3.21-3.17 (m, 2H), 2.93-2.89 (m, 2H), 1.34-1.30 (m, 4H), 0.85-0.82 (m, 3H) ppm.

8-5) Synthesis of compound MC-1

[Reaction Scheme 5]

According to Reaction Scheme 5, N-carbobenzoxyglycine (1.1 g, 5.3 mmol) and 1-ethyl-3-hydroxybenzaldehyde were added to 5-methoxytryptamine (500 mg, 2.63 mmol) (3-dimethylaminopropyl) carbodiimide, EDCI, 1.0 g, 5.3 mmol), triethylamine (364.3 μl, 2.6 mmol), 4-dimethyl 4-dimethylaminopyridine (DMAP, 32.1 mg, 0.26 mmol) and dichloromethane (13 mL) were added and reacted at room temperature for 30 minutes. It was then extracted with ethyl acetate and brine, dried over anhydrous MgSO ₄ and filtered. The filtrate was concentrated and purified by column chromatography (silica gel, Hx: EtOAC = 1: 1) to give compound 11 as a brown solid (901 mg, 90% yield).

The compound 11 (300 mg, 0.79 mmol) and Pd (OH) _{2 /} C (11.1 mg, 0.08 mmol) were mixed and methanol (2.6 mL) and hydrogen (H ₂ ) were introduced. After 2 hours, the vacuum filtration funnel was filled with Cellite and filtered under reduced pressure with MeOH (100 mL). The filtrate was concentrated under vacuum, and hydrogen chloride (1 mL) prepared by stirring dichloromethane (5 mL), methanol (1 mL) and acetyl chloride (1 mL) was slowly injected. Thereafter, this was further subjected to filtration under reduced pressure with ethyl acetate (100 mL) to obtain MC-1 (189.4 mg, 97% yield) as a white solid.

Example 2 Confirmation of Anti-inflammatory Effect of Melatonin and Melatonin Derivatives

In order to confirm the anti-inflammatory effect of the melatonin and the melatonin derivative prepared in Example 1, Raw 264.7 cells were first obtained from Korean Cell Line Bank (KCLB) and cultured in 10% fetal bovine serum (FBS, (Dulbecco's Modified Eagle's, DMEM, Gibco BRL) containing 100 μg / ml of Gibco BRL) and penicillin 100 U / ml / streptomycin. Lipopolysaccharide (LPS) and Griess reagents were purchased from Sigma-Aldrich. Raw 264.7 cells were separated into the treated group and the non-treated group in the presence of 1 μg / mL LPS, and the melatonin and the melatonin derivative synthesized in Example 1 were treated for 24 hours in the treated group to prepare an inflammation model.

1. NO production inhibitory effect and cytotoxicity

The melatonin and melatonin derivatives prepared in Example 1 were treated with the concentration of the nitrite in the culture medium at 540 nm absorbance using a Griess reagent to confirm the anti-inflammatory effect . Analysis of nitric oxide (NO) production was carried out by a known method (Hwang, SJ, YW Kim, Y. Park, HJ Lee, KW Kim. 2014 Anti-inflammatory effects of chlorogenic acid in lipopolysaccharide-stimulated RAW 264.7 cells. : 81-90.).

As a result, as shown in FIG. 2, all the melatonin derivatives except the melatonin, which is the compound 2 of FIG. 1, exerted an effect of inhibiting the production of NO in a concentration-dependent manner compared to the existing melatonin.

The cell survival rate was also checked to determine whether the inhibitory effect of melatonin derivatives on NO production was due to cytotoxicity. (Hwang, SJ, YW Kim, Y. Park, and HJ Lee, KW Kim, 2014). In this study, we examined the effect of chlorogenic acid on lipopolysaccharide-stimulated RAW 264.7 cells. Inflammation research 63: 81-90. Survival analysis was performed. Raw 264.7 cells were treated with a suitable amount of melatonin derivative for each experiment and after 24 hours 20 μl of cell viability 96% aqueous solution solution (celltiter 96 Aqueous One Solution Reagent, Promega, Madison, WI) Were measured. As a result, cytotoxicity of melatonin derivatives 4, 5, 6, 8, 9 and 10 was observed. Therefore, it was confirmed that melatonin derivatives 1, 3 and 7 showed NO production inhibition effect without cytotoxicity.

