KR101911020B1 - Method for detecting foodborne pathogens using gene reading chip and primer - Google Patents

Abstract

The present invention relates to a method for detecting food poisoning bacteria using a gene differentiation chip and a primer and, more specifically, to a method for detecting food poisoning bacteria using a gene differentiation chip and a primer to accurately and quickly differentiate genes. According to the present invention, the method for detecting food poisoning bacteria using the gene differentiation chip and the primer comprises: a) a step of extracting a gene to be analyzed; b) a step of injecting a sample containing the gene into the gene differentiation chip; c) a step of amplifying the gene contained in the sample by polymerase chain reaction (PCR) using at least one primer pair selected from the group consisting of primers including the base sequences of SEQ ID NO: 1 to 26; d) a step of mixing the amplified gene and a signaling material to form a mixed material; e) a step of measuring a current amount of the mixed material; and f) a step of analyzing the measured current amount to differentiate the gene.

Description

FIELD OF THE INVENTION [0001] The present invention relates to a method for detecting food poisoning bacteria using a gene chip and a primer,

The present invention relates to a method for detecting food poisoning bacteria using a gene discriminating chip and a primer, and more particularly, to a method for detecting food poisoning bacteria using a gene discriminating chip and a primer for accurately and quickly discriminating genes.

As the number of single-person households increases and the number of dual-earner households increases, processed food consumption is rapidly increasing, and the development of the food service industry and school meals are becoming commonplace. Particularly, due to the expansion of institutional food service stations, food poisoning accidents often occur. In addition, as the FTA with Korea takes effect in 2012, the foodstuffs distributed are becoming globalized, and food safety is becoming more important. The number of food poisoning incidents has been more than 5,000 per year since 2003, and is caused by ingestion of food contaminated with various food poisoning bacteria every year. The cost of socioeconomic loss due to food poisoning is estimated to be 1.6 trillion won in 2005. Therefore, there are various potential risk factors for each stage of foodstuffs ranging from food production stage, processing, processing, distribution, and final consumption stages. In order to minimize this, it is required to detect food poisoning bacteria quickly and accurately in the field.

On the other hand, researches on nano-biotechnology capable of directly confirming and manipulating the biomolecule behavior of nano unit such as genes, proteins and cells of a subject are actively conducted. Such nano-biotechnology can be used to diagnose a disease or to determine the type of a target object, and thus the recent industrial field is being expanded.

Particularly, in recent years, development of a lab-on-a-chip has been actively performed. A lab-on-a-chip is a type of biochip that allows a small chip to perform research that can be done in a laboratory. Specifically, the lab-on-a-chip is made of plastic, glass, silicon, etc. to create microchannels of nanometer (nm) or less. Through this, labs and researches that can be done in existing laboratories It is a chip made to replace. Because of this practicality, lab-on-a-chip is constantly being developed and used.

Conventional gene discrimination apparatuses are so large that they are inconvenient to carry and have a problem in that it takes a long time to discriminate genes, which is not practical. In the case of a probe-type lab-on-a-chip, there is a need to fix a probe that pairs with a gene to be discriminated in advance on a detection substrate in a discriminating part in order to discriminate a gene.

That is, conventionally, it is difficult to carry the gene discrimination device, and the time required to identify the gene is long, so that the practicality for rapid detection of food poisoning bacteria is low and the preparation process is complicated.

In addition, the official method of analyzing food poisoning bacteria internationally is a method of detecting a specific food poisoning bacteria by using a microorganism selective medium, and it takes about 1-3 days or more from the sample to detection, and the enrichment process is performed for 12 to 48 hours , And thus it is an obstacle to the rapid detection of food poisoning bacteria. In addition, since each strain must be tested, it is difficult to detect multiple strains. Therefore, more time is required to detect various causative pathogens.

Korean Patent Registration No. 1421098 (Jul. 14, 2014)

An object of the present invention to solve the above problems is to provide a method for detecting food poisoning bacteria using a gene discriminating chip and a primer for accurately and quickly reading a gene.

Another object of the present invention is to design a forward primer and a reverse primer pair for a species-specific gene existing in each food poisoning bacterium, and to identify a target gene without any cross-hybridization against other food poisoning genomic DNA (gDNA) And to amplify and detect food poisoning bacteria.

It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory and are not intended to limit the invention to the precise form disclosed. There will be.

According to an aspect of the present invention, there is provided a method of extracting a target gene, b) injecting a sample containing the gene into a gene discriminating chip; c) the gene contained in the sample passes through the amplification channel, and the heat supplied to the amplification channel is prevented from being transferred to the unexpected part by the thermal diffusion blocking grooves formed on both sides of the amplification channel, Amplification while preventing the degradation and at the same time improving the speed and efficiency of the polymerase chain reaction (PCR) so that the supplied heat is not dispersed to the surroundings; d) The amplified gene and the signal material are passed through the first to fourth mixer channel films, and are attached between the third and fourth mixer channel films and formed into holes of different shapes to form a plurality of Forming a mixed material so as to mix and mix while passing through a mixing hole formed with a mixing hole to improve mixing efficiency; d-1) The mixed material is provided so as to pass through a filter-attached film and an air filter made of a hydrophobic material to remove bubbles contained in the mixed material by the filter-attached film to increase gene discrimination efficiency, Moving a predetermined amount of the mixed material automatically to the discrimination unit even if the air pressure is not precisely controlled by discharging the air carrying the mixed substance to the outside; e) measuring the amount of current of the mixed material; And f) identifying the amplified gene by analyzing the measured amount of current, and detecting the pathogen-causing bacteria using the gene-identifying chip and the primer,
The primer pair comprising a primer comprising the nucleotide sequence of SEQ ID NO: 1 and a primer comprising the nucleotide sequence of SEQ ID NO: 2, a primer comprising the nucleotide sequence of SEQ ID NO: 3, and a nucleotide sequence of SEQ ID NO: A primer comprising a base sequence of SEQ ID NO: 5, a pair of primers comprising a base sequence of SEQ ID NO: 6, a primer comprising a nucleotide sequence of SEQ ID NO: 7, and a pair of primers comprising a nucleotide sequence of SEQ ID NO: A primer pair consisting of a primer comprising a base sequence, a primer comprising a base sequence of SEQ ID NO: 9 and a pair of primers comprising a base sequence of SEQ ID NO: 10, a primer comprising a base sequence of SEQ ID NO: 11, A primer pair consisting of a primer comprising a base sequence of SEQ ID NO: 13 and a primer pair comprising a base sequence of SEQ ID NO: 14, a primer comprising a base sequence of SEQ ID NO: 15 and a primer pair comprising a base sequence of SEQ ID NO: 16, A primer comprising a nucleotide sequence of SEQ ID NO: 17 and a primer pair comprising a nucleotide sequence of SEQ ID NO: 18, a primer comprising a nucleotide sequence of SEQ ID NO: 19 and a primer comprising a nucleotide sequence of SEQ ID NO: A primer comprising a nucleotide sequence of SEQ ID NO: 21 and a primer pair comprising a nucleotide sequence of SEQ ID NO: 22, a primer comprising a nucleotide sequence of SEQ ID NO: 23, and a primer comprising a nucleotide sequence of SEQ ID NO: And a primer pair consisting of the nucleotide sequence of SEQ ID NO: Using a primer, and at least one primer pair selected from the group consisting of a pair of primers consisting of a primer comprising the nucleotide sequence of SEQ ID NO: 26, E. coli (Escherichia coli O157: H7), Staphylococcus aureus (Staphylococcus aureus), Salmonella Entebbe utility Characterized in that it is configured to detect food poisoning bacteria of any one of Salmonella enteritidis , Listeria monocytogenes , Yersinia enterocolitica and Bacillus cereus . And a method for detecting food poisoning bacteria using the primer.

In the embodiment of the present invention, in the step d), the amplified gene contained in the mixed material and the signal material may be mutually combined.

In an embodiment of the present invention, the step e) includes the steps of: e1) applying an applied voltage to the working electrode; e2) exchanging electrons derived from the signal material included in the mixed material through the redox reaction with the working electrode; And e3) continuously measuring the current through the amount of electrons exchanged with the counter electrode by the working electrode.

In an embodiment of the present invention, in the step e1), the applied voltage is a voltage for generating a redox reaction of the signal material contained in the mixed material, and may be a unique voltage value depending on the signal material.

In the embodiment of the present invention, after the step e3), the method may further include: e4) displaying a display voltage which is a sum of the applied voltage and the reference voltage of the reference electrode.

In an embodiment of the present invention, in the step f), when the amount of current is higher than a preset reference value, it is determined that the amplified target gene is less than a reference amount. When the amount of current is less than a predetermined reference value, It can be judged that the target gene is larger than the reference amount.

