KR101928446B1 - Genetic marker and method for detecting red-pepper powdery mildew resistance plants - Google Patents

Abstract

The present invention provides a genetic marker and a detection method for detecting a powdery mildew resistance plant in a pepper powdery mildew resistant cultivar, and capable of rapidly and accurately detecting a powdery mildew resistance factor.

Description

TECHNICAL FIELD [0001] The present invention relates to a genetic marker and a method for detecting red pepper powdery mildew resistance plants,

The present invention relates to a genetic marker and a detection method, and more particularly, to a genetic marker and a detection method for detection of a powdery mildew resistance plant in pepper.

Powdery mildew is developed in the tissues before the marking on the surface of the leaves, and the spots on the front face of the young leaves are developed, resulting in destruction of the thermal complexes, resulting in discoloration of yellow, deterioration of photosynthesis efficiency, This necrosis causes the leaves to be damaged and affects the growth and yield of the pepper. The pathogen is Leveillula taurica , which is known to be the active parasite belonging to the fungal genus. L. taurica is a complete generation of Oidiopsis taurica . It occurs when dry day and night temperature difference is large, such as spring or autumn. When sensitive cultivars are cultivated, it propagates by wind and becomes worse. Especially, powdery mildew powdery mildew disease of pepper increases annual production due to increase of cultivation of house facilities and change of cultivation environment due to climate change. However, chemical control method and nature friendly control method are used as a method for controlling powdery mildew. It has been reported that the control method using the disinfectant has a low control effect and increases the possibility of a new pathogen having resistance to the drug. In addition, there are biological control methods using environmentally friendly microorganisms or biological compounds as a natural control method, but the efficiency is not high and effective control methods for controlling powdery mildew at present are still insufficient. In this situation, the development of resistant molecular markers for cultivating the powdery mildew resistant cultivars of pepper is required. In this regard, Korea Patent Publication No. 0919753 discloses melon and melon powdery mildew resistance-associated SCAR markers and a method for selecting resistant melon cultivars using the same.

However, in the case of the prior art, there is a problem in that the procedure for detecting the powdery mildew resistance factor is complicated and the detection efficiency is low.

Disclosure of Invention Technical Problem [8] Accordingly, the present invention has been made to solve the above-mentioned problems, and it is an object of the present invention to provide a gene marker capable of rapidly and accurately detecting a powdery mildew resistance factor. However, these problems are exemplary and do not limit the scope of the present invention.

According to one aspect of the present invention there is provided a nucleic acid molecule comprising a nucleotide sequence selected from SEQ ID NO: 19 or a complementary nucleic acid sequence thereof, wherein the 853rd nucleotide of SEQ ID NO: 19 is a C or T single nucleotide polymorphism (SNP) To 100 or more consecutive nucleotides, or a DNA polynucleotide complementary thereto is provided.

According to another aspect of the present invention, there is provided a composition for identifying a red pepper powdery mildew disease comprising a probe capable of specifically detecting the polynucleotide or a pair of primers capable of specifically amplifying the polynucleotide do.

According to another aspect of the present invention, there is provided a genomic DNA extraction step of extracting genomic DNA from pepper; Wherein the extracted genomic DNA is used as a template and the nucleotide sequence of SEQ ID NO: 19 or its complementary nucleic acid sequence is selected and the 853rd base of SEQ ID NO: 19 contains C or T or a nucleic acid complementary thereto at the 3'- 15 to 50 nt of pepper powdery mildew resistance specific forward primer; And a primer pair selected from a nucleic acid sequence represented by SEQ ID NO: 19 or a complementary nucleic acid sequence thereof and comprising a reverse primer selected from a common sequence at positions other than the forward primer position; And determining the presence or absence of an amplification product in the amplification step and judging whether or not the resultant is resistant to powdery mildew powdery mildew in a red pepper powdery mildew disease or resistance determination method.

