KR101931012B1 - Entomopathogenic fungi and microbidal insecticide comprising same - Google Patents

Abstract

The present invention relates to an insect pathogenic fungus, Metarhizium anisopliae , JEF-314 strain and a microbial insecticide comprising the same. The strain of the present invention exerts an excellent effect in controlling insects such as beetles and mites, and has the effect of reducing the production period and cost compared with the conventional methods by solid culture.

Description

TECHNICAL FIELD [0001] The present invention relates to insect pathogenic fungi and microbial pesticides containing the same,

The present invention relates to an insect pathogenic fungus, Metarhizium anisopliae , JEF-314 strain and a microbial insecticide comprising the same.

Recently, there have been reports of scabies larvae that cause serious problems in lawns, small herpes zoster ( Haemaphysalis ) that mediates Lyme disease, spot fever and severe febrile thrombocytopenia syndrome (SFTS) longicornis ) are increasingly in need.

In Korea, the focus is on the status and epidemiological investigation and monitoring for the development of ticks and mites, known as murder mites, and studies on repellents using plant natural materials are being conducted by domestic universities and research institutes. However, there have been no studies on the field application control using microbes for eco - friendly mites that have excellent environmental settlement ability.

In the case of beetle larvae, a large amount of chemical pesticides are sprayed for decades to control, but the demand for the development of an alternative control agent is rapidly increasing due to the problem of residual soil and resistance. In order to replace chemical pesticides, insect pathogenic nematodes and predatory / parasitic nemesis have been researched and developed, but national support for research and development is urgently needed.

On the other hand, if the outside is underway mite control study using a secure pesticidal microorganisms in Metairie Clear (Metarhizium) in the beam Beria (Beauveria) fungi in humans. Research and development using insect pathogenic nematodes ( Heterorhabditis sp. And Steinernema glaseri ) have been underway in order to control the larvae of grasses (such as orange long-legged beetle and spotted beetle) in grass , and various insect pathogenic fungi Studies on the control of beetle larvae have been actively conducted in the USA, China and India. Products using Bacillus popilliae (eg, Milky Spore) as an insecticidal bacterium for the control of beetle larvae have been industrialized, but the market ripple effect is not known to be significant.

There is a strong demand for the development of new microbial pesticides that are harmless to the human body in Korea, easy to handle, easy to manufacture, and commercially available.

Korean Patent Publication No. 10-2016-0084968 Korean Patent Publication No. 10-2014-0062099

The present invention relates to an insect pathogenic fungus, Metarhizium anisopliae , JEF-314 strain, a microbial insecticide comprising the same, and a method for producing the microbial insecticide.

An aspect of the present invention relates to a method for the treatment of insect pathogenic bacteria, JEF-314 strain (KFCC11671P).

According to an embodiment of the present invention, the insect may be any one selected from the group consisting of a beetle, a beetle, a flower beetle, a mite, a grasshopper, a fly, an insect worm, an irritant and combinations thereof.

An aspect of the present invention relates to a method for producing a microorganism which is selected from the group consisting of a methallysium anisophelia JEF-314 strain, a spore of the strain, a culture of the strain, a concentrate of the strain, a dried product of the culture, The present invention provides a microbial pesticide containing any one of them.

One aspect of the present invention is a method for producing a recombinant vector comprising the steps of: culturing a strain of Metarijium anisopaea JEF-314 in a solid culture medium; And harvesting the culture. The present invention also provides a method for producing a microorganism pesticide.

According to one embodiment of the present invention, the solid culture medium may be selected from the group consisting of crude, millet, bran, sorghum, cuttlefish, oats, millet, mung bean, perilla, buckwheat, meso, barley, sorghum, sesame, ≪ RTI ID = 0.0 > and / or < / RTI >

According to one embodiment of the present invention, the culture may be performed at 20 to 30 DEG C for 10 to 20 days.

One aspect of the present invention provides a microbial insecticide produced by the above production method.

In accordance with the present invention, The JEF-314 strain and the microbial insecticide containing the same have a broad insecticidal spectrum such as beetle, tick, and thrips. Especially, in the case of beetle larvae and small-scale mite ticks, .

In addition, the method for producing a microbial insecticide by the solid culture method according to the present invention has a simpler production process than the known liquid formulation method, and thus shows excellent effects in terms of manufacturing time and cost reduction.

