KR101933240B1 - Differentiating Infected from Vaccinated Animals Vacine for Porcine Reproductive and Respiratory Syndrome Virus - Google Patents

Abstract

The present invention relates to a vaccine composition for Differential Infected from Vaccinated Animals (DIVA) for inhibiting Porcine Reproductive and Respiratory Syndrome (PRRS) virus. By using the composition of the present invention, PRRSV-infected animals and vaccinated animals can be easily distinguished and screened while suppressing PRRSV with excellent efficiency as compared with the conventional PRRSV vaccine.

Description

[0002] Differentiation vaccines for the reproductive and respiratory syndrome virus inhibition of pigs [0002] {Differentiating Infected from Vaccinated Animals Vacuum for Porcine Reproductive and Respiratory Syndrome Virus}

The present invention relates to a vaccine composition for differential reproductive and respiratory syndrome (PRRS) infection.

Porcine reproductive and respiratory syndrome (PRRS) is a viral disease caused by swine genital and respiratory syndrome viruses, which is causing economic damage to the swine industry (Dea et al., 2000). Porcine reproductive and respiratory syndrome virus (PRRSV) causes low reproductive rates, increased abortion and stillbirth rates, and respiratory diseases of piglets (Wensvoort et al., 1992; Bilodeau et al., 1991). Pig reproductive and respiratory syndrome viruses were reported in North America (Keffaber et al., 1989) in 1987 and European type (Wensvoort et al., 1991) in 1990. Pig reproductive and respiratory syndrome viruses are positive-strand RNA viruses and belong to the Arteriviridae (Dea et al., 2000; Meulenberg et al., 1994; Snijder et al., 1998). Pig reproductive and respiratory syndrome viruses have an RNA genome of approximately 15 kb and encode nine ORFs (open reading frames) (Conzelmann et al., 1993; Wu et al., 2001; Snijder et al., 1999) . The major structural protein is GP5, M, and N which are encoded by ORFs 5, 6, and 7 (Meulenberg et al., 1995; Murtaugh et al., 1995). GP5 protein induces potent neutralizing capacity as a 25 kDa coat protein (Mardassi et al., 1995; Meng et al., 1995; Murtaugh et al., 1995). M protein induces a cellular immune response as a 18 kDa matrix protein (Mardassi et al., 1995, 1996; Rottier et al., 1986; Plagemann, 1996). Current swine genital and respiratory syndrome vaccines include attenuated and sadox vaccines. Modified-live virus (MLV) vaccines have the disadvantage of delaying humoral and cellular immunity (Zuckermann FA et al., 2007). Although the vaccine effect is delayed, it shows an effective defense against homologous viruses, and partially protects against heterologous viruses (Martelli P et al., 2007, Scortti M et al., 2006). An attenuated vaccine has the disadvantage of causing disease (Murtaugh MP et al., 2010). On the other hand, the Killed virus vaccine has very high safety, but both homologous and heterologous viruses show limited protection. Sadox vaccine can alleviate symptoms of pigs that have not yet been infected (Zuckermann FA et al., 2007). Efforts have been made to improve the immunogenicity, efficacy and safety of pig genital and respiratory virus vaccines, but there is a need for better vaccines to protect against pig genital and respiratory syndromes. Currently, commercialized vaccines have the disadvantage that they can not distinguish between vaccination and infection by using whole pig genital and respiratory viruses.

The present inventors have developed a gene carrier using a recombinant baculovirus inserted into an envelope in a conventional porcine endogenous retrovirus (PERV) envelope glycoprotein (see patent application No. 10-2013-0119555) There is no way to distinguish between animals and infected animals. Therefore, it is necessary to develop vaccines against differentiated infected animals (DIVA).

Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

The present inventors have made extensive efforts to develop a vaccine for differentiating infected animals (DIVA), which can differentiate between natural infection and inoculation, in pig genital and respiratory syndrome vaccine compositions using recombinant baculovirus vectors. As a result, by confirming that the above object can be achieved by using a nucleic acid molecule encoding an N protein that deletes some of the epitopes of the N protein corresponding to ORF (open reading frame) 7 of porcine reproductive and respiratory syndrome virus, Thereby completing the invention.

Accordingly, it is an object of the present invention to provide an infection differentiation (DIVA) vaccine composition for inhibiting porcine reproductive and respiratory syndrome virus.

It is another object of the present invention to provide a method for distinguishing between porcine reproductive and respiratory syndrome virus infected animals and vaccinated animals.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

According to one aspect of the present invention, the present invention provides a recombinant vector comprising (a) a nucleic acid sequence encoding a porcine endogenous retroviral envelope protein; (b) a first promoter operably linked to said envelope protein coding sequence; (c) a nucleic acid sequence encoding a GP5 protein of porcine reproductive and respiratory syndrome virus; (d) a second promoter operably linked to said GP5 protein coding sequence; (e) a nucleic acid sequence encoding an N protein in which an epitope of one of G14-I30 (G14DGQPVNQLCQMLGKII30) and S70-A87 (S70ERQLCLSSIQTAFNQGA87) which is an epitope of N protein of porcine reproductive and respiratory syndrome virus has been deleted; And (f) a first recombinant baculovirus vector comprising a third promoter operably linked to the N protein coding sequence lacking said one epitope as an active ingredient. DIVA) vaccine composition.

The present inventors have made extensive efforts to develop a vaccine for differentiating infected animals (DIVA), which can differentiate between natural infection and inoculation, in pig genital and respiratory syndrome vaccine compositions using recombinant baculovirus vectors. As a result, it has been found that the above object can be achieved by using a nucleic acid molecule encoding an N protein that deletes some of the epitopes of the N protein corresponding to ORF (open reading frame) 7 of porcine reproductive and respiratory syndrome virus.

The vaccine composition of the present invention comprises a pharmaceutically effective amount of the first recombinant baculovirus vector described above and may additionally comprise a veterinarily acceptable carrier. As used herein, the term "pharmaceutically effective amount" means an amount sufficient to achieve preventive, palliative or therapeutic efficacy against a disease or pathological condition caused by PRRSV. The veterinarily acceptable carriers that may be included in the composition of the present invention include those conventionally used in the present invention and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, calcium silicate , Microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, no. The composition of the present invention may further contain lubricants, wetting agents, sweeteners, flavors, emulsifiers, suspending agents, preservatives, etc. in addition to the above components. The vaccine composition of the present invention may contain other components, such as stabilizers, excipients, other pharmaceutically acceptable compounds or any other antigen or portion thereof. Vaccines may be present in the form of a freeze-dried preparation or suspension, all of which are common in the vaccine production field.