According to one embodiment of the present invention as described above, it is possible to quickly and accurately detect a powdery mildew resistance factor in order to cultivate a new variety resistant to powdery mildew. Of course, the scope of the present invention is not limited by these effects.

FIG. 1 is a graph showing the mapping of a single dominant gene Lv associated with Leveillula taurica on chromosome 12 in tomatoes for developing a powdery mildew resistance marker.
Fig. 2 is a graph showing the results of the Lycopersicon esculentum cv. (A and b) showing the mapping of three QTLs associated with Oidium neolycopersici using the F2 genetic population through crosses of Moneymaker and the resistant tomato Lycopersicon parviflorum G1.1601.
FIG. 3 is a graph showing the results of mapping 5 dominant genes associated with Oidium neolycopersici on chromosome 4, 6, and 12 and one recessive gene, 3 QTL, and Lv genes in a physical map of tomato.
FIG. 4 is a graph showing the results of analysis of pollen (PW-R, A) and pulsatile system (PW-S, B) grown in a seed company in order to confirm the polymorphism between the powdery mildew- It is a photograph showing the appearance.
5 is a gel photograph showing a DNA fragment amplified using CT129-F / R primer according to an embodiment of the present invention.
FIG. 6 is a graph showing the results of the nucleotide sequence polymorphism analysis of the DNA fragment amplified using the CT129-F / R primer according to an embodiment of the present invention.
FIG. 7 is a graph showing F3 analysis results of CTSNP markers in order to test the availability of F3-isolating populations and candidate markers of a commercially resistant mildew-resistant cultivar according to an embodiment of the present invention.
FIG. 8 is photographs showing the occurrence of powdery mildew in the F3 group according to an embodiment of the present invention.
FIG. 9 is a photograph showing an inoculated image formed in order to infect mildew disease in a natural state according to an embodiment of the present invention. FIG. 9 shows a case in which F3 (round flower pot) (Right), and F3, which is caused by powdery mildew.
FIG. 10 is a photograph showing a state of an F3 infant with powdery mildew according to an embodiment of the present invention.
11 is a photograph showing the occurrence of powdery mildew in the growing system according to an embodiment of the present invention.

Definition of Terms:

As used herein, the term "powdery mildew" is also referred to as whitepox, and about 20 pathogens include Erysiphe, Microsphaera, Podosphaera, ), Phillactinia, Sphaerotheca, and Uncinula (Uncinula), which are the most common species in the world. It occurs not only in crops but also in trees and is common in weeds. When the disease is caught, the fungal hyphae are entangled, and the plant turns grayish white, and the diseased part is twisted into an unsightly shape, causing the leaves or stalks to wilt and the quality of the fruit to fall.

As used herein, the term " quantitative trait loci " (QTL) refers to a locus that governs a quantitative trait and refers to a genetic marker selected through direct selection of the QTL or genetic markers associated with QTL Can be provided.

DETAILED DESCRIPTION OF THE INVENTION [

According to one aspect of the present invention there is provided a nucleic acid molecule comprising a nucleotide sequence selected from SEQ ID NO: 19 or a complementary nucleic acid sequence thereof, wherein the 853rd nucleotide of SEQ ID NO: 19 is a C or T single nucleotide polymorphism (SNP) To 100 or more consecutive nucleotides, or a DNA polynucleotide complementary thereto is provided.

According to another aspect of the present invention, there is provided a composition for identifying a red pepper powdery mildew disease comprising a probe capable of specifically detecting the polynucleotide or a pair of primers capable of specifically amplifying the polynucleotide do.

According to another aspect of the present invention, there is provided a genomic DNA extraction step of extracting genomic DNA from pepper; Wherein the extracted genomic DNA is used as a template and the nucleotide sequence of SEQ ID NO: 19 or its complementary nucleic acid sequence is selected and the 853rd base of SEQ ID NO: 19 contains C or T or a nucleic acid complementary thereto at the 3'- 15 to 50 nt of pepper powdery mildew resistance specific forward primer; And a primer pair selected from a nucleic acid sequence represented by SEQ ID NO: 19 or a complementary nucleic acid sequence thereof and comprising a reverse primer selected from a common sequence at positions other than the forward primer position; And determining the presence or absence of an amplification product in the amplification step and judging whether or not the resultant is resistant to powdery mildew powdery mildew in a red pepper powdery mildew disease or resistance determination method.