Fig. 1 shows the observation results of the JEF-314 strain according to the present invention with the naked eye (a) and the microscope (400-fold) (b and c).
Figure 2 shows the nucleotide sequence analysis result of the beta-tubulin region of the JEF-314 strain according to the present invention.
FIG. 3 shows a result obtained by comparing the β-tubulin sequence of the JEF-314 strain according to the present invention with the previously reported microorganisms of the genus Metarijum.
FIGS. 4 and 5 show the insecticidal effect of the JEF-314 strain according to the present invention on larvae of beetle and the result of mycosis formation after 14 days of strain treatment.
FIGS. 6 and 7 show the insecticidal effect against the small soaking mite of the JEF-314 strain according to the present invention and the fungal infection occurrence result after 14 days of the strain treatment.
8 shows the insecticidal effect of the JEF-314 strain according to the present invention on the flower yellow thrips.

While searching for insect pathogenic fungi for controlling scarab larvae and small mites, the present inventors have found that, JEF-314 strain (KFCC11671P) was newly isolated, and it was confirmed that the strain had an insect pathogenicity, and the microbial insecticide using the same was completed.

An aspect of the present invention relates to a method for the treatment of insect pathogenic bacteria, JEF-314 strain (KFCC11671P).

The term " JEF-314 strain "was prepared by isolating the methyrizium anisopolia strain, which exhibits excellent insecticidal effect against insects, specifically beetles larvae and small mites, among the fungi isolated from natural soil by the present inventors through bioassay Then, the isolated strain was morphologically identified, and the genomic DNA sequence was analyzed. The strain was found to have about 99% homology with the previously known methallysium anisopolia strain, and was identified as a methylanium anosyphryae strain , And was named JEF-314, and deposited on July 04, 2016 at the Korean Society for Microbiological Conservation (KFCC11671P).

As used herein, the term "insect" may be a pest, which includes, but is not limited to, garden insects and water insects. Such insects include, but are not limited to, beetles such as beetles, blooms, mites such as late mite ticks, specifically small mite mites, thrips, such as flower thrips.

An aspect of the present invention relates to a method for producing a microorganism which is selected from the group consisting of a methallysium anisophelia JEF-314 strain, a spore of the strain, a culture of the strain, a concentrate of the strain, a dried product of the culture, The present invention provides a microbial pesticide containing any one of them.

The above- The spore of the JEF-314 strain was obtained from Can be produced by culturing the inoculum of the JEF-314 strain in a solid culture medium.

One aspect of the present invention is a method for producing a recombinant vector comprising the steps of: culturing a strain of Metarijium anisopaea JEF-314 in a solid culture medium; And harvesting the culture. The present invention also provides a method for producing a microorganism pesticide.

The method for producing microbial pesticides by solid culture according to the present invention preferably takes about 2 weeks and can shorten the time by about 1 week compared to the method of producing a liquid preparation which takes about 3 weeks.

As used herein, the term "solid culture medium" may be any one selected from the group consisting of crude, millet, white rice, wheat bran, millet, and combinations thereof, but is not limited thereto and is preferably a batch.

The solid culture medium may further comprise an organic acid. The organic acid may be any one selected from the group consisting of citric acid, propionic acid, butyric acid, lactic acid, succinic acid, clonic acid, valeric acid, caproic acid and combinations thereof, Citric acid is preferred.

The method for producing the microbial insecticide may further comprise the step of immersing the solid culture medium. The step of immersing can be carried out by leaving it in water at 80 DEG C to 100 DEG C, preferably at 90 DEG C for 0.5 to 1.5 hours, preferably for 1 hour. The immersion may be performed by, for example, but not limited to, water bath.

The method for producing the microbial insecticide may further comprise the step of sterilizing the solid culture medium. The sterilization may be performed by a sterilization treatment at 110 ° C to 130 ° C, preferably at 121 ° C for 10 minutes to 30 minutes, preferably for 15 minutes.

As used herein, the term "cultivation" can be carried out according to the culture method of microorganisms commonly used in the technical field of the present invention. The culture may be performed at 20 캜 to 30 캜, preferably at 25 캜 for 5 days to 10 days, preferably 7 days, but is not limited thereto.

The method for producing the microbial insecticide may further include a step of drying after solid culture. The drying may be performed by a method of drying naturally at 20 ° C to 30 ° C, preferably at room temperature for 12 hours to 3 days, preferably for 1 day, but is not limited thereto.

