KR101903728B1 - A recombinant vector comprising MYH3 gene and use thereof - Google Patents

Abstract

The present invention relates to a recombinant vector comprising a MYH3 gene and a use thereof, and more particularly to a composition for improving meat quality comprising a recombinant vector comprising a MYH3 gene consisting of the nucleotide sequence of SEQ ID NO: 1, The present invention relates to a composition for judging meat quality comprising an agent capable of measuring an expression level.
Since the MYH3 gene has an effect of improving intramuscular fat content and redness of an individual, the recombinant vector containing the MYH3 gene may be used to improve the meat quality of the transformant. In addition, by measuring the expression level of the gene, the meat quality can be objectively evaluated.

Description

A recombinant vector comprising the MYH3 gene and its use {recombinant vector < RTI ID = 0.0 > MYH3 &

The present invention relates to a recombinant vector comprising a MYH3 gene and a use thereof, and more particularly to a composition for improving meat quality comprising a recombinant vector comprising a MYH3 gene consisting of the nucleotide sequence of SEQ ID NO: 1, The present invention relates to a composition for judging meat quality comprising an agent capable of measuring an expression level.

Pigs are the most basic livestock that provide the protein they need, since they were raised in the eastern part of India about 9,000 years ago, and have been breed in accordance with the times and circumstances and the preferences of the people. In order to produce commercially available finishing pigs, breeding pigs with excellent traits such as body weight gain, immune ability, number of litter, milk yield, and meat quality have been breeded to produce new kinds of pigs. However, the breeding process is complicated and takes a long time to obtain the breed having the desired traits. Accordingly, techniques for improving the meat quality of livestock have been actively carried out by modifying the genotype. As a result, the quality of the pigs is improved by using the SNP traits of the genes involved in the meat quality, And an improved method of producing pigs have been developed (Korean Patent Registration No. 10-1457942).

On the other hand, there are many factors that determine meat quality and weight of pigs. Among them, the level of muscle fat content is the most important measure for evaluating meat quality, and the meat size is the most important measure for meat quality. Red meat is the meat color most preferred by consumers, and it is also a predominant meat quality trait at the time of purchase. The meat quality traits vary greatly depending on the variety of pigs. In general, Korean native pigs have higher meat quality than foreign pigs. However, there are frequent cases of disturbing the distribution order by misusing the fact that pig meat is difficult to identify with the naked eye, and selling foreign pig meat that is poor in quality and selling it as native pork meat. As a result, research is actively conducted to establish objective criteria for judging pig meat.

As a part of this research, active research has been conducted in order to develop and develop methods for discriminating the breeds of pork meat using various DNA analysis techniques. For example, Korean Patent Laid-Open Publication No. 10-2004-0039059 discloses a gene assay method capable of selecting pigs excellent in the quality of pigs using specific DNA markers related to the daily gain of body weight, backfat thickness, and meat quality traits of pigs Korean Patent Laid-Open No. 10-2007-0113336 discloses an increase in the number of porcine muscle cells using a mutation (SNP) due to a single base sequence difference in the 5 'promoter region of the Myogenin gene, which is known to be involved in the myocyte differentiation of pigs. ≪ / RTI > are disclosed. However, methods for precisely determining the level of meat quality of pigs have not yet been developed, and methods for determining the level of meat quality of pigs using the MYH3 gene have not been developed.

Under these circumstances, the present inventors have made intensive researches to develop a method for judging the meat quality of livestock through genetic traits. As a result, they have found that the MYH3 gene is a gene determining the meat quality of pigs. The mouse transgenic plants were found to have better intramuscular fat content and redness compared to the wild type. Accordingly, it has been confirmed that the meat quality can be improved by using the recombinant vector containing the gene, and the meat quality can be easily determined by measuring the expression level of the mRNA or protein of the gene. Thus, the present invention has been completed .

One object of the present invention is to provide a composition for improving meat quality comprising a recombinant vector comprising the MYH3 gene consisting of the nucleotide sequence of SEQ ID NO: 1.

Another object of the present invention is to provide a composition for judging meat quality, which comprises an agent capable of measuring the expression level of mRNA or protein of the MYH3 gene comprising the nucleotide sequence of SEQ ID NO: 1.

One aspect of the present invention provides a composition for improving meat quality comprising a recombinant vector comprising the MYH3 gene consisting of the nucleotide sequence of SEQ ID NO: 1.

In the present invention, it was confirmed that the intramuscular fat content and redness of pigs were determined by the MYH3 gene, and that the transgenic mice into which the gene was introduced had improved muscle fat content and redness of the meat compared to the wild type, Of the present invention can improve the meat quality of the individual, thus completing the present invention.

The composition for improving meat quality of the present invention can exhibit a meat-improving effect by allowing an individual to express the MYH3 gene.

The term 'individual' refers to all animals such as mice, pigs, chickens, cows, and the like. Specific examples include livestock such as mammals and birds, but the present invention is not limited thereto as long as it has meat and meat composed of muscle and fat. In the present invention, the subject may be a mouse or a rat, and specific examples of the mouse variety include, but are not limited to, C57BL / 6n, BCF hybrid, FVB / n and the like.