2. Identification of inflammatory factor inhibitory effect

The inflammatory model prepared in Example 2 was treated with melatonin derivatives 1, 3 or 7, and then monocyte chemoattractant protein-1 (MCP-1), IL-6, IL- Expression of COX-2 and TNF-α was confirmed by RT-PCR.

RT-PCR analysis was performed by a known method (Hwang, SJ, YW Kim, Y. Park, HJ Lee, KW Kim. 2014 Anti-inflammatory effects of chlorogenic acid in lipopolysaccharide-stimulated RAW 264.7 cells. Inflammation research 63: 90.). PCR primers used in the present invention are shown in Table 1 below and were purchased from Bioneer.

designation direction sequence SEQ ID NO: IL-1? forward (forward) aagggctgcttccaaacctttgac One reverse (reverse) tgcctgaagctcttgttgatgtgc 2 TNF-a forward (forward) catcttctcaaaattcgagtgacaa 3 reverse (reverse) tgggagtagacaaggtacaaccc 4 COX-2 forward (forward) ttcaaaagaagtgctggaaaaggt 5 reverse (reverse) gatcatctctacctgagtgtcttt 6 IL-6 forward (forward) gaggataccactcccaacagacc 7 reverse (reverse) aagtgcatcatcgttgttcataca 8 MCP-1 forward (forward) cttctgggcctgctgttca 9 reverse (reverse) ccagcctactcattgggatca 10 GAPDH forward (forward) gagctgaacgggaagctactgg 11 reverse (reverse) ccaccttcttgatgtcatcat 12

For confirmation of PCR amplification, the PCR product was separated into 1.5% agarose gel using β-actin as an internal control, visualized with RedSafe nucleic acid staining (Intron, Korea) and confirmed by UV irradiation .

As a result, as shown in FIG. 3, the expression of MCP-1, IL-6, COX-2 and TNF-? Therefore, it was confirmed that the melatonin derivatives according to the present invention exhibit an excellent anti-inflammatory effect as compared with melatonin.

Example 3 Confirmation of Inhibitory Effect of Compound 48/80-induced Histamine Secretion in Mast Cells

In order to examine the inhibitory effect of the melatonin derivatives on histamine, a human obesity cell line HMC-1 was pre-treated in an immunology classroom of Chonbuk National University Medical School, and 10% fetal bovine serum (FBS) and 1% penicillin / IMC (Iscove's Modified Dulbecco's Media) containing penicillin / streptomycin was used as a culture medium and cultured at 37 ° C and 5% CO 2.

The melatonin and melatonin derivatives prepared in Example 1 were treated with 3 × 10 ⁶ HMC-1 thus cultured, and cultured at 37 ° C. for 30 minutes. Then, Compound 48/80 was added at 300 μg / ml for 20 minutes Lt; / RTI > The cells treated with Compound 48/80 were lightly centrifuged and the supernatant was collected. Histamine contained in the supernatant was measured after reacting with O-phthalaldehyde (OPT).

That is, to measure the amount of histamine contained in the supernatant, 2 ml of 0.5 N perchloric acid (HClO ₄ ) was added to 500 μl of the supernatant, and the mixture was centrifuged at 12,000 rpm for 20 minutes. To 2 ml of the centrifuged supernatant were added 0.2 ml of 6N sodium hydroxide (NaOH), 3.3 ml of butanol-chloroform (3: 2) and sodium chloride (NaCl), and centrifuged again at 3,000 rpm for 10 minutes. Then, 3 ml of n-heptane and 1.2 ml of 0.1 N HCl (HCl) were added to 3 ml of the upper layer of the supernatant, and the mixture was boiled at 100 ° C. for 10 minutes and centrifuged at 3,000 rpm for 5 minutes And the lower layer was collected with a Pasteur pipette. 0.1N HCl in 1 ml solution was collected and 1N NaOH 0.3 ml, 0.2% OPT 0.2 ml into a reaction between 45 minutes in dark place, and then, 0.5N sulfuric acid (H ₂ SO ₄₎ after having put the completion of the reaction 0.28 ml fluorescent The amount of fluorescence was measured using a quartz cuvette at excitation 350 nm and emission 440 nm with a spectrofluorophotometer (Shimadzu, Japan).

As a result, as shown in FIG. 4, the histamine inhibitory effects of melatonin derivatives 1, 3 and 7 were observed, and in particular, the melatonin derivative 7 exhibited superior histamine inhibitory effect to melatonin.