Hereinafter, the present invention will be described in more detail by way of examples. It should be understood, however, that the invention is not limited to the disclosed embodiments, but may be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, Is provided to fully inform the user.

Example 1: Molecular marker collection

In accordance with one embodiment of the present invention, molecular markers located in the powdery mildew resistance resistant QTL (quantitative trait loci) were collected. Generally, the pathogens of tomato powdery mildew among branches and crops are Oidium neolycopersici and Leveillula taurica , and the powdery mildew pathogenic bacteria of pepper is Leveillula taurica . Conventional studies have mapped the single dominant gene Lv associated with Leveillula taurica on chromosome 12 in tomatoes and reported CT121 and CT129 as proximity markers (Chunwongse et al ., Theoretical and Applied Genetics , 95 (1): 220-223, 1997) (Fig. 1). In addition, the disease susceptibility of Lycopersicon esculentum cv. Three QTLs associated with Oidium neolycopersici were mapped using the F2 genetic group through the crossing of Moneymaker and the resistant tomato Lycopersicon parviflorum G1.1601, and it was confirmed that Ol-qtl2 located on chromosome 12 was located near the Lv gene Bai Y. et al ., Mol. Plant-Microbe Interactions, 16 (2), 169-176, 2003) (Fig. In recent years, five dominant genes associated with chromosomes 4, 6, and 12 of Oidium neolycopersici and one febrile gene and three QTLs and Lv genes were mapped in the physical map of tomatoes (Seifi Alireza et al ., European J. of Plant Pathology , 2013) (Figure 3).

Example 2: Identification of polymorphisms of gene proximity markers

According to one embodiment of the present invention, the proximity marker of the resistance to powdery mildew disease reported in the prior art was obtained and the polymorphism of the marker was confirmed. The polymorphism between the powdery mildew-resistant strain of the pepper and the heterozygous line was confirmed using the proximity marker of the powdery mildew resistance gene based on the studies reported in the above study. The resistance system used leaf samples of the powdery mildew resistance system (PW-R, A) distributed from an external seed company and the leaf-like strain used leaf samples of the powdery mildew system (PW-S, B) .

As a result, no polymorphism was observed in all proximity markers except the CT129 marker. Table 1 shows the proximity markers of the powdery mildew resistance gene based on the reported studies.

Marker name The base sequence (5 '- > 3') SEQ ID NO: CT129-F TCTGTGATCTGATATGTCTAAG One CT129-R CTCCTGGGGTAAGTTTC 2 CT100-F GATAACAAAAGGGCAAACATG 3 CT100-R CAATTACTGTGCTGATTCTAAG 4 TG568-F GGTACCGCATCATTCTTTTTGGGAC 5 TG568-R GTTGTAACACATTTAGGGGTAAG 6 CD03-F CTTTAGCACATAATCTTGCCATT 7 CD03-R CTAATTCCTGGSBCTGGAATGCAG 8 Aps1-F ATGGTGGGTCCAGGTTATAAG 9 Aps1-R CAGAATGAGCTTCTGCCAATC 10 TG25-F TAATTTGGCACTGCCGT 11 TG25-1 TTGTYATRTTGTGYTTATCG 12 Ol2CAPS-F CTATGCCGACTCATCTAATCTG 13 Ol2CAPS-R CTATGCCGACGCACTTTCAAG 14

Example 3: PCR amplification and sequencing

(PW-R) and Powdery Mildew Resistance System (PW-S, B) samples and the CT129-F / R primer ( Solanum lycopersicum cDNA, clone: LEFL1064BA11, GenBank: AK323789.1), and the base sequence of the amplified DNA fragment was analyzed.