The dosage form of the vaccine composition of the present invention may be in the form of enteric coated unit, intraperitoneal, intramuscular or subcutaneous inoculation, aerosol spray, oral or intranasal use. It is also possible to administer it as drinking water or edible pellets. The vaccine composition of the present invention may be administered as a " cocktail " comprising two or more viral vectors that may express an immunomodulatory molecule such as a heterologous antigen and a cytokine in the same recombinant to deliver to a single vaccine, Lt; / RTI >

Pigs can conveniently inoculate vaccine compositions of the present invention at any age. Baby pigs can be vaccinated at 1 day of age, and caregivers can be immunized regularly at birth and at some point thereafter. Preferably, according to the continuous or cocktail method, the pigs can be vaccinated completely without compromising immunity. More conveniently, pigs can be vaccinated to protect against reinfection 4 weeks after the initial vaccination.

The gene using the porcine endogenous retrovirus (PERV) envelope protein of the present invention as the envelope glycoprotein is a gene that exists as a provirus in the porcine genome. Even if this protein is expressed, it is recognized as an autologous cell, Feature. The present invention relates to a method for producing a recombinant virus, which comprises introducing a PERV envelope protein on the surface of a baculovirus and allowing it to exist on the surface of a baculovirus, thereby producing a GP5 protein, M protein or N protein of a porcine reproductive or respiratory syndrome virus, The efficiency of the nucleic acid to be encoded is increased and applied to the PRRSV vaccine preventive vaccine.

In one embodiment of the invention, the envelope protein coding sequence of the invention comprises a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 1.

In one embodiment of the present invention, the nucleic acid sequence encoding the amino acid sequence of the first sequence of the sequence listing is a nucleic acid sequence comprising the second sequence of the sequence listing.

As used herein, the term " nucleic acid " has the meaning inclusive of DNA (gDNA and cDNA) and RNA molecules, and nucleotides which are basic constituent units in nucleic acid molecules include not only natural nucleotides but also analogues analogues) (Scheit, Nucleotide Analogs, John Wiley, New York (1980); Uhlman and Peyman, Chemical Reviews , 90: 543-584 (1990)).

Variations in nucleotides do not cause changes in the protein. Such nucleic acids include functionally equivalent codons or codons that encode the same amino acid (e.g., by codon degeneration, six codons for arginine or serine), or codons that encode biologically equivalent amino acids ≪ / RTI >

Also, variations in the nucleotides may result in changes in the amino acid sequence of the envelope proteins of the present invention. Even when the mutation brings about changes in the amino acid sequence of the envelope protein of the present invention, it can be obtained that exhibits almost the same activity as the vaccine composition of the present invention.

It will be apparent to those skilled in the art that the active ingredient of the vaccine composition of the present invention will be limited to variations of the amino acid sequence that exhibits biological activity equivalent to that of the vector of the present invention that can be included in the range of the first recombinant baculovirus vector Do.

Such amino acid variations are made based on the relative similarity of the amino acid side chain substituents, such as hydrophobicity, hydrophilicity, charge, size, and the like. By analysis of the size, shape and type of amino acid side chain substituents, arginine, lysine and histidine are both positively charged residues; Alanine, glycine and serine have similar sizes; Phenylalanine, tryptophan and tyrosine have similar shapes. Thus, based on these considerations, arginine, lysine and histidine; Alanine, glycine and serine; And phenylalanine, tryptophan and tyrosine are biologically functional equivalents.

In introducing the mutation, the hydrophobic index of the amino acid can be considered. Each amino acid is assigned a hydrophobic index according to its hydrophobicity and charge: isoruicin (+4.5); Valine (+4.2); Leucine (+3.8); Phenylalanine (+2.8); Cysteine / cysteine (+2.5); Methionine (+1.9); Alanine (+1.8); Glycine (-0.4); Threonine (-0.7); Serine (-0.8); Tryptophan (-0.9); Tyrosine (-1.3); Proline (-1.6); Histidine (-3.2); Glutamate (-3.5); Glutamine (-3.5); Aspartate (-3.5); Asparagine (-3.5); Lysine (-3.9); And arginine (-4.5).

The hydrophobic amino acid index is very important in imparting the interactive biological function of peptides. It is known that substitution with an amino acid having a similar hydrophobicity index can retain similar biological activities. When a mutation is introduced with reference to a hydrophobic index, substitution is made between amino acids showing a hydrophobic index difference preferably within ± 2, more preferably within ± 1, even more preferably within ± 0.5.

On the other hand, it is also well known that the substitution between amino acids with similar hydrophilicity values leads to peptides with homogeneous biological activity. As disclosed in U.S. Patent No. 4,554,101, the following hydrophilicity values are assigned to each amino acid residue: arginine (+3.0); Lysine (+3.0); Aspartate (+ 3.0 ± 1); Glutamate (+ 3.0 ± 1); Serine (+0.3); Asparagine (+0.2); Glutamine (+0.2); Glycine (0); Threonine (-0.4); Proline (-0.5 ± 1); Alanine (-0.5); Histidine (-0.5); Cysteine (-1.0); Methionine (-1.3); Valine (-1.5); Leucine (-1.8); Isoru Isin (-1.8); Tyrosine (-2.3); Phenylalanine (-2.5); Tryptophan (-3.4).

When a mutation is introduced with reference to the hydrophilicity value, the amino acid is substituted preferably within ± 2, more preferably within ± 1, even more preferably within ± 0.5.

Amino acid exchange in peptides that do not globally alter the activity of the molecule is known in the art (H. Neurath, R. L. Hill, The Proteins, Academic Press, New York, 1979). The most commonly occurring exchanges involve amino acid residues Ala / Ser, Val / Ile, Asp / Glu, Thr / Ser, Ala / Gly, Ala / Thr, Ser / Asn, Ala / Val, Ser / Gly, Thy / Pro, Lys / Arg, Asp / Asn, Leu / Ile, Leu / Val, Ala / Glu and Asp / Gly.