Example 4 Confirmation of Antitumor Effect of Melatonin and Melatonin Derivatives

1. Anticancer effect in HCT116 colon cancer cell line in vitro

The cell survival rate was measured by Thiazolyl Blue Tetrazolium Bromide (MTT) assay to examine the anti-cancer effect of the melatonin and melatonin derivatives prepared in Example 1 on the HCT-116 colon cancer cell line. (Lee HY et al., (2013) Cancer Lett. 332: 102-109), the following experiment was conducted. The colorectal cancer cell line HCT-116 was purchased from the Korean Cell Line Bank. HCT-116 cells were treated with heat-inactivated Fetal Bovine Serum (FBS), 100 units / mL penicillin, 100 μg / mL streptomycin and 250 ng / mL amphotericin B (amphotericin B) using RPMI 1640 medium containing 1 to 2 times were sub-cultured a week at 37 ℃, 5% carbon dioxide (CO ₂₎ condition. All cells were dissolved from liquid nitrogen and then used in experiments after passage over 3 times.

The colorectal cancer cell line was added to each well of a 96-well plate at 200 쨉 l (2 x 10 ⁴ cells / ml) and cultured for one day. The following day, melatonin and melatonin derivatives were added to dimethyl sulfoxide (DMSO) at a concentration of 0.125 mM to 2 mM and cultured for 3 days. However, DMSO was used so as not to exceed 10% of the medium. Groups without DMSO treatment alone were used as zero-day controls. The cultured cells were treated with 20 μl of 5 mg / ml MTT solution and cultured for an additional 4 hours. Then, the medium was removed, and impurities were removed with phosphate buffered saline (PBS) and 200 μl of DMSO was added. After stirring for 15 minutes in an agitator, the absorbance was measured at 590 nm. 10% DMSO was used as a control, and the cell survival rate according to the treatment of each test substance was measured using the following equation (1).

[Equation 1]

% Survival rate = (OD (0-day)) / (OD (10% DMSO) -OD (0-day)) X 100

When the control group without the sample was taken as 100%, the value of the sample treatment group was expressed as a percentage of the control group, and the treatment of each test substance was calculated as the mean value ± SEM of the double or triple test. The IC ₅₀ value is the concentration of the test substance relative to the 50% survival rate.

As a result, all of the melatonin derivatives 7, MB-2, and MC-1 were superior to the existing melatonin, except for the melatonin derivative 7, as shown in FIG. Especially, at a low concentration of 1 mM or less, the compounds showed considerable anticancer activities.

2. Anticancer effect on cervical cancer, breast cancer, lung cancer, colon cancer cell line

The antitumor effect of the melatonin 10 derivative on human cervical cancer, breast cancer, lung cancer, and colorectal cancer cell lines confirmed by the above example was confirmed by MTT (Thiazolyl Blue Tetrazolium Bromide) assay of Example 4 above. Human cervical cancer cell line HeLa, lung cancer cell line A549 and breast cancer cell line MDA-MB-231 were distributed from the American Cell Line Bank (ATCC, Manassas, VA, USA). HCT116, HeLa, A549 and MDA-MB-231 cells were incubated with heat-inactivated Fetal Bovine Serum (FBS), 100 units / mL penicillin, 100 μg / mL streptomycin The cells were subcultured once or twice a week in RPMI 1640 medium containing 250 ng / mL amphotericin B at 37 ° C and 5% CO ₂ . All cells were dissolved from liquid nitrogen and then used in experiments after passage over 3 times.

As a result, as shown in FIG. 6, the melatonin 10 derivative showed a broad anti-cancer effect. Especially, except colon cancer, breast cancer, and cervical cancer cell lines, cancer cells had a superior antitumor activity compared to melatonin.

3. Molecular mechanism analysis of antitumor effect of melatonin derivatives

In order to analyze the molecular mechanism of the antitumor effect exhibited by the melatonin derivatives, the melatonin and melatonin derivatives 1 to 10 prepared in Example 1 were treated with HCT-116, a colon cancer cell line, and its anticancer effect was confirmed by western blot Respectively. Western analysis was performed by a method that is already known (2014, Inflammation research 63: 81-90). Specifically, Western blotting was performed as follows: Primary antibodies specific for phosphorylated protein phospho-AKT (pAKT, Cell Signaling) and AKT (Cell Signaling) proteins were used. An anti-rabbit horseradish peroxidase conjugated secondary antibody was purchased from Pierce Chemical Co., and electrochemiluminescent plus reagent (ECL Plus reagent, Amersham Biosciences, USA) After development, the cells were detected using Fusion equipment (Vilber Lourmat, FR). Ponceau S solution was purchased from Sigma.