According to another aspect of the present invention, there is provided a gene discrimination chip used for detecting food poisoning bacteria, comprising: a frame part having an outer shape and having a sample inlet and an outlet; A body portion including a body upper cover film provided inside the frame portion to form a body and attached to an upper portion of the body channel film on which a plurality of channels are formed so that the injected sample can be moved; An amplification unit coupled to one side of the upper part of the body part and performing PCR on the sample; A filter attachment film provided on the other side of the body part to form a mixed material by mixing the sample amplified by the amplification part with a signal material and to remove bubbles contained in the mixed material to increase gene discrimination efficiency, A mixer unit having an air filter arranged to automatically move a predetermined amount of the mixed material without precisely controlling the air pressure by discharging the air carrying the mixed material to the outside; And a discrimination unit coupled to the other side of the lower part of the body part and measuring a current amount of the mixed material that has passed through the mixer unit to discriminate a gene contained in the mixed material, And a thermal diffusion blocking groove formed at both sides of the amplification channel, wherein the thermal diffusion blocking groove is formed in a region where the heat supplied to the amplifying unit is not scheduled To prevent the deterioration of the sample due to excessive heat transfer and to prevent the supplied heat from being dispersed to the surroundings so as to improve the speed and efficiency of the polymerase chain reaction, Through the fourth mixer channel film, wherein the first mixer channel film and the second mixer channel film are attached to each other between the third and fourth mixer channel films, And it is characterized in that it has a mixing hole film having a plurality of mixing holes that result in the vortex,
The primer pair comprising a primer comprising the nucleotide sequence of SEQ ID NO: 1 and a primer comprising the nucleotide sequence of SEQ ID NO: 2, a primer comprising the nucleotide sequence of SEQ ID NO: 3, and a nucleotide sequence of SEQ ID NO: A primer comprising a base sequence of SEQ ID NO: 5, a pair of primers comprising a base sequence of SEQ ID NO: 6, a primer comprising a nucleotide sequence of SEQ ID NO: 7, and a pair of primers comprising a nucleotide sequence of SEQ ID NO: A primer pair consisting of a primer comprising a base sequence, a primer comprising a base sequence of SEQ ID NO: 9 and a pair of primers comprising a base sequence of SEQ ID NO: 10, a primer comprising a base sequence of SEQ ID NO: 11, A primer pair consisting of a primer comprising a base sequence of SEQ ID NO: 13 and a primer pair comprising a base sequence of SEQ ID NO: 14, a primer comprising a base sequence of SEQ ID NO: 15 and a primer pair comprising a base sequence of SEQ ID NO: 16, A primer comprising a nucleotide sequence of SEQ ID NO: 17 and a primer pair comprising a nucleotide sequence of SEQ ID NO: 18, a primer comprising a nucleotide sequence of SEQ ID NO: 19 and a primer comprising a nucleotide sequence of SEQ ID NO: A primer comprising a nucleotide sequence of SEQ ID NO: 21 and a primer pair comprising a nucleotide sequence of SEQ ID NO: 22, a primer comprising a nucleotide sequence of SEQ ID NO: 23, and a primer comprising a nucleotide sequence of SEQ ID NO: And a primer pair consisting of the nucleotide sequence of SEQ ID NO: Using a primer, and at least one primer pair selected from the group consisting of a pair of primers consisting of a primer comprising the nucleotide sequence of SEQ ID NO: 26, E. coli (Escherichia coli O157: H7), Staphylococcus aureus (Staphylococcus aureus), Salmonella Entebbe utility Characterized in that it is configured to detect food poisoning bacteria of any one of Salmonella enteritidis , Listeria monocytogenes , Yersinia enterocolitica and Bacillus cereus . .

The effect of the present invention according to the above configuration is that the gene discrimination chip is compact and portable.

Further, since the method for detecting food poisoning bacteria using the gene discrimination chip and the primer does not need to fix the food-borne bacteria gene to be detected and the probe corresponding to the gene in advance in the discriminating part, the preparation time for the food poisoning gene is shortened, Can be determined.

In addition, since the gene discrimination chip is convenient to carry and can quickly identify the gene, it is practical in that it can be used immediately in the field.

Further, according to the present invention, the main sikjungdokgyun 6 species, Listeria monocytogenes to Ness (Listeria monocytogenes), E. coli (Escherichia coliEscherichia coli O157: H7), Staphylococcus aureus (Staphylococcus aureus), Salmonella Entebbe utility disk (Salmonella enteritidis), Yersinia Enterococcus coli urticae (Yersinia enterocolitica and Bacillus cereus primers can be amplified and detected on a PCR method basis without cross-hybridization effectively.

It should be understood that the effects of the present invention are not limited to the above effects and include all effects that can be deduced from the detailed description of the present invention or the configuration of the invention described in the claims.

1 is a top plan view of a gene discrimination chip according to an embodiment of the present invention.
2 is an exploded perspective view of a gene discriminating chip according to an embodiment of the present invention.
3 is an exploded perspective view of a body part of a gene discrimination chip according to an embodiment of the present invention.
4 is an exploded perspective view of an amplification unit of a gene discrimination chip according to an embodiment of the present invention.
5 is an exploded perspective view of a mixer unit of a gene discrimination chip according to an embodiment of the present invention.
6 is an exploded perspective view of a discriminating unit of a gene discriminating chip according to an embodiment of the present invention.
7 is a top view of the discriminating unit of the gene discriminating chip according to an embodiment of the present invention.
8 is a flowchart of a method for detecting food poisoning bacteria using a gene discriminating chip and a primer according to an embodiment of the present invention.
FIG. 9 is a flowchart of a step of measuring a current amount of a mixed substance in a method for detecting food poisoning bacteria using a gene discriminating chip and a primer according to an embodiment of the present invention.
10 is a photograph of a gene discrimination chip according to an embodiment of the present invention viewed from above.
11 and 12 are photographs showing a perspective view of a gene discrimination chip according to an embodiment of the present invention.
13 is a photograph showing an exploded perspective view of a gene discriminating chip according to an embodiment of the present invention.
Figure 14 is a graph coli O157: H7) of the primers set forth in SEQ ID NOS: 1 and 2, respectively.
Figure 15 shows the reaction specificity of the primer sets of SEQ ID NOS: 3 and 4 for Staphylococcus aureus .
Figure 16 shows the reaction specificity of the primer sets of SEQ ID NOS: 5 and 6 for Salmonella enteritidis .
Figure 17 shows the reaction specificity of the primer sets of SEQ ID NOS: 7 and 8 for Salmonella enteritidis .
18 shows the reaction specificity of the primer sets of SEQ ID NOS: 9 and 10 for Salmonella enteritidis .
19 is a Listeria monocytogenes to Ness (Listeria monocytogenes ) of the primer sets of SEQ ID NOS: 11 and 12.
20 is a Listeria monocytogenes to Ness (Listeria monocytogenes ) of the present invention.
21 is a Listeria monocytogenes to Ness (Listeria monocytogenes ) of the primer sets of SEQ ID NOS: 15 and 16.
22 is a Listeria monocytogenes to Ness (Listeria monocytogenes ) of the primer set of SEQ ID NOS: 17 and 18.
23 is a graph showing the activity of Yersinia < RTI ID = 0.0 > SEQ ID NOS: 19 and 20 for enterocolitica ).
Figure 24 is a graph showing the activity of Yersinia < RTI ID = 0.0 > 21 and 22 for Enterococcus species .
25 is a graph showing the results obtained from Yersinia < RTI ID = 0.0 > 23 and 24 for enterocolitica ).
Figure 26 shows the reaction specificity of the primer sets of SEQ ID NOS: 25 and 26 for Bacillus cereus .

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS Hereinafter, the present invention will be described with reference to the accompanying drawings. The present invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. In order to clearly illustrate the present invention, parts not related to the description are omitted, and similar parts are denoted by like reference characters throughout the specification.

Throughout the specification, when a part is referred to as being "connected" (connected, connected, coupled) with another part, it is not only the case where it is "directly connected" "Is included. Also, when an element is referred to as " comprising ", it means that it can include other elements, not excluding other elements unless specifically stated otherwise.

The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. The singular expressions include plural expressions unless the context clearly dictates otherwise. In this specification, the terms "comprises" or "having" and the like refer to the presence of stated features, integers, steps, operations, elements, components, or combinations thereof, But do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, or combinations thereof.

Hereinafter, embodiments of the present invention will be described in detail with reference to the accompanying drawings.

FIG. 1 is a top plan view of a gene discriminating chip according to an embodiment of the present invention, and FIG. 2 is an exploded perspective view of a gene discriminating chip according to an embodiment of the present invention.

1 and 2, the gene discrimination chip 1000 includes a frame unit 100, a body unit 200, an amplification unit 300, a mixer unit 400, and a discrimination unit 500.

The frame unit 100 forms an outer shape of the gene discrimination chip 1000 and includes a sample injection port 111 and an exhaust port 121 and includes an upper frame 110 and a lower frame 120.

The upper frame 110 is provided on the upper part of the body part 200 and the sample injection port 111 is formed on one side. The sample injection port 111 is a path through which a sample mixed with an amplification buffer (PCR buffer) is injected, and may be provided in plural. A signal material injection port 112 may be formed on the other side of the upper frame 110. The signal material injection port 112 is a path through which a signal material to be coupled with a gene contained in the sample is injected and may be provided in a corresponding number to the sample injection port 111.