Considering the mutation having the above-mentioned biological equivalent activity, the porcine endogenous retroviral envelope protein of the present invention and the nucleic acid molecule for coding thereof are interpreted to include a sequence showing substantial identity with the sequence described in the sequence listing. The above-mentioned substantial identity is determined by aligning the above-described sequence of the present invention with any other sequence as much as possible, and analyzing the aligned sequence using an algorithm commonly used in the art, at least 80% Homology, more preferably 90% homology, and most preferably 98% homology. Alignment methods for sequence comparison are well known in the art. Various methods and algorithms for alignment are described by Smith and Waterman, Adv. Appl. Math. 2: 482 (1981) ; Needleman and Wunsch, J. Mol. Bio. 48: 443 (1970); Pearson and Lipman, Methods in Mol. Biol. 24: 307-31 (1988); Higgins and Sharp, Gene 73: 237-44 (1988); Higgins and Sharp, CABIOS 5: 151-3 (1989); Corpet et al., Nuc. Acids Res. 16: 10881-90 (1988); Huang et al., Comp. Appl. BioSci. 8: 155-65 (1992) and Pearson et al., Meth. Mol. Biol. 24: 307-31 (1994). The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al., J. Mol. Biol. 215: 403-10 (1990)) is accessible from National Center for Biological Information (NBCI) It can be used in conjunction with sequence analysis programs such as blastx, tblastn and tblastx. BLSAT is accessible from /. The sequence homology comparison method using this program can be found in.

In one embodiment of the present invention, the first promoter of the present invention is selected from the group consisting of a polyhedrin promoter, baculovirus IE-1 promoter, IE-2 promoter, p35 promoter, p10 promoter and gp64 promoter, but is not limited thereto Do not.

In one embodiment of the present invention, the second promoter and the third promoter of the present invention are selected from the group consisting of CMV (cytomegalo virus) promoter, U6 promoter, H1 promoter, late adenovirus promoter, Vexinia virus 7.5K promoter, SV40 promoter, HSV promoter of the human IL-4 gene, the promoter of the human IL-4 gene, the human lymphocyte promoter, the promoter of the human IL-4 gene, the promoter of the human IL-4 gene, But are not limited to, promoters selected from the group consisting of a promoter of a toxin gene, a promoter of a human GM-CSF gene, a TERT promoter, a PSA promoter, a PSMA promoter, a CEA promoter, an E2F promoter AFP promoter and an albumin promoter .

In one embodiment of the invention, the epitope deletion of the nucleic acid sequence encoding the N protein of the present invention is a G14-I30 or S70-A87 deletion, preferably a S70-A87 deletion.

The PRRSV of the present invention is a positive-strand RNA virus, has an RNA genome of about 15 kb, and codes for 9 ORFs. Of these, ORF 5, 6, or 7 encode GP5, M, or N, which are the main structural proteins, respectively. The GP5 protein induces potent neutralizing activity as a 25 kDa coat protein, and the M protein is a matrix protein of 18 kDa, which induces a cellular immune response. N protein is highly homologous to both European and North American PRRSVs and is therefore very useful for the differential diagnosis of infected and vaccinated animals. Using this, the present inventors have incorporated in the first recombinant baculovirus vector a nucleic acid sequence encoding an N protein in which one of two epitopes of the N protein, G14-I30 (G14DGQPVNQLCQMLGKII30) and S70-A87 (S70ERQLCLSSIQTAFNQGA87) has been deleted. In infected animals, both antibodies against both G14-I30 and S70-A87 epitopes are well-formed, so the infected animals show antibody-positive responses to both peptides. However, in the vaccinated group, it is possible to distinguish from the infected animal because it is exposed only to the epitope that has not been deleted and forms an antibody (see FIG. 8).

The GP5 gene sequence (PRRSV ORF5) of the present invention can be modified using the GP5 gene sequence of domestic representative pig genital and respiratory viruses. PRRSV is an RNA virus such as influenza, and as the influenza vaccine changes every year, PRRSV also changes every year, so we can expect to increase the preventive effect by changing gene sequence.

In one embodiment of the invention, the N protein from which one epitope of the present invention has been deleted consists of the 1-70 amino acid sequence of ORF7 (Open reading frame 7) of the porcine reproductive and respiratory syndrome viruses. One amino acid sequence of PRF7 in one embodiment, a 1-40 amino acid sequence of PRF7 in another embodiment, a 1-35 amino acid sequence of PRF7 in another embodiment, and 1-30 amino acids of pRF7 in yet another embodiment Amino acid sequence of PRF7, and in another embodiment, 1-25 amino acid sequence of PRF7.

In one embodiment of the invention, the recombinant baculovirus vector comprises (a) a nucleic acid sequence encoding a porcine reproductive and respiratory syndrome virus M protein, and (b) a fourth promoter operably linked to the M protein coding sequence . M protein induces a cellular immune response as a 18 kDa matrix protein as described above. This embodiment shows that nucleic acid molecules encoding GP5, M and N proteins of PRRSV are all contained in one vector.

In one embodiment of the invention, the infection differentiating vaccine composition of the present invention further comprises the following second recombinant baculovirus vector:

(a) a nucleic acid sequence encoding a porcine endogenous retroviral envelope protein; (b) a fifth promoter operably linked to said envelope protein coding sequence; (c) a nucleic acid sequence encoding a GP5 protein of porcine reproductive and respiratory syndrome virus; (d) a sixth promoter operably linked to said GP5 protein coding sequence; (e) a nucleic acid sequence encoding the M protein of a porcine reproductive and respiratory syndrome virus; And (f) a seventh promoter operably linked to the M protein coding sequence. This embodiment is characterized in that a first recombinant baculovirus vector in which nucleic acid molecules encoding GP5 and N proteins of PRRSV are contained in one vector and a second recombinant baculovirus vector in which nucleic acid molecules encoding GP5 and M proteins of PRRSV are contained in one vector Lt; RTI ID = 0.0 > recombinant < / RTI > baculovirus vectors.

The fourth to seventh promoters of the present invention can be used as a cytomegalo virus (CMV) promoter, U6 promoter, H1 promoter, late adenovirus promoter, vaccinia virus 7.5K promoter, SV40 promoter, HSV tk promoter, RSV promoter, Promoter of human IL-4 gene, promoter of human lymphotoxin gene, promoter of human IL-2 gene, promoter of human IL-4 gene, promoter of human IL-4 gene, promoter of human lympotoxin gene, But are not limited to, the same or different promoters selected from the group consisting of a promoter of a gene, a TERT promoter, a PSA promoter, a PSMA promoter, a CEA promoter, an E2F promoter AFP promoter and an albumin promoter.

In one embodiment of the present invention, the ratio of the first recombinant baculovirus vector to the second recombinant baculovirus vector of the present invention is 100: 1 to 1: 5. Preferably from 20: 1 to 1: 5, more preferably from 10: 1 to 1: 3, even more preferably from 5: 1 to 1: 1. Differential Infected from Vaccinated Animals and induction of significant humoral immune response by M protein within the above quantitative ratio can be achieved.