Specifically, in order to separate DNA from the sample, a 1.5 ml microtube was filled with a sample of a nail size and a tungsten bead, a CTAB buffer [2% (w / v) hexadecyltrimethylammonium bromide ), 1.4 M sodium chloride, 30 mM EDTA, 100 mM Tris-HCl pH 8.0, 1% (w / v) PVP and 0.2% (v / v) mercaptoethanol) And cultured at 65 ° C for 1 hour. 750 μl of a chloroform: isoamyl alcohol (24: 1) solution was added, mixed well, and centrifuged at 13,000 rpm for 10 minutes to obtain 500 μl of supernatant. The DNA was precipitated by adding 1/10 the amount of sodium acetate and twice the amount of 100% ethanol. After washing with 70% ethanol, the DNA was isolated by dissolving in TE buffer (10 mM Tris-HCl pH 8.0, 1 mM EDTA) and used as template DNA for PCR (polymerase chain reaction) amplification. The reaction conditions were as follows: 50 ng of template DNA, 10 pmole of primer, 10 μl of PCR buffer (containing 1.5 mM MgCl ₂ ), 200 μM of dNTPs and 1 unit of taq DNA polymerase. Denatured at 94 ° C for 4 minutes, and then reacted at 94 ° C for 1 minute, at 50 ° C for 1 minute, and at 72 ° C for 2 minutes, followed by reaction at 72 ° C for 10 minutes. The amplified product was electrophoresed on 1.2% agarose gel to confirm the reaction products.

As a result, three DNA fragments of about 1,200, 1,650 and 2,000 bp were amplified in the PW-R sample (Fig. 5), and 1200 and 2000 bp of the 1650 bp band No. 19) size DNA fragments. Both of these bands were inconsistent with the original sequence CT129, which was used for primer production. However, since there was a polymorphism between the resistant and the heterologous strains, based on the obtained nucleotide sequence, A new primer was prepared and tested. As a result, the nucleotide sequence derived from the 1200 bp band was not polymorphic between the resistant line and the dysplastic line, and the nucleotide sequence derived from the 2000 bp band was polymorphic.

Example 4: Polymorphism analysis between resistant and deleterious strains

In accordance with an embodiment of the present invention, new primers CT129-2F and CT129-2R primers were prepared in the nucleotide sequence based on the nucleotide sequence of Example 3 (see Table 2). As a result of polymorphism analysis between the fungus resistance strain and the fungus line using the above primers, SNPs observed only in the resistant pepper line (PW-R) were observed (Fig. 6) A new primer CTSNP-F / CTSNP-F was prepared (see Table 3).

Marker name The base sequence (5 '- > 3') SEQ ID NO: CT129-2F GACATAAAAATGTTCTAACGGGTG 15 CT129-2R GTAGTGTTGATGTATGGATCCCTTTC 16

Marker name The base sequence (5 '- > 3') SEQ ID NO: CTSNP-F GGAATAGAGCATGGACTTGTCA 17 CTSNP-R CATAAGGTGTGCATGCAAGG 18

Example 5: Candidate Marker Usability Test

In accordance with one embodiment of the present invention, the utility of the F3 isolate populations and candidate markers for resistance to powdery mildew on commercial varieties was tested. Specifically, in order to cultivate a genetic group for development of markers, commercially available foliar disease resistant flounder F1 breed PM Xinjiang and a celestial F2 segregation generation were cultivated, and F3 population growth and CTSNP marker analysis derived from the F2 segregation generation were performed (FIG. 7). In order to investigate the occurrence of natural powdery mildew in the F3 group, powdery mildew pathogenic fungi (Pseudomonas spp. And Lee, Byeongbyeop) developed in red pepper redpot were obtained (Fig. 8). F3 50 spp. (Fig. 9 and Fig. 10). The occurrence of powdery mildew and marker analysis were performed in the PM Xinjiang and the celestial F3 group. CTSNP marker analysis was performed using a Gene Scanning system using HR4 (High Resolution Melting) of LC480 (Roche), preincubation at 95 ° C for 5 minutes, and then 15 seconds at 95 ° C, 25 seconds at 58 ° C, Amplification at 72 ° C for 45 seconds was repeated 35 times and genotyping was performed by high resolution melting and cooling.