The lower frame 120 is provided at a lower portion of the body 200 and the outlet 121 is formed at the other side. The outlet (121) forms a passage through which the mixed material passes after passing through the discriminating part (500). Here, the mixed material may refer to a material mixed with a sample introduced through the sample injection port 111 and a signal material introduced through the signal material injection port 112.

The upper frame 110 and the lower frame 120 are coupled to each other to form an outer shape of the gene discriminating chip 1000. The frame part 100 may be made of a plastic material, but the material of the frame part 100 is not limited thereto.

The frame part 100 provided as described above is configured to separate the body part 200, the amplification part 300, the mixer part 400 and the discrimination part 500 provided inside the frame part 100 from the external environment Can be protected.

A plurality of alignment holes 113 are formed in the upper frame 110 and alignment pillars 122 are formed in the lower frame 120 at positions corresponding to the alignment holes 113. The alignment pillar 122 may be formed to have a diameter that can be inserted and fixed in the alignment hole 113. The alignment holes 113 and the alignment pillars 122 are formed on the outer side, but the positions are not limited to the illustrated positions. The effect of the alignment holes 113 and the aligning columns 122 is described when the alignment holes 205 provided in the body 200 are described.

Further, the upper frame 110 may further include an air outlet 114. Specifically, the sample and the signal material injected through the sample injection port 111 and the signal material injection port 112 are injected by air pressure. The air outlet 114 is formed by mixing the sample and the signal material in the mixer unit 400 to form a mixed material, and before the mixed material is moved to the discriminating unit 500, air To the outside.

3 is an exploded perspective view of a body part of a gene discrimination chip according to an embodiment of the present invention.

3, the body part 200 is provided inside the frame part 100 to form a body, and a passage is formed so that the sample injected through the sample injection port 111 can be moved. The body part 200 includes a body channel film 210, a body upper cover film 220, and a body lower cover film 230.

The body channel film 210 has a plurality of channels. The body channel film 210 is formed with a passage through which the sample can move from the sample injection port 111 to the discharge port 121. The number of the channels is the same as that of the sample injection port 111 . In addition, the shape of the channel formed in the body channel film 210 is not limited to the illustrated form, and can be changed. The body channel film 210 may be formed of a polyimide material, but is not limited thereto.

The body upper cover film 220 is attached to an upper portion of the body channel film 210 and has a sample injection hole 221 through which the sample can pass and a sample injection hole (222) may be formed. The sample injection film 222 can prevent the sample passing through the sample injection port 111 and the sample injection hole 221 from leaking to the outside of the sample injection port 111. [ If the sample leaks outside the predetermined flow path, contamination due to the sample and external infection may occur. In addition, the leaked sample may cause mechanical failure, and the gene contained in the sample may be reduced to cause an error in the gene discrimination test. Therefore, the sample injection film 222 preventing the sample from leaking can prevent the above problems from occurring, thereby improving the detection performance and improving the accuracy of the gene discrimination test. The sample injection film 222 may have a predetermined thickness and may be made of a material having elasticity. In one embodiment, a CT380 tape may be used. The sample injection film 222 made of such a material may be stacked in a plurality of layers in order to align the steps.

An upper pressure supporting film 223 extending in the width direction of the body upper cover film 220 may be additionally provided adjacent to the sample injection hole 221. Specifically, when the sample is injected into the sample injection hole 221, a predetermined pressure is applied. At this time, the body upper cover film 220 may be bent by the pressure applied to the sample injection hole 221, and the sample injection hole 221 may be bent Can occur. Therefore, the upper pressure supporting film 223 is provided to prevent the body upper cover film 220 from being bent by the pressure applied to the sample injection hole 221, so that the sample injection holes 221 The leakage of the sample can be prevented.

An amplification channel 224 having a predetermined length extending in the longitudinal direction of the body upper cover film 220 is formed at one side of the body upper cover film 220 at a position where the amplification unit 300 is attached . At this time, the amplification channel 224 is formed to be the same as the number of the sample injection ports 111, and a channel is formed so that the sample introduced into the sample injection port 111 can pass therethrough. The thermal diffusion blocking grooves 225 may be further formed on both sides of the amplification channel 224 (the width direction of the body upper cover film 220). The heat dissipation cut-off groove 225 may prevent the heat supplied to the amplification unit 300 from being transmitted to the rest of the position where the amplification unit 300 is attached. The heat dissipation cut-off groove 225 provided in this way can cause a PCR reaction only at a position where the amplification part 300 is attached, and the sample flowing in the part where the amplification part 300 is not attached It is possible to prevent deterioration due to excessive heat. In addition, the heat dissipation cut-off groove 225 prevents the heat supplied to the amplification unit 300 from being scattered around, thereby improving the speed and amplification efficiency of the polymerase chain reaction.

A plurality of pressure control holes 226 may be formed on both sides of the amplification channel 224 (the longitudinal direction of the body upper cover film 220). Specifically, when the sample is amplified by the amplification unit 300, the volume of the amplification unit 300 expands and the pressure increases due to the increase of the temperature. Therefore, the pressure adjusting hole 226 is provided to discharge the gas inside the amplification unit 300 and to control the pressure, thereby improving amplification efficiency of the polymerase chain reaction.

In addition, a signal material injection film 227 may be further attached to the body upper cover film 220 at a position corresponding to the signal material injection port 112. The signal material injection film 227 can prevent the signal material flowing into the signal material injection port 112 from leaking. The signal material injection film 227 may be stacked as a plurality of layers to control the height. In one embodiment, the CT380 tape may be used.

The body upper cover film 220 is provided with a filter attachment film 228 for removing air bubbles generated in the mixed material mixed with the signal material introduced from the signal material injection port 112 and the sample, (229) may be further provided.

The filter attachment film 228 and the air filter 229 are provided to remove bubbles generated in the mixed material by mixing the sample and the signal material by the mixer unit 400 described later. The air filter 229 may be a hydrophobic material and may be made of a material selected from the group consisting of polytetrafluoroethylene (PTFE), polyethylene terephthalate (PET), and polyvinyl chloride And at least one material selected from the group consisting of Specifically, the mixed material flowing along the flow path may include protein particles, and the mixed material may be a liquid in which one or more hydrophilic liquids are mixed with water. Accordingly, the air filter 229 can be provided with a function of passing gas without passing water and a hydrophilic liquid. Accordingly, the air filter 229 can perform a function of separating and removing only the gas using a hydrophobic material. The air passing through the air filter 229 may be discharged to the outside through the air outlet 114. In addition, the air filter 229 thus provided may automatically stop injecting the mixed substance into the discriminating part 500. [ Specifically, as described above, the mixed material is moved by air pressure. Accordingly, when the mixed material passes all the positions of the air filter 229, all of the air pressure escapes through the air filter 229, so that even if the air pressure is not precisely controlled, It can be automatically prevented from moving to the determination unit 500.

The body lower cover film 230 may be attached to the lower portion of the body channel film 210. The body lower cover film 230 may be attached and fixed to the upper portion of the lower frame 120. The body upper cover film 220 and the body lower cover film 230 may be made of polyethylene terephthalate . However, the material of the body upper cover film 220 and the body lower cover film 230 is not limited thereto, and may be made of a material capable of performing the same function.

In addition, the body portion 200 has the alignment hole 205 formed therein. Specifically, the body channel film 210, the body upper cover film 220, and the body lower cover film 230 are provided with the alignment holes 113 at positions corresponding to the alignment holes 113 formed in the upper frame 110, The alignment holes 205 having the same diameter as the holes 113 may be formed. The alignment holes 113, the alignment pillars 122 and the alignment holes 205 are coupled to each other and the frame portion 100 and the body portion 200 do not need to be separately aligned when they are combined. That is, it is convenient in that the channels formed by lamination of the films provided in the body part 200 can be accurately and easily aligned and fixed so as not to be shifted.

4 is an exploded perspective view of an amplification unit of a gene discrimination chip according to an embodiment of the present invention.

4, the amplification unit 300 is coupled to one side of the upper part of the body part 200 and can perform a polymerase chain reaction with the sample. The valve film 310 and the dummy chamber film (320).

The valve film 310 is attached to one side of the body part 200 and the dummy chamber film 320 is attached to the upper part of the valve film 310. The valve film 310 and the dummy chamber film 320 may be formed so that a plurality of films are stacked to form a flow path. The amplification unit 300 may be provided so that the number of genes is amplified exponentially by the polymerase chain reaction while the sample introduced from the sample injection port 111 passes through the amplification unit 300.

Specifically, the valve film 310 is attached to an upper portion of the body upper cover film 220, and an amplification channel 313 having the same shape as the amplification channel 224 is formed at a position corresponding to the amplification channel 224, And a valve channel film 311 formed with the valve channel film 311. The amplification channel 313 forms a channel through which the sample passes and the amplification channel 313 is continuously heated and cooled so that a polymerase chain reaction occurs in the sample passing through the amplification channel 313. [ can do.