According to one aspect of the present invention, an epitope expression level of a porcine reproductive and respiratory syndrome virus N protein is measured against a biological sample separated from an object to which an infection differentiation differentiation (DIVA) vaccine composition for PRRSV inhibition according to another embodiment of the present invention is administered A method for distinguishing between a porcine reproductive and respiratory syndrome virus infected animal and a vaccinated animal comprising the steps of: (a) expressing a deletion epitope of the N protein in said N protein epitope expression. The expression " expression " used herein in the context of " when expressing a deleted epitope " in the present invention means that the expression levels of two epitopes contained in the N protein are similar at the level of the common knowledge of those skilled in the art, (Fig. 8, infection). If the expression of an epitope deliberately deleted for the production of a DIVA vaccine is significantly different from that of other epitopes to a similar extent to the expression of the uninfected wild type, it can be judged to be a vaccinated animal, not an infected animal.

In one embodiment of the present invention, measurement of the amount of N protein epitope expression of the present invention is carried out through detection of the epitope-specific antibody. Specifically, for example, ELISA can be used to detect the epitope-specific antibody, but the present invention is not limited thereto. More specifically, ELISA plates were coated with G14-I30 and S70-A87 peptides, respectively, and the serum of the experimental group was separated and subjected to indirect ELISA to detect each epitope-specific antibody. The inoculation group can be distinguished.

The features and advantages of the present invention are summarized as follows:

(a) The present invention provides an infection differentiation (DIVA) vaccine composition for inhibiting porcine reproductive and respiratory syndrome virus.

(b) The present invention provides a method for distinguishing between porcine reproductive and respiratory syndrome virus infected animals and vaccinated animals.

(c) Using the present invention, PRRSV can be suppressed with excellent efficiency as compared with the conventional PRRSV vaccine.

(d) Using the present invention, animals infected with PRRSV can be easily distinguished from vaccinated animals.

1 shows a schematic diagram of AcPERV-PRRSV, wherein (A) shows AcPERV-PRRSV / NA and (B) shows AcPERV-PRRSV / EU.
Figure 2 shows the European pig genital and respiratory syndrome virus GP5 phylogenetic tree.
Figure 3 shows the hydropathic profiles of N proteins
Figure 4 shows the expression of GP5, M and N proteins of porcine reproductive and respiratory syndrome viruses confirmed by reverse transcriptase polymerisation.
Figure 5 shows the antibody (IgG) to the pig genital and respiratory syndrome viruses (antiboby titer). Figure 5 (A) shows antibody titers against the North American type and (B) shows antibody titers against the European type.
FIG. 6 shows the result of evaluating the virus neutralizing ability of porcine reproductive and respiratory syndrome virus using mouse serum. Figure 6 (A) shows the neutralizing antibody titer for the North American type and Figure 6 (B) shows the neutralizing antibody titer for the European type.
Figure 7 shows interferon gamma quantitation results secreted in mouse splinocytes.
Fig. 8 shows the results of an experiment for distinguishing an infected animal from an inoculated animal through an antibody-positive reaction in an infected animal.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

Example

Example 1: Amplification of GP5, M, and N genes of porcine reproductive and respiratory syndrome viruses

GP5, M, and N were amplified using the sequence of the isolate LMY strain (NC_001961) in porcine reproductive and respiratory syndrome virus isolates. The primers are shown in Table 1 below.

primer The sequence (5'-3 ') GP5-F AAA AAGCTT ATGTTGGGGAGATGCTTGAC (SEQ ID No. 3) GP5-R AAA CTCGAG CTAAGGATGACCCCATTG (SEQ ID No. 4) M-F AAA AAGCTT ATGGGGTCATCCTTAGAT (SEQ ID No. 5) M-R AAA CTCGAG TTATTTGGCATATTTAACAAG (SEQ ID NO: 6) N-F_1-30 AAA AAGCTT ATGCCCAACAATAACGG (SEQ ID NO: 7 sequence) N-R_1-30 AAA CTCGAG TTAAATTATCTTACCCAGCATC (SEQ ID No. 8)

N protein amplified only the 1-30 amino acid portion to distinguish it from infection.

Example 2: Production of AcPERV-PRRSV

1, recombinant baculovirus was prepared using the Bac-to-Bac system (Invitrogen, USA) by cloning into pFastBac1 vector (Invitrogen, USA). 1 shows a schematic diagram of AcPERV-PRRSV, wherein (A) shows AcPERV-PRRSV / NA and (B) shows AcPERV-PRRSV / EU. The GP5 amino acid sequence of the North American PRRSV is shown in SEQ ID NO: 9, the GP5 amino acid sequence of the European PRRSV is shown in the sequence listing of SEQ ID NO: 10, but the * GP5 gene sequence (PRRSV ORF5) GP5 gene sequence. The amino acid sequence of the M protein of FIG. 1 (A) is shown in SEQ ID NO: 11, and the N-Truncate amino acid sequence of (B) (1-30 amino acid sequence) is shown in SEQ ID NO: 12.

As PRRSV is an RNA virus like influenza, the strain of influenza virus is changed every year. As the strain changes every year, it can be expected to improve the preventive effect by changing the gene sequence.

Figure 2 below shows the European pig genital and respiratory syndrome virus GP5 phylogenetic tree. Consensus was synthesized using the common sequence of European viruses found in Japan as the GP5 gene of European pig genital and respiratory syndrome virus synthesized for the present invention.

Example 3: Viruses and cells

Recombinant baculovirus was prepared using Invitrogen's Bac-to-Bac system and pFastbac 1 ^™ vector was used. Recombinant baculovirus was obtained from Invitrogen Sf-9 cells and Sf-9 cells were cultured in Sf-900II (Antibiotic-Antimycotic, 1X containing) medium.

MARC145 cells used for confirmation of expression were cultured in RPMI medium 1640 supplemented with 10% FBS, 1X antibiotic-antimycotic (Gibco BRL) and 1X MEM non-essential amino acid solution (Gibco BRL).

Example 4 Expression of Target Gene Using Reverse Transcriptase Polymerization

When MARC-145 cells reached 1 × 10 ⁵ / ml in a 25 T flask, the recombinant baculoviruses AcPERV-PRRSV / NA and AcPERV-PRRSV / EU were infected at 100 MOI, and incubated at 37 ° C. in a 5% CO ₂ incubator And cultured for 24 hours. Twenty-four hours later, the medium was changed. After 24 hours, 0.5 ml of Easy-BLUE (Intron, Korea) was added to the cell lysate, and the cell lysate was loosened using a vortex, followed by incubation at room temperature for 5 minutes. After 5 minutes, 0.2 ml of chloroform (Sigma, USA) was added, followed by gently mixing and centrifugation at 16,000 × g at 4 ° C for 30 minutes. Only the supernatant was transferred to a new 1.7 ml tube, followed by addition of 0.5 ml of isopropyl alcohol, followed by incubation at -80 ° C for 30 minutes. After centrifugation at 16,000 × g for 30 minutes at 4 ° C., the supernatant was discarded and the pellet was washed with 70% EtOH (DEPC). After centrifugation at 16,000 × g for 15 minutes at 4 ° C., the supernatant was discarded, air dried, and resuspended in 20 μl DEPC-treated water. RNA was treated with DNase I to remove all DNA except RNA, and then cDNA was synthesized.