As a result, as shown in Tables 4 and 5, a sample of PM Shin Shin derived 160 (No. 17-20), No. 161 (No. 21-28), No. 166 (No. 41-44) (Numbers 37 to 40) and 168 (numbers 49 to 52), which showed symptoms in samples No. 173 (No. 61-64) and No. 178 (No. 77-80) and analyzed by resistance or heterotyping with CTSNP marker, No samples were found in the samples No. 175 and No. 69 (No. 69 to No. 72) and No. 186 (No. 101).

As shown in Table 6, the results of analysis of the CTSNP marker and the occurrence of the disease were different from those of the selected individuals in the PM Xinjiang isolates, but 95% (Fig. 11).

In conclusion, the genetic markers of the present invention can be used for effective control of powdery mildew of red pepper because it can rapidly and accurately detect a powdery mildew resistance factor by cultivating a new resistant variety of red pepper powdery mildew.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the invention is not limited to the disclosed embodiments, but, on the contrary, is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims. Accordingly, the true scope of the present invention should be determined by the technical idea of the appended claims.

&Lt; 110 > FNP, Inc. <120> Genetic marker and method for detecting red-pepper powdery mildew          resistance plants <130> PD16-5408 <160> 19 <170> Kopatentin 2.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CT129-F <400> 1 tctgtgatct gatatgtcta ag 22 <210> 2 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> CT129-R <400> 2 ctcctggggt aagtttc 17 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CT100-F <400> 3 gataacaaaa gggcaaacat g 21 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CT100-R <400> 4 caattactgt gctgattcta ag 22 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> TG568-F <400> 5 ggtaccgcat cattcttttt gggac 25 <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> TG568-R <400> 6 gttgtaacac atttaggggt aag 23 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> CD03-F <400> 7 ctttagcaca taatcttgcc att 23 <210> 8 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> CD03-R <400> 8 ctaattcctg gsbctggaat gcag 24 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Aps1-F <400> 9 atggtgggtc caggttataa g 21 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Aps1-R <400> 10 cagaatgagc ttctgccaat c 21 <210> 11 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> TG25-F <400> 11 taatttggca ctgccgt 17 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TG25-1 <400> 12 ttgtyatrtt gtgyttatcg 20 <210> 13 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Ol2CAPS-F <400> 13 ctatgccgac tcatctaatc tg 22 <210> 14 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Ol2CAPS-R <400> 14 ctatgccgac gcactttcaa g 21 <210> 15 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> CT129-2F <400> 15 gacataaaaa tgttctaacg ggtg 24 <210> 16 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> CT129-2R <400> 16 gtagtgttga tgtatggatc cctttc 26 <210> 17 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CTSNP-F <400> 17 ggaatagagc atggacttgt ca 22 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CTSNP-R <400> 18 cataaggtgt gcatgcaagg 20 <210> 19 <211> 1948 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > PW-R sample DNA <400> 19 gtncgattt gtctgtatga agtaactaaa tctaagatta gtcctatcta gctggtgatc 60 tttaagtata ctgataataa agatgatttg acttagtctg agatcagtcc tacctagagg 120 gtgatctcta aatctgatat actgatactg attgaccata gttgagatca gtcctatcta 180 atggatgatc ccaaagtcta tttataatga taagggttga ccgtatctaa tagtcctgaa 240 tctatattac tgagctgaat taactgtatc tgacagtcct gattctatag ctgaaactgt 300 aggatgtatt catctaaccg acatgcccca tgctaagcta actggggtct aacctgtaac 360 cccagttgga agggtgccag taccgcgcca ccagtaaaga caactactgt ggagtcagtc 420 ctaatctagt gggtgacccc tgggaccagt cctagacata aaaatgttct aacgggtgat 480 ccttgagtat gtcngtccta tctaatgggt gacatctcgt acctacgctg ggtacgtagt 540 ttctggaact tagggattgc ttctagggat ctcagtccta tttagcgggt gagccccaat 600 ccctaggttt gcttggtgct gaatcctact ctcggatgaa agacattgaa ctaattaact 660 gaactgaact aattagctga actgatactg attaactgaa cggatactag tgtattattt 720 agcggagcta aactgagttc ctttgactga cagaacgtac cgagttctga ggactgacta 780 agatactgaa attactgaga ttactaggaa tactgttttt actgagatta ctgagattac 840 tgagtacaga gatcgctgag ataactgaac tacaaagatt actgtgattt ttgagttttc 900 ctgagtcaca tgactgactg aattctagag atcatggatt gactgagagt atcatgataa 960 catgacatga ctctaggaac acagctatgt ttttcgggta caagtacccc caggactcga 1020 tagaaggaaa ctgacacaca tgacacttct tgatcatagg aataacatcc acaattcata 1080 atatcataag taggggattt catactatcc atggttctca acatcattta catgaaaggg 1140 aatgcgtata acatgtaaat acttgcataa ctttattttc ataagcattc catatcacaa 1200 caacaataca caataattag tatggaattc atgttaaatc ataaggaata gagcatggac 1260 ttgtcattta agttctattt agctataata catgatttct agtctcttag gtattttatc 1320 aaacaccttg catgcacacc ttatggcata ggcatattta tcaccaccta aaattcatat 1380 atttcaattt acatgtcatc ctagtttcat aaactcacat aaagattcta acttgggagt 1440 tgcataataa tcaatcacac aaacataatc aatccataac ataacttcat gattcatagt 1500 ttaaaagagg atgaaaggga tccatacatc aacactacac ataccttagc tctttattta 1560 ctgaagattg acggagagat tcttgaaatt tgatggttaa ttcccttgga attgttcctt 1620 ctatgaaaac catagggctt gttcttgaga gtttttgaga gaaatagagt ataaattgct 1680 gaattatggc caaatctcgt gttagtaggc ttatataggg tagggaaatt gaccaaattg 1740 cccttgaaaa cacggaggtg aaatgctaaa aattgggcac ccaccggagt tgcagggtgg 1800 cgccttgcta tagccccgct ctagcaaggg cagcgccttg ctagtccccc gctgtagcca 1860 agcggcgcct tacttagagc ggtgctctag gctgggtgac gtgggctaaa tgcctttttc 1920 tactggttgg aaatccaacc cccctctn 1948