A wing film 312 is extended on both sides of the valve channel film 311 (the longitudinal direction of the body upper cover film 220). At this time, the blade film 312 is formed to be thinner than the valve channel film 311 to form a step. A plurality of valve holes 314 and 315 are formed in the blade film 312. The valve holes 314 and 315 are formed at positions corresponding to the pressure adjusting holes 226, When the sample is amplified, the pressure can be controlled by discharging the gas. In addition, the sample may be introduced through the valve hole 314 located on the sample injection port 111 side, and the amplified sample may be discharged through the valve hole 315 located on the opposite side. In addition, the valve channel film 311 and the blade film 312 may be formed of polyimide material, but the material is not limited thereto.

A wing film cover 316 is attached to the upper portion of the wing film 312. The blade film cover 316 may be formed of the CT380 tape material so as to cover the upper side of the valve holes 314 and 315 formed in the blade film 312 to prevent the liquid from leaking to the outside of the valve holes 314 and 315 can do. The wing film cover 316 may have a thickness such that the height of the upper surface of the wing film cover 316 is equal to the height of the upper surface of the valve channel film 311 when attached to the wing film 312.

A lift film 317 may be attached to the upper portion of the wing film cover 316 at a position corresponding to the valve holes 314 and 315. The lift film 317 attaches external equipment and the wing film cover 316. When the external equipment applies pressure to the lift film 317, the valve holes 314 and 315 are completely closed, The amplification can be performed for a predetermined period of time. When the external equipment is lifted up, the wing film cover 316 is lifted by the adhesive force of the lift film 317, so that the valve holes 314 and 315 are opened, and the sample is fed to the mixer unit 400 Lt; / RTI >

A dummy chamber film 320 is attached to the upper portion of the valve film 310. The dummy chamber film 320 is first attached to the upper portion of the valve channel film 311 and the valve channel film 311 And an amplification chamber film 321 having a wider width than the amplification chamber film 321. Since the amplification chamber film 321 is formed to have a width wider than the valve channel film 311 so that both sides of the amplification chamber film 321 press the wing film cover 316, It is possible to prevent the sample from leaking at the interface of the first electrode 316. The amplification chamber film 321 has an amplification channel 322 formed in a shape and position corresponding to the amplification channel 313 formed in the valve channel film 311. The thickness of the amplification chamber film 321 may be adjusted to widen the channel so as to amplify the amplified chamber film 321. If necessary, the amplification chamber film 321 may be further laminated, Since the amount of the sample can be increased, it is possible to adjust the sample according to the purpose of amplification of the gene sample. In addition, the amplification chamber film 321 may be formed of a polyimide material.

An amplification cover film 323 is attached to the upper portion of the amplification chamber film 321. The amplification cover film 323 may serve as a cover for preventing the sample passing through the amplification channels 224, 313, and 322 from leaking. The amplification cover film 323 may be made of polyethylene terephthalate but is not limited thereto.

Further, a dummy tape 324 and a dummy film 325 may be further attached to the upper portion of the amplification cover film 323. A dummy channel 326 is formed in the dummy tape 324 and the dummy film 325 at positions corresponding to those of the amplification channel 322. The dummy channel 326 may provide a space in which the amplification cover film 323 can swell when the volume of the amplification channels 224, 313, and 322 increases due to temperature increase. That is, the dummy flow path 326 provides a space for expanding when the amplification cover film 323 instantaneously bulges, thereby preventing the amplification cover film 323 from being damaged and leaking out can do. Therefore, the dummy tape 324 and the dummy film 325 may be provided to have a thickness sufficient to secure a space in which the amplification cover film 323 can expand, and if necessary, It is possible.

The dummy tape 324 may be formed of a polyimide material, and the dummy film 325 may be formed of a polypropylene material.

5 is an exploded perspective view of a mixer unit of a gene discrimination chip according to an embodiment of the present invention.

5, the mixer unit 400 is provided on the other side of the body 200 and mixes the signal material with the gene amplified by the amplification unit 300 to form the mixed material can do. The mixer unit 400 includes a mixer lower cover film 410, a first mixer channel film 420, a second mixer channel film 430, a third mixer channel film 440, a fourth mixer channel film 450, a mixer connection hole film 460, a mixing hole film 470, and an upper cover film 480.

The mixer lower cover film 410 may be provided on the other side of the body part 200. The mixer lower cover film 410 may be integrally formed with the body lower cover film 230 of the body part 200 and may be formed integrally with the amplification part 300 and the air filter 229. [ As shown in FIG.

The first to fourth mixer channel films 420, 430, 440 and 450 may be sequentially attached to the upper portion of the mixer lower cover film 410 and may be formed of a polyimide material. Holes may be formed in the first to fourth mixer channel films 420, 430, 440, and 450 to form a flow path, and the flow path may be formed such that the sample and the signal material are mixed by vortexing. In addition, the first to fourth mixer channel films 420, 430, 440, and 450 may be formed to change the channel when the shape of the holes is changed. That is, various types of channels can be formed by freely setting the size, length, position, direction, shape, etc. of holes formed in the first to fourth mixer channel films 420, 430, 440, , Thereby controlling the flow and velocity of the sample and signal material passing through the flow path, thereby easily controlling the mixing concentration, mixing amount, and the like.

Particularly, the first mixer channel film 420 may be integrally formed with the body channel film 210 and may be attached to the upper surface of the mixer lower cover film 410. Accordingly, the first mixer channel film 420 may form the inlet and outlet passages of the sample conveyed along the body channel film 210 and the mixed material conveyed to the discriminating unit 500.

The mixer connection hole film 460 is formed between the first mixer channel film 420 and the second mixer channel film 430 and between the second mixer channel film 430 and the third mixer channel film 440, Respectively. The mixer connection hole film 460 connects the first mixer channel film 420 and the second mixer channel film 430 and connects the second mixer channel film 430 and the third mixer channel film 430 440 are interconnected. The mixer connection hole film 460 positioned between the first mixer channel film 420 and the second mixer channel film 430 may be integrally formed with the body upper cover film 220, The first mixer channel film 420 and the second mixer channel film 420 may be attached to each other.

The mixing hole film 470 may be attached between the third mixer channel film 440 and the fourth mixer channel film 450. The mixing hole film 470 may be formed with a hole for forming a vortex so that the mixed material is mixed. More specifically, the mixing hole film 460 and the mixing hole film 470 may have a plurality of hole holes 461 and 471 of different shapes. The mixing holes 461 and 471 may be formed in different shapes so that the sample passing through the mixing holes 461 and 471 and the signal material are uniformly mixed. That is, the mixing efficiency can be improved.

The upper cover film 480 may be attached to the upper portion of the fourth mixer channel film 450.

The mixer connection hole film 460, the mixing hole film 470, and the upper cover film 480 may be formed of polyethylene terephthalate. It does not.

The mixer unit 400 may include a channel through which the sample that has passed through the amplification unit 300 flows and a channel through which the signal material injected into the signal material inlet 112 flows. The sample and the signal material pass through the mixer unit 400 and are mixed by vortex to form the mixed material.

FIG. 6 is an exploded perspective view of a discriminating unit of a gene discriminating chip according to an embodiment of the present invention, and FIG. 7 is a top view of a discriminating unit of a gene discriminating chip according to an embodiment of the present invention.

6 and 7, the discrimination unit 500 is coupled to the other side of the lower part of the body part 200, and can discriminate a gene included in the mixed substance that has passed through the mixer part 400 have. The discrimination unit 500 can discriminate the gene by measuring the amount of current due to the oxidation and reduction of the mixed material. The discrimination unit 500 includes the electrode unit 510, the discrimination substrate unit 520, the discrimination film unit 530, A film unit 540, and the like.

The electrode unit 510 may be made of a material such as platinum, gold, carbon, copper, nickel, or silver. The electrode unit 510 can measure the amount of current due to the redox reaction of the mixed material, A reference electrode 512, and a reference electrode 513.

The working electrode 511 can measure an amount of current due to redox of the mixed material. Specifically, the mixed material is a mixture of the sample and the signal material, and the gene contained in the sample is combined with the signal material only when amplified through a sequential enzyme polymerization reaction. When the gene is not subjected to the sequential enzymatic polymerization reaction, the signal substance remains in the mixed substance in a state where it is not bound to the gene. The working electrode 511 can measure an electrical signal through electrons generated by applying a voltage to the signal material that is not coupled in this way and induce a redox reaction. Therefore, the amount of current measured by the working electrode 511 can be changed according to the amount of the signal material that is not coupled.