11 μl of RNA and 1 μl of random hexamer (10 pmol / μl) were denatured at 65 ° C for 10 minutes and then annealed on ice for 30 minutes. 5 μl of 5 × buffer, 1 μl of dNTP mix (10 mM), 2 μl of DTT (100 mM), 1 μl of SuperScript ™ II RTase (200 units) and the remaining volume of DEPC-treated water by pipetting CDNA was synthesized at 42 ° C for 60 minutes, at 70 ° C for 15 minutes, and at 4 ° C. PCR was carried out using primers and GAPDH primers shown in Table 1 using the synthesized cDNA as a template to confirm the expression of GP5, M and N proteins.

Example 5: Animal experiment using a laboratory mouse

Six groups of 6-week-old mice were used in a total of 4 groups (5 mice per group). The first group received 100 μl of the PRRSV VR-2332 live-attenuated vaccine 1 × 10 ^4.9 TICD ₅₀ / ml (Boehringer Ingelheim, Germany) as a commercial vaccine. The second group was inoculated with 2 × 10 ⁷ / dose of each of AcPERV-PRRSV / NA and AcPERV-PRRSV / EU. The third group was inoculated with wild type baculovirus at 2 × 10 ⁷ / dose. The last group was inoculated with 100 μl of PBS. Two inoculations were performed at intervals of 3 weeks. Serum was sampled at 2 and 5 weeks, and an indirect ELISA was performed. Serum was collected at week 5 to measure neutralizing antibody levels. At the 5th week, mice were sacrificed and spleenocytes were separated and subjected to an interferon-gamma (IFN-γ) release test to measure the cellular immune response.

Example 6: Indirect ELISA

Porcine reproductive and respiratory syndrome viruses LMY strain and European type were used as an antigen of ELISA, and the coating buffer was diluted to 1 × 10 ⁴ TCID ₅₀ / ml on the plate, and 100 μl / well was coated and incubated overnight at 4 ° C. 2% BSA was dispensed in 150 μl of each well and blocking was performed at 37 ° C for 2 hours.

Mouse serum was diluted 1/100 with PBS and then subjected to 3-fold dilution by end point dilution. 100 [mu] l per well of each plate was dispensed in duplicate, followed by incubation at room temperature for 2 hours. After 2 hours, PBST (PBS + 0.1% Tween 20) was dispensed in 200 μl of each well and washed three times. Then, anti-pig IgG rabbit antibody (santacruz, USA) was diluted 1 / 2,000 with 1% BSA, and 60 [mu] l per well was diluted and incubated at room temperature for 1 hour. After washing three times with PBST, 100 μl of TMB Peroxidase EIA Substrate Kit (Bio-rad, USA) was dispensed per well. After stopping the reaction with 1 N sulfuric acid, ELISA reader (Bio-rad, USA) Specific antibody titer was measured by reading the value at 450 nm.

Example 7: Neutralizing assay < RTI ID = 0.0 >

MARC-145 cells were plated on a 96-well flat plate at a rate of 1 × 10 ⁴ cells / well, followed by addition of 5% CO ₂ Lt; / RTI > overnight. Each mouse serum was incubated at 56 ° C for 30 minutes, diluted twice from 1/4, mixed with 50 μl of the same volume of PRRSV 200 TCID50, and incubated at 37 ° C and 5% CO ₂ for 1 hour. The diluted mixture was dispensed into each well and cultured at 37 ° C and 5% CO ₂ for 7 days. After 7 days, the cells were stained with 0.5% crystal violet for 10 minutes and then washed three times with PBS to confirm the CPE of the cells. The highest serum dilution CPE was measured.

Example 8: Interferon gamma release assay (release assay)

Splinocytes were dispensed into 24-well plates at 2 × 10 ⁶ / ml per well, and incubated at 37 ° C. and 5% CO ₂ for 72 hours after 200 TCID ₅₀ treatment for pig genital and respiratory syndrome viruses. The amount of interferon gamma secreted was measured using a commercial mouse interferon gamma immunoassay ELISA kit (Invitrogen, US) using the supernatant.

Example 9: Distinguishing between vaccinated and infected animals

ELISA was used to distinguish between vaccinated and infected animals. Figure 3 below shows the hydropathic profiles of the N protein. Only two of the two epitopes of the N protein, G14DGQPVNQLCQMLGKII30 (G14-I30), were used in the vaccine to monitor immunization and to identify infected animals. The ELISA plates were coated with the peptides G14-I30 and S70ERQLCLSSIQTAFNQGA87 (S70-A87), respectively, and the serum of the experimental group was separated and subjected to indirect ELISA to distinguish between vaccinated and infected animals. The N protein is very similar to the European and North American type, so it can be diagnosed very accurately when diagnosing the differentiation of infected animals.

Experiment result

1. Expression of GP5, M and N proteins in porcine reproductive and respiratory syndrome

Expression of GP5, M, and N proteins in the mRNA stage was confirmed by RT - PCR. GP5, M, and N proteins were expressed using the primers used in Table 1 (see FIG. 3). Expression of GP5, M and N proteins in porcine reproductive and respiratory syndrome viruses was confirmed using reverse transcriptase polymerase (Fig. 4).

2. Humoral immunity

2-1. Detection of antibodies against pig genital and respiratory syndrome through indirect ELISA

Figure 5 below shows the antibody (IgG) to the pig genital and respiratory syndrome viruses (antiboby titer). Figure 5 (A) shows antibody titers against the North American type and (B) shows antibody titers against the European type. As a result of measurement of specific antibody of GP5 protein of PRRSV LMY strain using indirect ELISA, it was confirmed that AcPERV-PRRSV derived from the present invention shows higher antibody affinity than commercial vaccine (see FIG. 5). This means that AcPERV-PRRSV has higher homology than commercial vaccines, and it is more effective in domestic isolates.