The microbial insecticide according to the present invention can be used as a method for controlling insects by treating the soil after the solid culture and has a simple production method and use method compared with the conventional dilute spray formulations such as a wetting agent and a liquid wettable powder, The microbial control agent Beauveria bassiana ).

Hereinafter, the present invention will be described in more detail with reference to one or more embodiments. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

Example  1. Isolation and Identification of Strain

1.1. Isolation of strain

Metarialum No Sofia Among the fungi isolated from natural soil, JEF-314 isolates were isolated from mountainous areas in Hoengseong, Gangwon province in Korea, and showed excellent resistance to insecticides, especially scarab larvae and small mites.

1.2. Identification of the strain

The strain isolated in Example 1.1. Above was cultured in Sabraud Dextrose Agar (SDA) under darkness conditions of 25 for 14 days, and then observed under visual and optical microscope (400 times) (see FIG. 1). As a result of observation, it was confirmed how to form green spores and spores, which are typical characteristics of Metarylium genus.

For the identification of the strain, sequencing was performed after the PCR. PCR was carried out under the following conditions. 94 for 5 minutes, 94 to 60 seconds, 62 to 30 seconds for 72 to 30 seconds for each 30 times, and finally post maturation for 72 minutes to 3 minutes. ITS 1, the forward primer used, and ITS 4, the reverse primer, are set forth in Table 1 below, and electrophoresis of the PCR products was performed using a mixture of 0.8% agarose gel and EtBr , And the process was carried out at 140 V for 25 minutes. Finally, the product was finally identified as a methallysium anisophelia (FIG. 2 and SEQ ID NO: 3) through DNA sequencing analysis of the resulting product.

In addition, in order to confirm the flexible relationship with the previously known Metarylium sp. Strains, 14 kinds of meta-amylases reported in the National Center for Bioinformatics (http://www.ncbi.nlm.nih.gov/) The β-tubulin sequence of the Li glume strain was compared with that of the JEF-314 strain to compare its flexibility (see FIG. 3).

primer The sequence (5 '- > 3') Beta-Tubulin (Forward) GGTAACCAAATCGGTGCTGCTTTC Beta-tubulin (reverse direction) ACCCTCAGTGTAGTGACCCTTGGC

Example  2. Manufacture of microbial pesticides

200 g of Italian millet was added to a polyvinyl bag for culture, and then 0.16 ml of 50% citric acid was added. And the mixture was heat-treated at 90 for 1 hour by using a water bath so that water was sufficiently absorbed in the bath. The polyvinyl bag was treated at 121 for 15 minutes to sterilize the bath. The sterilized bath was cooled at room temperature, and the JEF-314 strain was suspended (1 x 10 ⁷ conidia / ml) and the suspension was inoculated into the polyvinyl bag in 1 ml increments. 25 to 7 days, and then dried at room temperature for 1 day to prepare a granular formulation of JEF-314 microorganism preparation.

Experimental Example  1. Microbial formulation White spotted flower plain Insecticidal effect on larvae  Confirm

In order to confirm the insecticidal effect of the microorganism preparation according to the present invention on the white spotted flower larva, 4 g of the JEF-314 microorganism preparation prepared in Example 2 was put into a round plastic container (90 mm × 45 mm) Spotted flowers ( Protaetia brevitarsis seulensis) 3 Lentivirus (beetle larvae) were treated with 5 rats (control group means no treatment). Daily 1 ml of distilled water was provided as a source of water, and the raw water was irradiated for 25 to 12 days.

As a result of the experiment, it was confirmed that the larvae were treated with JEF-314 from the 6th day after the treatment, and the larvae were observed at 0% of control and 60% of JEF-314 treatment on the 9th day of treatment. (See Fig. 4). After 14 days of treatment with JEF-314, the larvae of the control and JEF-314 treatments were observed to show mycosis in the strain treated with the control, 5).

Experimental Example 2. Identification of insecticidal effect against microbial microbial mites

The microbial agent of the present invention, a small herring mite ( Haemaphysalis longicornis ), 0.314 g (1 kg / a) of the JEF-314 microorganism preparation prepared in Example 2 was put into a water-treated gauzed test tube, and 10 small-sized mites were treated After 24 hours, live embryos were examined for 25 to 14 days.