As a result, as shown in FIG. 7, it was confirmed that the antitumor effect of the melatonin derivative is due to inhibition of the signal transduction system of protein kinase B (AKT), which functions to inhibit apoptosis of cell and promote cell proliferation. In particular, derivative 10, which exhibited the most excellent anticancer activity, had the ability to inhibit phosphorylation of AKT.

Many cancer cells have increased HIF-1α activity regardless of hypoxia. Although HIF-1α activity is enhanced by adaptation of some cancer cells due to rapid proliferation of cancer cells, proliferative signal transduction system is constantly increased by genetic mutation even if it is not hypoxic. Therefore, continuous HIF-1α . Therefore, reduction of HIF-1α expression in cancer cell therapy is very important.

3, the melatonin derivatives 1, 3, 7 and 8, which had relatively low anticancer activity, were treated with HCT-116 cell line and then treated with Hypoxia-inducible factor-1 alpha (HIF- ).

Specifically, Western blots were performed as follows: Primary antibodies specific for HIF-1a (BD), Tubulin (Santa Cruz) protein were used. Mouse horseradish peroxidase-conjugated secondary antibodies were purchased from Pierce Chemical Co. and electroblotted with electrogenerated chemiluminescence plus reagents (ECL Plus reagent, Amersham Biosciences, USA) And then detected using a Fusion kit (Vilber Lourmat, FR). Ponceau S solution was purchased from Sigma.

As a result, as shown in FIG. 8, it was confirmed that the expression of HIF-1α was significantly decreased when the melatonin derivative was treated, and in particular, derivatives 3 and 8 inhibited the expression of HIF-1α more than the existing melatonin.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that such detail is solved by the person skilled in the art without departing from the scope of the invention. will be. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

<110> inje university industry-academic cooperation foundation <120> Composition for Preventing or Treating Inflammatory Disease,          Allergic Disease or Cancer Comprising Melatonin Derivative <130> ADP-2016-0341 <160> 12 <170> KoPatentin 3.0 <210> 1 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 aagggctgct tccaaacctt tgac 24 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 tgcctgaagc tcttgttgat gtgc 24 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 catcttctca aaattcgagt gacaa 25 <210> 4 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 tgggagtaga caaggtacaa ccc 23 <210> 5 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 ttcaaaagaa gtgctggaaa aggt 24 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 gatcatctct acctgagtgt cttt 24 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 gaggatacca ctcccaacag acc 23 <210> 8 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 aagtgcatca tcgttgttca taca 24 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 cttctgggcc tgctgttca 19 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 ccagcctact cattgggatc a 21 <210> 11 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 gagctgaacg ggaagctact gg 22 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 ccaccttctt gatgtcatca t 21

Claims (14)

delete delete delete delete delete A pharmaceutical composition for preventing or treating an allergic disease, comprising a melatonin derivative represented by the following general formula (1) or (2) as an active ingredient.
[Chemical Formula 1]

Wherein R &lt; ^{1 &gt;} is hydrogen or propylcarbonyl,
(2)

Wherein R &lt; ² &gt; is methylcarbonyl. The method according to claim 6,
Wherein the melatonin derivative is contained in an amount of 0.1 to 50 parts by weight based on 100 parts by weight of the total amount of the pharmaceutical composition. The method according to claim 6,
The above-mentioned allergic diseases include asthma, urticaria, anaphylaxis, food allergy, drug allergy, allergy-free blood transfusion reaction, and atopic dermatitis. Wherein the composition is at least one selected from the group consisting of allergic rhinitis, allergic conjunctivitis, allergic dermatitis, allergic contact dermatitis, and dermatitis. A health food for preventing or ameliorating an allergic disease, comprising a melatonin derivative represented by the following formula (1) or (2) as an active ingredient.
[Chemical Formula 1]

Wherein R &lt; ^{1 &gt;} is hydrogen or propylcarbonyl,
(2)

Wherein R &lt; ² &gt; is methylcarbonyl. A cosmetic composition for preventing or improving an allergic disease, comprising a melatonin derivative represented by the following general formula (1) or (2) as an active ingredient.
[Chemical Formula 1]

Wherein R &lt; ^{1 &gt;} is hydrogen or propylcarbonyl,
(2)

Wherein R &lt; ² &gt; is methylcarbonyl. delete delete delete delete

Images