2-2. Neutralization ability evaluation

FIG. 6 shows the results of evaluating the virus neutralizing ability of porcine reproductive and respiratory syndrome using mouse serum. Figure 6 (A) shows the neutralizing antibody titer for the North American type and Figure 6 (B) shows the neutralizing antibody titer for the European type. As in the ELISA results, AcPERV-PRRSV has a higher neutralizing capacity than the commercial vaccine (see FIG. 6). This means that the developed product is more homologous to the domestic isolate than the commercial vaccine and exhibits better immunogenicity than the commercial vaccine.

3. Cellular immunity

Figure 7 shows the results of interferon gamma quantitation secreted from mouse splinocytes. As shown in FIG. 7, AcPERV-PRRSV shows higher interferon gamma secretion than the commercial vaccine. As a result, this product shows better therapeutic effect and relieves symptoms of infection when infected with pig genital and respiratory syndrome.

4. Differentiating Infected from Vaccinated Animals (DIVA)

For infected animals, G14-I30 and S70-A87 Since antibodies against both epitopes are produced, the infected animal exhibits an antibody-positive response to both peptides. However, in the vaccinated group, G14-I30 It is possible to distinguish from infected animals because they are exposed only to peptides and form antibodies (see Fig. 8).

AcPERV-PRRSV exhibits superior humoral and cellular immune responses compared to commercial vaccines. This indicates that AcPERV-PRRSV is a more useful vaccine. It can also be used as a DIVA vaccine by expressing N protein truncate. It can be used to isolate inoculation and infection by not expressing S70-A87 antibody by expressing G14-I30 among the major markers of N protein (see FIG. 3). This is a vaccine that can overcome the drawbacks of not being able to distinguish between vaccine infections and vaccinated animals. By using this vaccine, only infected pigs can be isolated and culled.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the present invention. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