As a result, it was confirmed that JEF-314 strain had higher mortality than the control without strain. On the 8th day of treatment, 11.18% of the control and 65.83% of the JEF-314 treatment were observed, and the bacterium treated with B. bassiana , a conventional microbial control agent, showed a rate of 30.69% (see FIG. 10 days after the treatment, it was confirmed that mycosis appeared in the JEF-314 strain treatment (see FIG. 7). Through this, it was confirmed that the JEF-314 strain according to the present invention exhibited a higher insecticidal effect against the tick than the microbial agent used in the past.

Experimental Example 3. Determination of the insecticidal effect on the flower yellow thrips of the microorganism preparation

In order to confirm the insecticidal effect of the microorganism preparation according to the present invention on the insect pests, the experiment was carried out in the same manner as in Experimental Example 1, except that a flower yellow insect worm was used in the experiment.

The results of the experiment showed that the JEF-314 strain was found to be more effective against the flower yellow moth worm than the flower yellow moth worm (Fig. 8), which was 96.67% in the JEF-314 treatment, 53.33% in the B. bassiana treatment and 3.33% And it showed high insecticidal effect.

The present invention has been described with reference to the preferred embodiments. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the present invention is defined by the appended claims rather than the foregoing description, and all changes or modifications derived from the meaning and scope of the claims and equivalents thereof are included in the scope of the present invention. .

Korea Microorganism Conservation Center (Domestic) KFCC11671P 20160704

<110> Industrial Cooperation Foundation CHONBUK NATIONAL UNIVERSITY <120> ENTOMOPATHOGENIC FUNGI AND MICROBIDAL INSECTICIDE COMPRISING SAME <130> PN160234 <160> 3 <170> Kopatentin 2.0 <210> 1 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> forward primer (beta-tubulin) <400> 1 ggtaaccaaa tcggtgctgc tttc 24 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> reverse primer (beta-tubulin) <400> 2 accctcagtg tagtgaccct tggc 24 <210> 3 <211> 566 <212> DNA <213> Metarhizium anisopliae <400> 3 tttgatctct ggtgacacgg cctcgacagc aatggtgtct acaacggtac ctctgagctc 60 cagctcgagc gtatgagcgt ctacttcaat gaggtaagtt tgaatgagcc gaatcctagg 120 atgttgagga accataggtt gttatcatcc atgggggaga tcaaagactg acgcggggac 180 tcccctcaaa aggcctccgg taacaagtat gttcctcgcg ccgtccttgt cgatcttgaa 240 cctggcacca tggatgccgt ccgtgccggt cctttcggtc agcttttccg tcccgacaac 300 ttcgtctttg gtcagtctgg tgctggcaac aattgggcca agggtcacta agtcgatctt 360 gaacctggca ccatggatgc cgtccgtgcc ggtcctttcg gtcagctttt ccgtcccgac 420 aacttcgtct ttggtcagtc tggtgctggc aacaattggg ccaagggtca ctaacctgga 480 gggtaaggaa aaaaaaaaaa aattaaaaaa ttattttatt attaatgtat tttttaagta 540 attattttat ttttttgtta tttttt 566

Claims (7)

As Metarhizium anisopliae JEF-314 strain (KFCC11671P) having insect pathogenicity,
Wherein the insect is any one selected from the group consisting of flowerless, thrips, and combinations thereof.
delete The method of any one of claims 1 to 3, wherein the strain is selected from the group consisting of the methallysium anisophelia JEF-314 strain, the spore of the strain, the culture of the strain, the concentrate of the strain, the dried product of the culture, Including microbial pesticides.
Culturing the strain of Metarialum anoploli JEF-314 of claim 1 in a solid culture medium; And
Harvesting the culture;
Lt; RTI ID = 0.0 &gt; pesticide. &Lt; / RTI &gt;
5. The method of claim 4,
The solid culture medium may be any one selected from the group consisting of crude, millet, bran, sorghum, cuttlefish, oats, millet, mung bean, perilla, buckwheat, meso, barley, sorghum, sesame, whole wheat, rice and combinations thereof &Lt; / RTI &gt;
5. The method of claim 4,
Wherein the cultivation is carried out at 20 to 30 DEG C for 10 to 20 days.
A microbial pesticide produced by the method according to any one of claims 4 to 6.

Images