The counter electrode 512 may exchange electrons derived from the redox reaction of the signal material contained in the mixed material with the working electrode 511. Specifically, the counter electrode 512 may exchange electrons derived from the signal material not associated with the gene of the mixed material through the redox reaction with the working electrode 511. The working electrode 511 can accurately measure the amount of current of the mixed material by measuring the amount of electrons exchanged with the counter electrode 512

The reference electrode 513 may be a reference for a voltage to be applied to the working electrode 511. Specifically, the reference electrode 513 has a reference voltage for each of the mixed materials, and the working electrode 511 is adapted to apply a voltage according to a reference voltage of the reference electrode 513, (511) can maintain a constant voltage relative to the mixed material at all times.

The applied voltage applied to the working electrode 511 may be a unique voltage value for causing a redox reaction depending on each signal material included in the mixed material. In particular, the applied voltage may be adjusted in consideration of the reference electrode 513 so that the signal material included in the mixed material has a voltage value at which a redox reaction can occur.

The display voltage may be a sum of the reference voltage and the applied voltage. For example, when the reference voltage of the reference electrode 513 is 0.2 V and the applied voltage to be applied to the working electrode 511 is 0.5 V, the display voltage of the working electrode 511 is 0.2 V And an applied voltage of 0.5V.

The electrodes 511, 512, and 513 of the electrode unit 510 include a reaction unit 514 that is in contact with the mixed material and a ground unit 515 that is extended from the reaction unit 514 and is grounded ). ≪ / RTI >

The reaction unit 514 may refer to a portion where the working electrode 511, the counter electrode 512, and the reference electrode 513 are in contact with the mixed material. A reaction chamber 534 of the discrimination film unit 530 to be described later is provided at the upper part of the reaction part 514 and the reaction part 514 is formed by passing the mixed substance through the reaction chamber 534, The electrochemical reaction with the electrode unit 510 can be performed.

The grounding unit 515 may refer to a portion where the electrodes 511, 512 and 513 included in the electrode unit 510 are grounded and may extend from the reaction unit 514. The grounding unit 515 may be separated from the reaction unit 514 by the discriminating film unit 530 so as not to be in contact with the mixed substance.

A plurality of the electrode units 510 may be attached to the upper portion of the identification substrate unit 520. Specifically, the material of the identification substrate unit 520 may be glass, and a plurality of the electrode units 510 may be attached to the upper portion of the identification substrate unit 520 in the longitudinal direction. At this time, the material of the identification substrate unit 520 is not limited to glass, and the number of the electrode units 510 attached to the identification substrate unit 520 is the same as the number of the sample injection ports 111 .

The discriminating film unit 530 is attached to the upper portion of the discriminating substrate unit 520 and a reaction chamber 534 through which the mixed substance passes may be formed. Specifically, the determination film unit 530 may be provided to form the reaction chambers 534 at positions corresponding to the plurality of electrode units 510 provided in the longitudinal direction of the identification substrate unit 520 have. The reaction chamber 534 may be formed in such a shape that the mixed material having passed through the mixer unit 400 flows into one side, reacts with the electrode unit 510, and is discharged to the other side. The width of the discriminating film unit 530 is divided into the reaction unit 514 and the ground unit 515 of the electrode unit 510 so that the ground unit 515 and the mixed material are not in contact with each other .

The discriminating film unit 530 includes a first discriminating film 531 attached to the upper portion of the discriminating substrate unit 520, a second discriminating film 532 attached to the upper portion of the first discriminating film 531, And a third discriminating film 533 attached to the upper part of the second discriminating film 532 and the lower part of the body part 200. The discrimination films 531, 532 and 533 have the reaction chamber 534 formed at a position corresponding to the reaction section 514 and the discrimination films 531, (514) and the ground portion (515). In addition, the discrimination film unit 530 can control the volume of the reaction chamber 534 by stacking the discrimination films 531, 532, and 533. More specifically, the discrimination film unit 530 can change the number of the discriminating films stacked so as to control the amount of the mixed substance passing through the reaction chamber 534 by adjusting the volume of the reaction chamber 534 have. The second discriminating film 532 may be formed of the CT380 tape material to control the thickness thereof and the first discriminating film 531 and the third discriminating film 533 may be formed of a polyimide material .

The discharge film unit 540 may guide the mixed material having passed through the reaction chamber 534 to be discharged by the discharge port 121 and may include a first discharge film 541 provided with a discharge hole 543, And a second exhaust film 542. Here, the first discharge film 541 may be formed of a CT380 tape material, and the second discharge film 542 may be formed of a polyimide material. However, the material is not limited thereto.

The first discharge film 541 is attached to the upper portion of the discharge port 121 and may be provided to prevent leakage. Specifically, the first discharge film 541 may be provided with the discharge hole 543 for guiding the mixed substance at a position corresponding to the discharge port 121. Also, the first discharge film 541 can prevent the mixed substance discharged through the discharge port from leaking into a gap other than the discharge port 121 and flowing out.

The second discharge film 542 may be attached to the upper portion of the first discharge film 541 and the lower portion of the body portion 200. The second discharge film 542 may have the same discharge hole 543 as the discharge hole 543 provided in the first discharge film 541. The second discharge film 542 is coupled to the upper portion of the first discharge film 541 so that the height of the discharge film unit 540 corresponds to the height of the reaction chamber 534. The thickness of the first discharge film 541 and the second discharge film 542 may be equal to or greater than the height of the channel of the reaction chamber 534 so that the mixed material may be discharged to the discharge port 121 without leaking As shown in FIG. Alternatively, the third discharge film 543 may be laminated on the second discharge film 542, and the discharge film unit 540 may be formed so as to correspond to the height of the flow path of the reaction chamber 534 through which the mixed substance is discharged. . The discharge film unit 540 may be configured to discharge the mixed material that has passed through the reaction chamber 534 through the discharge film unit 540 without being leaked.

The gene discrimination chip (1000) thus prepared is compact and portable. Since the gene discrimination chip 1000 is convenient to carry and can quickly identify a gene, the gene discrimination chip 1000 is practical in that it can be used immediately in the field. In addition, since the gene discriminating chip 1000 does not need to fix the probe corresponding to the gene to the discriminating unit 500 in advance, the preparation time for gene discrimination is shortened, and the gene can be discriminated quickly.

The gene discrimination chip 1000 thus prepared is applicable to the food poisoning bacteria discriminator. That is, the food-borne pathogen discriminator to which the gene-discriminating chip 1000 is applied can determine whether food poisoning is dangerous by collecting and extracting food-borne bacteria from food or the like and then injecting the food-borne bacteria into the gene discriminating chip 1000. However, the present invention is not limited to the case where the gene discriminating chip 1000 is applied to the food poisoning bacteria discriminating device. For example, the gene discrimination chip 1000 may be applied to a fish species discriminator.

Hereinafter, the method for detecting food poisoning bacteria using the gene discrimination chip 1000 will be described in detail with reference to FIGS. 8 and 9. FIG.

FIG. 8 is a flow chart of a method for detecting a food poisoning bacteria using a gene discriminating chip and a primer according to an embodiment of the present invention. FIG. 9 is a flowchart showing a method of detecting a food poisoning bacteria using a gene discriminating chip and a primer according to an embodiment of the present invention. And a step of measuring the amount of current.

The present invention provides primer pair information composed of a forward primer and a reverse primer capable of amplifying a gene region specifically present in each food poisoning bacterium, and a method for detecting food poisoning bacteria using the primer pair information.

As shown in FIGS. 8 and 9, in the method for detecting food poisoning bacteria using the gene discriminating chip and the primer, a gene extracting step (S610) may be performed first. Specifically, in step S610 of extracting the gene, a gene for an analyte can be extracted. For example, genes, preferably genomic DNA (gDNA), can be extracted from various samples to be analyzed, such as foods, soil, tissues of a human body or animals, faeces, and the like.

After the step of extracting the gene (S610), a step of injecting the sample containing the gene into the gene discriminating chip (S620) may be performed. Specifically, the step of injecting the sample containing the gene into the gene discriminating chip (S620) may include injecting a sample containing the gene extracted in the extracting step (S610) of the gene discriminating chip into the sample inlet 111). The sample injected into the sample injection port 111 moves along the flow path formed in the body part 200.

After the step of injecting the sample containing the gene into the gene discriminating chip (S620), a step of amplifying the gene contained in the sample (S630) may be performed. More specifically, the step of amplifying the gene contained in the sample (S630) may include injecting the sample containing the gene into the gene discriminating chip (S620), passing the sample through the amplifying unit 300 And amplifying the number of genes. Here, the gene can be amplified by polymerase chain reaction (PCR). Generally, in the step of extracting the gene (S610), since the number of extracted genes is very small, it is difficult to perform accurate discrimination with only the extracted gene. However, if the number of genes is increased by amplifying the gene as described above, the discriminating operation can be accurately performed.