<110> Konkuk University Industrial Cooperation Corp. <120> Differentiating Infected from Vaccinated Animals Vacine for          Porcine Reproductive and Respiratory Syndrome Virus <130> PN140333 <160> 12 <170> Kopatentin 2.0 <210> 1 <211> 535 <212> PRT <213> Artificial Sequence <220> <223> PERV <400> 1 Met His Pro Thr Leu Ser Arg Arg His Leu Pro Ile Arg Gly Gly Lys   1 5 10 15 Pro Lys Arg Leu Lys Ile Pro Leu Ser Phe Ala Ser Ile Ala Trp Phe              20 25 30 Leu Thr Leu Ser Ile Thr Pro Gln Val Asn Gly Lys Arg Leu Val Asp          35 40 45 Ser Pro Asn Ser Lys Pro Leu Ser Leu Thr Trp Leu Leu Thr Asp      50 55 60 Ser Gly Thr Gly Ile Asn Ile Asn Ser Thr Gln Gly Glu Ala Pro Leu  65 70 75 80 Gly Thr Trp Trp Pro Glu Leu Tyr Val Cys Leu Arg Ser Val Ile Pro                  85 90 95 Gly Leu Asn Asp Gln Ala Thr Pro Pro Asp Val Leu Arg Ala Tyr Gly             100 105 110 Phe Tyr Val Cys Pro Gly Pro Pro Asn Asn Glu Glu Tyr Cys Gly Asn         115 120 125 Pro Gln Asp Phe Phe Cys Lys Gln Trp Ser Cys Val Thr Ser Asn Asp     130 135 140 Gly Asn Trp Lys Trp Pro Val Ser Gln Gln Asp Arg Val Ser Ser Ser Ser 145 150 155 160 Phe Val Asn Asn Pro Thr Ser Tyr Asn Gln Phe Asn Tyr Gly His Gly                 165 170 175 Arg Trp Lys Asp Trp Gln Gln Arg Val Gln Lys Asp Val Arg Asn Lys             180 185 190 Gln Ile Ser Cys His Ser Leu Asp Leu Asp Tyr Leu Lys Ile Ser Phe         195 200 205 Thr Glu Lys Gly Lys Gln Glu Asn Ile Gln Lys Trp Val Asn Gly Met     210 215 220 Ser Trp Gly Ile Val Tyr Tyr Gly Gly Ser Gly Arg Lys Lys Gly Ser 225 230 235 240 Val Leu Thr Ile Arg Leu Arg Ile Glu Thr Gln Met Glu Pro Pro Val                 245 250 255 Ala Ile Gly Pro Asn Lys Gly Leu Ala Glu Gln Gly Pro Pro Ile Gln             260 265 270 Glu Gln Arg Pro Ser Pro Asn Pro Ser Asp Tyr Asn Thr Thr Ser Gly         275 280 285 Ser Val Pro Thr Glu Pro Asn Ile Thr Ile Lys Thr Gly Ala Lys Leu     290 295 300 Phe Ser Leu Ile Gln Gly Ala Phe Gln Ala Leu Asn Ser Thr Thr Pro 305 310 315 320 Glu Ala Thr Ser Ser Cys Trp Leu Cys Leu Ala Ser Gly Pro Pro Tyr                 325 330 335 Tyr Glu Gly Met Ala Arg Gly Gly Lys Phe Asn Val Thr Lys Glu His             340 345 350 Arg Asp Gln Cys Thr Trp Gly Ser Gln Asn Lys Leu Thr Leu Thr Glu         355 360 365 Val Ser Gly Lys Gly Thr Cys Ile Gly Met Val Pro Ser Ser His Gln     370 375 380 His Leu Cys Asn His Thr Glu Ala Phe Asn Arg Thr Ser Glu Ser Gln 385 390 395 400 Tyr Leu Val Pro Gly Tyr Asp Arg Trp Trp Ala Cys Asn Thr Gly Leu                 405 410 415 Thr Pro Cys Val Ser Thr Leu Val Phe Asn Gln Thr Lys Asp Phe Cys             420 425 430 Val Met Val Gln Ile Val Pro Arg Val Tyr Tyr Tyr Pro Glu Lys Ala         435 440 445 Val Leu Asp Glu Tyr Asp Tyr Arg Tyr Asn Arg Pro Lys Arg Glu Pro     450 455 460 Ile Ser Leu Thr Leu Ala Val Met Leu Gly Leu Gly Val Ala Ala Gly 465 470 475 480 Val Gly Thr Gly Thr Ala Ala Leu Ile Thr Gly Pro Gln Gln Leu Glu                 485 490 495 Lys Gly Leu Ser Asn Leu His Arg Ile Val Thr Glu Asp Leu Gln Ala             500 505 510 Leu Glu Lys Ser Val Ser Asn Leu Glu Glu Ser Leu Thr Ser Leu Ser         515 520 525 Glu Val Val Leu Gln Asn Arg     530 535 <210> 2 <211> 1605 <212> DNA <213> Artificial Sequence <220> <223> PERV <400> 2 atgcatccca cgttaagccg gcgccacctc ccgattcggg gtggaaagcc gaaaagactg 60 aaaatcccct taagcttcgc ctccatcgcg tggttcctta ctctgtcaat aactcctcaa 120 gttaatggta aacgccttgt ggacagcccg aactcccata aacccttatc tctcacctgg 180 ttacttactg actccggtac aggtattaat attaacagca ctcaagggga ggctcccttg 240 gggacctggt ggcctgaatt atatgtctgc cttcgatcag taatccctgg tctcaatgac 300 caggccacac cccccgatgt actccgtgct tacgggtttt acgtttgccc aggaccccca 360 aataatgaag aatattgtgg aaatcctcag gatttctttt gcaagcaatg gagctgcgta 420 acttctaatg atgggaattg gaaatggcca gtctctcagc aagacagagt aagttactct 480 tttgttaaca atcctaccag ttataatcaa tttaattatg gccatgggag atggaaagat 540 tggcaacagc gggtacaaaa agatgtacga aataagcaaa taagctgtca ttcgttagac 600 ctagattact taaaaataag tttcactgaa aaaggaaaac aagaaaatat tcaaaagtgg 660 gtaaatggta tgtcttgggg aatagtgtac tatggaggct ctgggagaaa gaaaggatct 720 gttctgacta ttcgcctcag aatagaaact cagatggaac ctccggttgc tataggacca 780 aataagggtt tggccgaaca aggacctcca atccaagaac agaggccatc tcctaacccc 840 tctgattaca atacaacctc tggatcagtc cccactgagc ctaacatcac tattaaaaca 900 ggggcgaaac tttttagcct catccaggga gcttttcaag ctcttaactc cacgactcca 960 gaggctacct cttcttgttg gctttgctta gcttcgggcc caccttacta tgagggaatg 1020 gctagaggag ggaaattcaa tgtgacaaag gaacatagag accaatgtac atggggatcc 1080 caaaataagc ttacccttac tgaggtttct ggaaaaggca cctgcatagg gatggttccc 1140 ccatcccacc aacacctttg taaccacact gaagccttta atcgaacctc tgagagtcag 1200 tatctggtac ctggttatga caggtggtgg gcatgtaata ctggattaac cccttgtgtt 1260 tccaccttgg ttttcaacca aactaaagac ttttgcgtta tggtccaaat tgtcccccgg 1320 gtgtactact atcccgaaaa agcagtcctt gatgaatatg actatagata taatcggcca 1380 aaaagagagc ccatatccct gacactagct gtaatgctcg gattgggagt ggctgcaggc 1440 gtgggaacag gaacggctgc cctaatcaca ggaccgcaac agctggagaa aggacttagt 1500 aacctacatc gaattgtaac ggaagatctc caagccctag aaaaatctgt cagtaacctg 1560 gaggaatccc taacctcctt atctgaagtg gttctacaga acaga 1605 <210> 3 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer (GP5-F) <400> 3 aaaaagctta tgttggggag atgcttgac 29 <210> 4 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer (GP5-R) <400> 4 aaactcgagc taaggatgac cccattg 27 <210> 5 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer (M-F) <400> 5 aaaaagctta tggggtcatc cttagat 27 <210> 6 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer (M-R) <400> 6 aaactcgagt tatttggcat atttaacaag 30 <210> 7 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer (N-F_1-30) <400> 7 aaaaagctta tgcccaacaa taacgg 26 <210> 8 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> primer (N-R_1-30) <400> 8 aaactcgagt taaattatct tacccagcat c 31 <210> 9 <211> 200 <212> PRT <213> GP5 from Porcine Reproductive and Respiratory Syndrome Virus NA type <400> 9 Met Leu Gly Arg Cys Leu Thr Ala Gly Cys Cys Ser Gln Leu Leu Phe   1 5 10 15 Leu Trp Cys Ile Val Ser Ser Cys Phe Val Ala Ile Val Ser Ala Asn              20 25 30 Asn Ser Ser Ser Asn Leu Gln Leu Ile Tyr Asn Leu Thr Leu Cys          35 40 45 Glu Leu Asn Gly Thr Asp Trp Leu Ala Asn Arg Phe Asp Trp Ala Val      50 55 60 Glu Cys Phe Val Ile Phe Pro Val Leu Thr His Ile Val Ser Tyr Gly  65 70 75 80 Ala Leu Thr Thr Ser His Phe Leu Asp Thr Val Gly Leu Val Thr Val                  85 90 95 Ser Thr Ala Gly Phe Val His Gly Arg Tyr Val Leu Ser Ser Ile Tyr             100 105 110 Ala Val Cys Ala Leu Ala Ala Leu         115 120 125 Lys Asn Cys Met Ser Trp Arg Tyr Ser Cys Thr Arg Tyr Thr Asn Phe     130 135 140 Leu Leu Asp Thr Lys Gly Arg Leu Tyr Arg Trp Arg Ser Ser Val Valle 145 150 155 160 Ile Glu Lys Arg Gly Lys Val Glu Val Glu Gly Gln Lys Ile Asp Leu                 165 170 175 Lys Arg Val Val Leu Asp Gly Ser Ala Ala Thr Pro Val Thr Arg Val             180 185 190 Ser Ala Glu Gln Trp Gly His Pro         195 200 <210> 10 <211> 201 <212> PRT <213> GP5 from Porcine Reproductive and Respiratory Syndrome Virus EU type <400> 10 Met Arg Cys Ser His Lys Leu Gly Arg Phe Leu Ile Pro His Ser Cys   1 5 10 15 Phe Trp Trp Leu Phe Leu Leu Cys Thr Gly Leu Ser Trp Ser Phe Ala              20 25 30 Asp Gly Asn Gly Asn Ser Ser Thr Tyr Gln Tyr Ile Tyr Asn Leu Thr          35 40 45 Ile Cys Glu Leu Asn Gly Thr Ala Trp Leu Ser Thr His Phe Pro Trp      50 55 60 Ala Val Glu Thr Phe Val Leu Tyr Pro Val Ala Thr His Ile Leu Ser  65 70 75 80 Leu Gly Phe Leu Thr Thr Ser His Phe Phe Asp Ala Leu Gly Leu Gly                  85 90 95 Ala Val Ser Ile Thr Gly Phe Cys Asp Lys Arg Tyr Val Leu Ser Ser             100 105 110 Ile Tyr Gly Ala Cys Ala Leu Ala Ala Phe Val Cys Phe Ala Ile Arg         115 120 125 Ala Ala Lys Asn Cys Met Ala Cys Arg Tyr Ala Arg Thr Arg Phe Thr     130 135 140 Asn Phe Ile Val Asp Asp Arg Gly Arg Ile His Arg Trp Lys Ser Pro 145 150 155 160 Val Val Val Glu Lys Leu Gly Lys Ala Glu Ile Gly Gly Asp Leu Val                 165 170 175 Thr Ile Lys His Val Val Leu Glu Gly Val Lys Ala Gln Pro Leu Thr             180 185 190 Arg Thr Ser Ala Glu Gln Trp Glu Ala         195 200 <210> 11 <211> 174 <212> PRT <213> M from Porcine Reproductive and Respiratory Syndrome Virus <400> 11 Met Gly Ser Ser Leu Asp Asp Phe Cys His Asp Ser Thr Ala Pro Gln   1 5 10 15 Lys Val Leu Leu Ala Phe Ser Ile Thr Tyr Thr Pro Val Met Ile Tyr              20 25 30 Ala Leu Lys Val Ser Arg Gly Arg Leu Leu Gly Leu Leu His Leu Leu          35 40 45 Ile Phe Leu Asn Cys Ala Phe Thr Phe Gly Tyr Met Thr Phe Met His      50 55 60 Phe Gln Ser Thr Asn Lys Val Ala Leu Thr Met Gly Ala Val Val Ala  65 70 75 80 Leu Leu Trp Gly Val Tyr Ser Ala Ile Glu Thr Trp Arg Phe Ile Thr                  85 90 95 Ser Arg Cys Arg Leu Cys Leu Leu Gly Arg Lys Tyr Ile Leu Ala Pro             100 105 110 Ala His His Val Glu Ser Ala Ala Gly Phe His Pro Ile Ala Ala Asn         115 120 125 Asp Asn His Ala Phe Val Val Arg Arg Pro Gly Ser Thr Thr Val Asn     130 135 140 Gly Thr Leu Val Pro Gly Leu Lys Ser Leu Val Leu Gly Gly Arg Lys 145 150 155 160 Ala Val Lys Gln Gly Val Val Asn Leu Val Lys Tyr Ala Lys                 165 170 <210> 12 <211> 30 <212> PRT <213> Artificial Sequence <220> <223> 1-30 A.A. from ORF7 of Porcine Reproductive and Respiratory          Syndrome Virus <400> 12 Met Pro Asn Asn Asn Gly Lys Gln Gln Lys Arg Lys Lys Gly Asp Gly   1 5 10 15 Gln Pro Val Asn Gln Leu Cys Gln Met Leu Gly Lys Ile Ile              20 25 30