Claims (3)

A nucleic acid sequence as set forth in SEQ ID NO: 19 or a complementary nucleic acid sequence thereof, wherein the 853rd nucleotide of SEQ ID NO: 19 is C or T, wherein the 853rd nucleotide is a C or T single nucleotide polymorphism (SNP) A DNA polynucleotide for identifying a red pepper powdery disease or a complementary polynucleotide thereof. A probe for detecting the resistance to pepper powdery mildew, comprising a probe capable of specifically detecting the polynucleotide of claim 1 or a pair of primers capable of specifically amplifying the polynucleotide of claim 1. A genomic DNA extraction step of extracting genomic DNA from pepper;
Wherein the extracted genomic DNA is used as a template and the nucleotide sequence of SEQ ID NO: 19 or its complementary nucleic acid sequence is selected and the 853rd base of SEQ ID NO: 19 contains C or T or a nucleic acid complementary thereto at the 3'- 15 to 50 nt of pepper powdery mildew resistance specific forward primer; And a primer pair selected from a nucleic acid sequence represented by SEQ ID NO: 19 or a complementary nucleic acid sequence thereof and comprising a reverse primer selected from a common sequence at positions other than the forward primer position; And
Determining the presence or absence of an amplification product in the amplification step, and determining whether the resultant is resistant to powdery mildew powdery mildew of red pepper.

Images