When the step of amplifying the gene is carried out by polymerase chain reaction (PCR), a primer used for gene amplification comprises a primer comprising the nucleotide sequence of SEQ ID NO: 1 and a nucleotide sequence of SEQ ID NO: 2 Containing Escherichia < RTI ID = 0.0 > coli O157: H7) primer, a primer comprising the nucleotide sequence shown in SEQ ID NO: 3 and a primer comprising the nucleotide sequence shown in SEQ ID NO: 4, a pair of primers for detecting Staphylococcus aureus , And a pair of primers for detection of Salmonella enteritidis consisting of a primer comprising the nucleotide sequence shown in SEQ ID NO: 6, a primer comprising the nucleotide sequence shown in SEQ ID NO: 7, a primer comprising the nucleotide sequence shown in SEQ ID NO: 8, a primer comprising the nucleotide sequence shown in SEQ ID NO: 9, and a primer comprising the nucleotide sequence shown in SEQ ID NO: 10, and a pair of Salmonella enteritidis ( Salmonella enteritidis ) detecting primer consisting of a primer comprising the nucleotide sequence shown in SEQ ID NO: Entebbe utility disk (Salmonella enteritidis) for detecting A base sequence described in the primer pair, the primers and SEQ ID NO: consisting of a primer comprising the nucleotide sequence set forth in 12 L. monocytogenes to Ness (Listeria monocytogenes) a pair of primers for detecting, SEQ ID NO: 13 comprising the nucleotide sequence set forth in SEQ ID NO: 11 L. monocytogenes to Ness (Listeria consisting of a primer comprising the nucleotide sequence set forth in SEQ ID NO: 14 and a primer comprising monocytogenes ) detection primer, a primer comprising the nucleotide sequence shown in SEQ ID NO: 15 and a primer comprising the nucleotide sequence shown in SEQ ID NO: 16, a primer pair for detecting Listeria monocytogenes , A primer comprising the nucleotide sequence described above and a primer comprising the nucleotide sequence shown in SEQ ID NO: 18 ( Listeria monocytogenes monocytogenes ), a primer comprising the nucleotide sequence shown in SEQ ID NO: 19, and a pair of primers for detecting Yersinia enterocolitica consisting of a primer comprising the nucleotide sequence shown in SEQ ID NO: 20, a primer pair consisting of SEQ ID NO: 21 And a primer comprising the nucleotide sequence shown in SEQ ID NO: 22 and a primer comprising the nucleotide sequence of Yersinia < RTI ID = 0.0 > enterocolitica detection primer, a primer comprising the nucleotide sequence shown in SEQ ID NO: 23 and a primer comprising the nucleotide sequence shown in SEQ ID NO: 24, and a pair of primers for detecting Yersinia enterocolitica , And a pair of primers for detecting Bacillus cereus comprising a primer comprising the nucleotide sequence set forth in SEQ ID NO: 26 and a pair of primers for detecting Bacillus cereus .

Specifically, SEQ ID NO: 1 and SEQ ID NO: 2 correspond to Escherichia coli O157: a pair of primers for detecting the eaeA genes H7), SEQ ID NO: 3 and SEQ ID NO: 4 is a pair of primers for detecting the nucA gene from Staphylococcus aureus (Staphylococcus aureus), SEQ ID NO: 5 and SEQ ID NO: 6 is a Salmonella Entebbe Priority display a pair of primers, SEQ ID NO: 7 and SEQ ID NO: 8 Salmonella Entebbe utility discharge primers, SEQ ID NO: 9 and SEQ ID NO: 10 for detecting the sefA genes (Salmonella enteritidis) for detecting the sefA genes (Salmonella enteritidis) is Salmonella Entebbe utility discharge primers, SEQ ID NO: 11 and SEQ ID NO: 12 for detecting the gene of sefA (Salmonella enteritidis) is L. monocytogenes to Ness (Listeria a pair of primers for detecting the hly genes monocytogenes), SEQ ID NO: 13 and SEQ ID NO: 14 is the primer pair SEQ ID NO: 15 and SEQ ID NO: 16 for detecting the hly gene of L. monocytogenes to Ness (Listeria monocytogenes) is a Listeria monocytogenes Listeria monocytogenes ), SEQ ID NO: 17 and SEQ ID NO: 18 are primer pairs for detecting the iap gene of Listeria monocytogenes , SEQ ID NO: 19 and SEQ ID NO: 20 are primers for detecting the hly gene of Yersinia Enterococci ( Yersinia enterocolitica ), SEQ ID NO: 21 and SEQ ID NO: 22 are primer pairs for detecting the yst gene of Yersinia a pair of primers for detecting the yst gene of enterocolitica), SEQ ID NO: 23 and SEQ ID NO: 24 is a Yersinia Enterococcus coli urticae (primer pair SEQ ID NO: 25 and SEQ ID NO: 26 for detecting the ail gene of Yersinia enterocolitica) is Bacillus celebrity It is a pair of primers for detecting the groEL gene of Bacillus cereus .

Escherichia coli O157: H7) has an attachment factor that sticks to the intestinal epithelial cells and is detectable through the related gene eaeA associated with the toxin. The Nuc A gene is a gene region that is already used to effectively detect Staphylococcus aureus . The SefA gene is a gene for toxicity specific to Salmonella enteritidis , and it is possible to detect specifically for the pathogenic bacteria. Listeria monocytogenes ( Listeria monocytogenes ) is a gene with toxicity. Most of the hly and iap genes are used to specifically detect the pathogenic bacteria. It has been reported that the Yst gene is specifically detectable for Yersinia enterocolitica . The GroEL gene is a housekeeping gene that is already used to detect Bacillus cereus.

The six types of food poisoning bacteria detected in the present invention are pathogenic microorganisms originating from major foodstuffs causing food poisoning worldwide, and Escherichia coli O157: H7), Salmonella Entebbe utility disk (Salmonella enteritidis), Staphylococcus aureus (Staphylococcus aureus), L. monocytogenes to Ness (Listeria monocytogenes , Yersinia enterocolitica , and Bacillus cereus .

After the step of amplifying the gene contained in the sample (S630), a step S640 of forming a mixed material by mixing the amplified gene sample and the signal material may be performed. Specifically, in step S640, the amplified gene sample, which has passed through the amplification unit 300, is mixed with the amplified gene sample and the signal material through the mixer unit 400, Can be mixed with the signal material. The gene and the signal material included in the mixed material may be mutually combined. At this time, the signal material may be continuously injected into the signal material injection port 112 continuously.

After the amplified gene sample and the signal material are mixed to form a mixed material (S640), a step S650 of measuring the amount of current of the mixed material may be performed. The step S650 of measuring the amount of current of the mixed material may include applying an applied voltage to the working electrode in operation S651, converting the electrons derived from the redox reaction of the signal material included in the mixed material into the working electrode, And a step S653 of continuously measuring the amount of current through the amount of electrons that the working electrode exchanges with the counter electrode.

First, a step S651 of applying an applied voltage to the working electrode is a step of applying an applied voltage to the working electrode 511. Here, the applied voltage means a unique voltage value for causing a redox reaction depending on each signal material included in the mixed material. That is, by applying the applied voltage to the working electrode 511 in consideration of the reference voltage of the reference electrode 513, the redox reaction can be performed on the signal material included in the mixed material.

In the step S652 of exchanging the electrons derived from the redox reaction of the signal material included in the mixed material with the working electrode, the counter electrode 512 may oxidize the signal material included in the mixed material Electrons derived through the reduction reaction can be exchanged with the working electrode 511. At this time, in the step of exchanging the electrons derived through the redox reaction of the signal material included in the mixed material with the working electrode (S652), the signal material causing the redox reaction is a signal material Quot; Specifically, the binding amount of the signal substance is determined according to the amount of the amplified gene in the step of amplifying the gene contained in the sample (S630), and the signal substance not binding with the amplified gene is subjected to the redox reaction So that an electric signal is provided to the working electrode 511.

In the step S653 of continuously measuring the amount of current through the amount of electrons exchanged with the counter electrode, the working electrode 511 sequentially changes the amount of current through the amount of electrons exchanged with the counter electrode 512 . That is, in the step S653 of continuously measuring the amount of current through the amount of electrons exchanged with the counter electrode by the working electrode, it is possible to successively measure the amount of current change according to the amount of the signal material that is not coupled with the gene .

The step S650 of measuring the amount of current of the mixed material may further include a step S654 of displaying a display voltage which is a sum of an applied voltage and a reference voltage of the reference electrode. Step S654 of displaying the display voltage, which is a sum of the applied voltage and the reference voltage of the reference electrode, may display the display voltage, which is a sum of the applied voltage and the reference voltage, on a separate display unit . The user can confirm whether an applied voltage that can cause a redox reaction is applied to the signal material included in the mixed material through the display voltage.

After the step S650 of measuring the amount of current of the mixed material, step S660 of discriminating the gene by analyzing the measured amount of current may be performed. Specifically, in the step S660 of determining the gene by analyzing the measured amount of current, it is determined that the gene is less than the reference amount when the amount of current is higher than a predetermined reference value, and when the amount of current is less than the predetermined reference value, It can be judged that the gene is larger than the reference amount.