Claims (13)

(a) a nucleic acid sequence encoding a porcine endogenous retroviral envelope protein; (b) a first promoter operably linked to said envelope protein coding sequence; (c) a nucleic acid sequence encoding a GP5 protein of porcine reproductive and respiratory syndrome virus; (d) a second promoter operably linked to said GP5 protein coding sequence; (e) a nucleic acid sequence encoding an N protein in which an epitope of one of G14-I30 and S70-A87 which is an epitope of the N protein of the porcine reproductive and respiratory syndrome virus has been deleted; And (f) a first recombinant baculovirus vector comprising a third promoter operably linked to the N protein coding sequence lacking said one epitope as an active ingredient. DIVA) vaccine composition.
2. The composition of claim 1, wherein said envelope protein coding sequence comprises a nucleic acid sequence encoding an amino acid sequence of SEQ ID &lt; RTI ID = 0.0 &gt; 1 &lt; / RTI &gt;
3. The composition of claim 2, wherein the nucleic acid sequence encoding the amino acid sequence of the first sequence of Sequence Listing is a nucleic acid sequence comprising the second sequence of Sequence Listing.
2. The composition of claim 1, wherein the first promoter is selected from the group consisting of a polyhedrin promoter, baculovirus IE-1 promoter, IE-2 promoter, p35 promoter, p10 promoter and gp64 promoter.
The method of claim 1, wherein the second promoter and the third promoter are selected from the group consisting of CMV (cytomegalo virus) promoter, U6 promoter, H1 promoter, late adenovirus promoter, Vexinia virus 7.5K promoter, SV40 promoter, HSV tk promoter, RSV promoter Promoter of the human IL-4 gene, promoter of the human lymphotoxin gene, promoter of the human IL-2 gene, promoter of the human IL-2 gene, promoter of the human IL- Wherein the promoter is the same or different promoter selected from the group consisting of a promoter of a human GM-CSF gene, a TERT promoter, a PSA promoter, a PSMA promoter, a CEA promoter, an E2F promoter AFP promoter and an albumin promoter.
2. The composition of claim 1, wherein the deletion is an S70-A87 epitope deletion.
2. The composition of claim 1, wherein the N protein deleted from the one epitope consists of the 1-70 amino acid sequence of ORF7 (Open reading frame 7) of the porcine reproductive and respiratory syndrome viruses.
8. The composition of claim 7, wherein the N protein from which the one epitope is deleted comprises the 1-30 amino acid sequence of ORF7 (Open reading frame 7) of the porcine reproductive and respiratory syndrome viruses.
The recombinant baculovirus vector of claim 1, further comprising: (a) a nucleic acid sequence encoding a porcine reproductive and respiratory syndrome virus M protein; and (b) a fourth promoter operably linked to the M protein coding sequence. &Lt; / RTI &gt;
2. The composition of claim 1, wherein said infection differentiating vaccine composition further comprises a second recombinant baculovirus vector,
(a) a nucleic acid sequence encoding a porcine endogenous retroviral envelope protein; (b) a fifth promoter operably linked to said envelope protein coding sequence; (c) a nucleic acid sequence encoding a GP5 protein of porcine reproductive and respiratory syndrome virus; (d) a sixth promoter operably linked to said GP5 protein coding sequence; (e) a nucleic acid sequence encoding the M protein of a porcine reproductive and respiratory syndrome virus; And (f) a seventh promoter operably linked to the M protein coding sequence.
11. The composition of claim 10, wherein the first recombinant baculovirus vector and the second recombinant baculovirus vector have a volume ratio of 100: 1 to 1: 5.
12. A method for preventing or treating a porcine reproductive and respiratory syndrome virus infected animal comprising measuring the amount of expression of an epitope of a porcine reproductive and respiratory syndrome virus N protein on a biological sample separated from an object to which the composition of any one of claims 1 to 11 is administered And Vaccinated Animals: When expressing a deleted epitope of the N protein in the N protein epitope expression, the animal is judged to be an infected animal.
13. The method of claim 12, wherein the measurement of the amount of N protein epitope expression is performed by detecting the epitope-specific antibody.

Images