For example, in the case of the food-borne pathogen discriminator using the method for distinguishing food-borne bacteria using the gene discrimination chip and the primer according to the present invention, it is judged that the gene causing the food-borne pathogen is small when the electric current is higher than the preset reference value, It can be judged. Conversely, if the amount of current is lower than a predetermined reference value, it is judged that there are many causative genes causing food poisoning, and it can be judged that there is a risk of food poisoning if the food is consumed.

The method of discriminating using the gene discriminating chip is not limited to the food poisoning bacteria discriminating machine. As an example, the method of gene discrimination using a gene discrimination chip can be applied to a fish species discriminator.

Example 1 Culture of food poisonous bacteria to be detected and gDNA extraction

The strains of six food poisoning bacteria used in the experiment are summarized in Table 1 below. Escherichia coli O157: H7), Salmonella Entebbe utility disk (Salmonella enteritidis), Staphylococcus aureus (Staphylococcus aureus), L. monocytogenes to Ness (Listeria aerobic bacteria including monocytogenes , Yersinia enterocolitica , and Bacillus cereus were inoculated into 4 ml of TSB (Trypton Soy Broth) and cultured at 37 ° C for 16 hours.

After the incubation, the microorganism gDNA was extracted using GeneAll Exgene ^™ Cell SV kit. The concentration of extracted gDNA was measured using a spectrophotometer (UV-1601 Spectrophotometer, Shimadzu Corp., Japan).

Food poisoning bacteria Strain Listeria monocytogenes
( Listeria monocytogenes ) ATCC 19111 E. coli
( Escherichia coli O157: H7) ATCC 43894 Staphylococcus aureus
( Staphylococcus aureus ) ATCC 29213 Salmonella enteritidis
( Salmonella enteritidis ) ATCC 13076 Yersinia enterrocolitica
( Yersinia enterocolitica ) ATCC 23715 Bacillus cereus
( Bacillus cereus ) ATCC 21768

Example 2: Primer design for detection of food poisoning bacteria

Primer design conditions for the detection of 6 species of food poisoning bacteria were 35 - 60% for GC% and 58 - 61 ℃ for Tm, and Primer 3 was used for the specific genes of each pathogenic bacterium.

Table 1 summarizes the species specific genes and amplified products of target food poisoning bacteria amplified by the synthesized primers.

Strain gene Product size
(bp) Primer Sequences (5 '- 3') Escherichia coli O157: H7 eaeA 384 EO157-F GACCCGGCACAAGCATAAGC (SEQ ID NO: 1) EO157-R CCACCTGCAGCAACAAGAGG (SEQ ID NO: 2) Staphylococcus aureus nucA 400 STAU-F AAAGCGATTGATGGTGATACTGT (SEQ ID NO: 3) STAU-R GACCTGAATCAGCGTTGTCTTCG (SEQ ID NO: 4) Salmonella enteritidis sefa 498 SAEN1-F CAAAGCAGTGGTTCAGGCAG
(SEQ ID NO: 5) SAEN1-R TGCTGAACGTAGAAGGTCGC
(SEQ ID NO: 6) 404 SAEN2-F GGTAACAAAGCAGTGGTTCAGG (SEQ ID NO: 7) SAEN2-R ACGTAGAAGGTCGCAGTGAA
(SEQ ID NO: 8) 402 SAEN3-F GGTTCAGGCAGCGGTTACTA
(SEQ ID NO: 9) SAEN3-R TGATACTGCTGAACGTAGAAGGT (SEQ ID NO: 10) Listeria  monocytogenes hly 479 LIMO1-F CCGAACTGCATGCCGAATTT
(SEQ ID NO: 11) LIMO1-R GCAGCGCTCTCTATACCAGG
(SEQ ID NO: 12) 410 LIMO2-F CATCGACGGTAACCTCGGAG
(SEQ ID NO: 13) LIMO2-R CCGTTCTCCACCATTCCCAA
(SEQ ID NO: 14) 432 LIMO3-F CTTCGGCGCAATCAGTGAAG
(SEQ ID NO: 15) LIMO3-R TCCCGGTTAAAAGTAGCACCT (SEQ ID NO: 16) iap 499 LIMO4-F AGTGGCGCTGGTGTTGATAA
(SEQ ID NO: 17) LIMO4-R CCGTTTTCACTTCTGCTTTTGGA (SEQ ID NO: 18) Yersinia  enterocolitica yst 498 YEEN1-F ACCACCAATAGTCGTGCCTG
(SEQ ID NO: 19) YEEN1-R GGGCCACCTTAAGATGACCC
(SEQ ID NO: 20) 373 YEEN2-F TTGAAATAACTAGGCTGGGTCGA (SEQ ID NO: 21) YEEN2-R CGACGGAGGATCACAAGCTT
(SEQ ID NO: 22) family 454 YEEN3-F TGTACGCTGCGAGTGAAAGT
(SEQ ID NO: 23) YEEN3-R AGCATCCAGGTGCCAACTTT
(SEQ ID NO: 24) Bacillus cereus groEL 443 BACE-F GCTGGTGCGAACCCAATG
(SEQ ID NO: 25) BACE-R TCGCCTTCTACATCTTCAGCA
(SEQ ID NO: 26)

<Example 3> PCR was carried out using a primer for detecting food poisoning bacteria

 The DNA of the food poisoning bacteria was amplified using the GoTaq DNA Polymerase (Promega, Madison, Wisconsin, USA) and 2720 Thermal Cycler (Applied Biosystems, Foster City, CA, USA) PCR was carried out using 20 ng of gDNA, 20 pmol of forward primer and 25 μl of reverse primer, GoTaq DNA polymerase 1.25 U, 0.2 mM each dNTP, and 1 × GoTaq buffer. The PCR reaction was carried out by pre-denaturing the template DNA at 95 ° C for 5 minutes, then at 95 ° C for 30 seconds; 30 seconds at 60 占 폚; Followed by 30 cycles at 72 ° C for 30 seconds, and finally at 72 ° C for 5 minutes. For all experiments, a reaction mixture without food poisoning DNA was used as a control.

 After the DNA amplification, the PCR product was subjected to gel electrophoresis in TAE buffer using 2.5% (w / v) agarose gel, and the PCR product stained with EtBr (Ethidium bromide) was observed under ultraviolet light.

14 to 26, in lanes 1, 20 ng of Escherichia coli gDNA, 20 ng of lane 1, and 20 ng of Escherichia coli gDNA in lanes 1, 2, 3, 4, 20 ng of Staphylococcus aureus gDNA, 20 ng Salmonella enteritidis gDNA, 20 ng Salmonella entericidis gDNA, 20 ng of lycoricin enterocolitica gDNA, 20 ng of bacillus cereus gDNA, lane 6 listeria monocytogenes PCR was performed with 20 ng of ness gDNA, and lane 7 was used as a control and PCR was performed using a reaction mixture without addition of food poisoning DNA.

In Fig. 16, Fig. 17 and Fig. 18, 20 ng of Escherichia coli gDNA, 20 ng of Staphylococcus aureus gDNA, 20 ng of Salmonella enteritidis gDNA, 20 ng of lane 3, 20 ng of lycoric acid enterocolitica gDNA, , Lane 5 was performed by adding 20 ng of gDNA to listeria monocytogenes, and lane 6 was subjected to PCR using a reaction mixture without the addition of food poisoning DNA as a control. 16, 17 and 18 show primer sets for the sefA gene of Salmonella enteritidis , SEQ ID NO: 5 and SEQ ID NO: 6, primer sets for SEQ ID NO: 7 and SEQ ID NO: 8, As a result of electrophoresis on the primer set of No. 9 and 10, the corresponding primer set is suitable for the detection of food poisoning bacteria except for Bacillus cereus .

Through the experiments of FIG. 14 to FIG. 26, it can be confirmed that only six kinds of target food poisoning bacteria can be detected quickly without cross-hybridization.

It will be understood by those skilled in the art that the foregoing description of the present invention is for illustrative purposes only and that those of ordinary skill in the art can readily understand that various changes and modifications may be made without departing from the spirit or essential characteristics of the present invention. will be. It is therefore to be understood that the above-described embodiments are illustrative in all aspects and not restrictive. For example, each component described as a single entity may be distributed and implemented, and components described as being distributed may also be implemented in a combined form.

The scope of the present invention is defined by the appended claims, and all changes or modifications derived from the meaning and scope of the claims and their equivalents should be construed as being included within the scope of the present invention.

1000: gene discrimination chip 100:
110: upper frame 111: sample inlet
112: signal material inlet 113: alignment hole
114: air outlet 120: lower frame
121: outlet 122: alignment post
200: body part 205: alignment hole
210: Body channel film 220: Body upper cover film
221: sample injection hole 222: sample injection film
223: upper pressure supporting film 224: amplification channel
225: thermal diffusion blocking groove 226: pressure adjusting hole
227: signal material injection film 228: filter attachment film
229: Air filter 230: Body lower cover film
300: amplification part 310: valve film
311: valve channel film 312: wing film
313: Amplification flow path 314: Valve hole
315: valve hole 316: wing film cover
317: lift film 320: dummy chamber film
321: Amplification chamber film 322: Amplification channel
323: amplification cover film 324: dummy tape
325: dummy film 326:
400: mixer part 410: mixer lower cover film
420: first mixer channel film 430: second mixer channel film
440: third mixer channel film 450: fourth mixer channel film
460: Mixer connection hole film 461: Mixing hole
470: mixing hole film 471: mixing hole
480: upper cover film 500:
510: electrode unit 511: working electrode
512: counter electrode 513: reference electrode
514: Reactor 515:
520: Identification board unit 530: Identification film unit
531: first discrimination film 532: second discrimination film
533: third discrimination film 534: reaction chamber
540: discharge film unit 541: first discharge film
542: second discharge film 543: discharge hole

Claims (7)

a) extracting a gene to be analyzed;
b) injecting a sample containing the gene into a gene discriminating chip;
c) the gene contained in the sample passes through the amplification channel, and the heat supplied to the amplification channel is prevented from being transferred to the unexpected part by the thermal diffusion blocking grooves formed on both sides of the amplification channel, Amplification while preventing the degradation and at the same time improving the speed and efficiency of the polymerase chain reaction (PCR) so that the supplied heat is not dispersed to the surroundings;
d) The amplified gene and the signal material are passed through the first to fourth mixer channel films, and are attached between the third and fourth mixer channel films and formed into holes of different shapes to form a plurality of Forming a mixed material so as to mix and mix while passing through a mixing hole formed with a mixing hole to improve mixing efficiency;
d-1) The mixed material is provided so as to pass through a filter-attached film and an air filter made of a hydrophobic material to remove bubbles contained in the mixed material by the filter-attached film to increase gene discrimination efficiency, Moving a predetermined amount of the mixed material automatically to the discrimination unit even if the air pressure is not precisely controlled by discharging the air carrying the mixed substance to the outside;
e) measuring the amount of current of the mixed material; And
f) determining the amplified gene by analyzing the measured amount of current, and detecting the pathogen from the gene chip and the primer,
The primer pair comprising a primer comprising the nucleotide sequence of SEQ ID NO: 1 and a primer comprising the nucleotide sequence of SEQ ID NO: 2, a primer comprising the nucleotide sequence of SEQ ID NO: 3, and a nucleotide sequence of SEQ ID NO: A primer comprising a base sequence of SEQ ID NO: 5, a pair of primers comprising a base sequence of SEQ ID NO: 6, a primer comprising a nucleotide sequence of SEQ ID NO: 7, and a pair of primers comprising a nucleotide sequence of SEQ ID NO: A primer pair consisting of a primer comprising a base sequence, a primer comprising a base sequence of SEQ ID NO: 9 and a pair of primers comprising a base sequence of SEQ ID NO: 10, a primer comprising a base sequence of SEQ ID NO: 11, A primer pair consisting of a primer comprising a base sequence of SEQ ID NO: 13 and a primer pair comprising a base sequence of SEQ ID NO: 14, a primer comprising a base sequence of SEQ ID NO: 15 and a primer pair comprising a base sequence of SEQ ID NO: 16, A primer comprising a nucleotide sequence of SEQ ID NO: 17 and a primer pair comprising a nucleotide sequence of SEQ ID NO: 18, a primer comprising a nucleotide sequence of SEQ ID NO: 19 and a primer comprising a nucleotide sequence of SEQ ID NO: A primer comprising a nucleotide sequence of SEQ ID NO: 21 and a primer pair comprising a nucleotide sequence of SEQ ID NO: 22, a primer comprising a nucleotide sequence of SEQ ID NO: 23, and a primer comprising a nucleotide sequence of SEQ ID NO: And a primer pair consisting of the nucleotide sequence of SEQ ID NO: Using a primer, and at least one primer pair selected from the group consisting of a pair of primers consisting of a primer comprising the nucleotide sequence of SEQ ID NO: 26, E. coli (Escherichia coli O157: H7), Staphylococcus aureus (Staphylococcus aureus), Salmonella Entebbe utility Characterized in that it is configured to detect food poisoning bacteria of any one of Salmonella enteritidis , Listeria monocytogenes , Yersinia enterocolitica and Bacillus cereus . And a method for detecting food poisoning bacteria using the primer.
The method according to claim 1,
In the step d)
Wherein the amplified gene contained in the mixed material and the signal substance are mutually bound to each other, and the method for detecting food poisoning bacteria using the gene discriminating chip and the primer.
The method according to claim 1,
The step e)
e1) applying an applied voltage to the working electrode;
e2) exchanging electrons derived from the signal material included in the mixed material through the redox reaction with the working electrode; And
and e3) continuously measuring the amount of current through an amount of electrons exchanged with the counter electrode by the working electrode. The method of detecting a food poisoning bacteria using a gene discriminating chip and a primer.
The method of claim 3,
In the e1) step,
Wherein the applied voltage is a unique voltage value for generating a redox reaction depending on each signal substance included in the mixed material.
5. The method of claim 4,
After the step e3)
e4) displaying the display voltage as a sum of the applied voltage and the reference voltage of the reference electrode.
The method according to claim 1,
In the step f)
Determining that the amplified gene is less than the reference amount when the amount of current is higher than a preset reference value and determining that the amplified gene is greater than the reference amount when the amount of current is lower than a predetermined reference value, And a method for detecting food poisoning bacteria using the primer.
A gene discrimination chip used for detecting food poisoning bacteria,
A frame part forming an outer shape and having a sample inlet and an outlet;
A body portion including a body upper cover film provided inside the frame portion to form a body and attached to an upper portion of the body channel film on which a plurality of channels are formed so that the injected sample can be moved;
An amplification unit coupled to one side of the upper part of the body part and performing PCR on the sample;
A filter attachment film provided on the other side of the body part to form a mixed material by mixing the sample amplified by the amplification part with a signal material and to remove bubbles contained in the mixed material to increase gene discrimination efficiency, A mixer unit having an air filter arranged to automatically move a predetermined amount of the mixed material without precisely controlling the air pressure by discharging the air carrying the mixed material to the outside; And
And a discrimination unit coupled to the other side of the lower part of the body part and measuring the amount of current of the mixed material having passed through the mixer unit to discriminate a gene contained in the mixed material,
The body top cover film is provided with an amplification channel provided at a position to be coupled with the amplification unit to form a channel for allowing a sample to pass therethrough and a thermal diffusion blocking groove formed at both sides of the amplification channel, It is possible to prevent the heat supplied to the amplification unit from being transmitted to the unscheduled portion and prevent the deterioration of the sample due to excessive heat transfer and to prevent the supplied heat from being dispersed to the surroundings, , &Lt; / RTI &gt;
The mixer unit may include a mixing hole formed through the first to fourth mixer channel films and attached to between the third and fourth mixer channel films to form a plurality of mixing holes for inducing a vortex, Characterized in that it has a film,
The primer pair comprising a primer comprising the nucleotide sequence of SEQ ID NO: 1 and a primer comprising the nucleotide sequence of SEQ ID NO: 2, a primer comprising the nucleotide sequence of SEQ ID NO: 3, and a nucleotide sequence of SEQ ID NO: A primer comprising a base sequence of SEQ ID NO: 5, a pair of primers comprising a base sequence of SEQ ID NO: 6, a primer comprising a nucleotide sequence of SEQ ID NO: 7, and a pair of primers comprising a nucleotide sequence of SEQ ID NO: A primer pair consisting of a primer comprising a base sequence, a primer comprising a base sequence of SEQ ID NO: 9 and a pair of primers comprising a base sequence of SEQ ID NO: 10, a primer comprising a base sequence of SEQ ID NO: 11, A primer pair consisting of a primer comprising a base sequence of SEQ ID NO: 13 and a primer pair comprising a base sequence of SEQ ID NO: 14, a primer comprising a base sequence of SEQ ID NO: 15 and a primer pair comprising a base sequence of SEQ ID NO: 16, A primer comprising a nucleotide sequence of SEQ ID NO: 17 and a primer pair comprising a nucleotide sequence of SEQ ID NO: 18, a primer comprising a nucleotide sequence of SEQ ID NO: 19 and a primer comprising a nucleotide sequence of SEQ ID NO: A primer comprising a nucleotide sequence of SEQ ID NO: 21 and a primer pair comprising a nucleotide sequence of SEQ ID NO: 22, a primer comprising a nucleotide sequence of SEQ ID NO: 23, and a primer comprising a nucleotide sequence of SEQ ID NO: And a primer pair consisting of the nucleotide sequence of SEQ ID NO: Using a primer, and at least one primer pair selected from the group consisting of a pair of primers consisting of a primer comprising the nucleotide sequence of SEQ ID NO: 26, E. coli (Escherichia coli O157: H7), Staphylococcus aureus (Staphylococcus aureus), Salmonella Entebbe utility Characterized in that it is configured to detect food poisoning bacteria of any one of Salmonella enteritidis , Listeria monocytogenes , Yersinia enterocolitica and Bacillus cereus . .

Images