The term "MYH3 gene" of the present invention refers to a gene encoding myosin heavy chain 3, which is one of the heavy chain proteins contained in myosin constituting the muscle of an animal, and the nucleotide sequence thereof is known from a database such as GenBank of NCBI (For example, GenBank Accession No. XM_013981330). As a specific example, the gene may be a gene derived from a pig, but is not limited thereto. In the present invention, the gene may be a polynucleotide represented by SEQ ID NO: 1.

The term "recombinant vector" of the present invention refers to a gene construct containing an essential regulatory element operably linked to express a desired gene or target RNA in a suitable host cell, such that the gene insert is expressed.

The recombinant vector of the present invention includes the MYH3 gene, specifically, it may be represented by a cleavage map of FIG. 6, and more specifically, may comprise a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 2.

In addition, the recombinant vector may include a CAGGS promoter (CAGGS promoter), and more specifically, a CAGGS promoter may be operably linked to a MYH3 gene.

The term "promoter" of the present invention is a gene site located upstream of an encoding site, which generally includes a point at which transcription is initiated. The promoter is a TATA box that controls gene expression, a CAAT box site, And an enhancer which promotes the expression of almost all genes regardless of the position and direction. In addition, among these promoters, there are a constitutive promoter that constantly induces expression in all tissues and an inducible promoter that induces time or location-specific expression. Specifically, the promoter according to the present invention is a CAGGS promoter .

The term 'operably linked' refers to a functional linkage between a nucleic acid expression control sequence and a nucleic acid sequence encoding a desired protein or RNA to perform a general function. For example, a promoter and a nucleic acid sequence encoding a protein or RNA can affect the expression of a nucleic acid sequence that is operably linked. The operative linkage with the recombinant vector can be produced using genetic recombination techniques well known in the art, and site-specific DNA cleavage and linkage are made using enzymes generally known in the art.

The term "meat quality" of the present invention means various expression traits indicating the state of the slaughter body except for bones. The expression traits include, but are not limited to, intramuscular fat content, meat color, water holding capacity, shearing force, Specifically, it may be an intramuscular fat content or a meat color. The muscle fat content is the content of fat contained in the muscle, the color is the color of the meat judged by the naked eye, the water holding capacity is the ability of the poultry to maintain moisture, the shear force is tough when the meat is torn, the higher the intramuscular fat content, The lower the water holding capacity and the shearing force, the higher the quality of the meat. Among these, the level of muscle fat content is the most important measure for evaluating meat quality, and meat color is the main factor affecting consumer 's freshness and preference evaluation.

In a specific example of the present invention, a mouse expressing the porcine MYH3 gene was prepared using a recombinant CAGGS-MYH3-Flag expression vector having the MYH3 gene inserted therein (FIGS. 5 to 7) In contrast, there are many red muscle fibers and adipocytes in the hind limb muscles, and mRNAs and proteins of genes affecting the slow type, a type of red muscle; And mRNA expression of lipogenic genes was significantly increased (Figs. 9 and 10).

This suggests that the use of the composition of the present invention comprising a recombinant vector containing the MYH3 gene can improve meat quality by improving intramuscular fat content and meat color of an individual.

Another embodiment provides a composition for judging meat quality comprising an agent capable of measuring the expression level of mRNA or protein of MYH3 gene.

In the present invention, when the expression level of the MYH3 gene is high, it can be judged that the intramuscular fat content increases and the redness of the meat color increases when the expression level is low.

The term "agent capable of measuring the expression level of mRNA or protein of MYH3 gene" of the present invention means a preparation capable of specifically binding to mRNA or protein of the gene and capable of amplifying the mRNA or protein, As a specific example, a primer or a probe that specifically binds to the mRNA; Or an antibody or a probe that specifically binds to the protein.

The agent may be labeled directly or indirectly for the expression level of the MYH3 gene. Specifically, the label may be a ligand, a bead, a radionuclide, an enzyme, a substrate, a cofactor, an inhibitor, a fluorescer, a chemiluminescent material, a magnetic particle, a hapten and a dye. It does not. Specific examples of the ligand include biotin, avidin and streptavidin, and the enzyme includes luciferase, peroxidase, and beta-galactosidase, and the fluorescent substance includes fluorescein, coumarin, rhodamine, But are not limited to, fumaric acid, fumaric acid, fumaric acid, fumaric acid, fumaric acid, fumaric acid, fumaric acid, fumaric acid, fumaric acid, fumaric acid, Many of the known markers may be used as such detectable markers, and those skilled in the art will be able to select appropriate markers for the purpose of the invention.

The term "primer" of the present invention is a base sequence having a short free 3 'hydroxyl group and can form a base pair with a complementary template and is used as a starting point for template strand copy Quot; short sequence " In the present invention, primers used for mRNA amplification of the MYH3 gene, suitable conditions in appropriate buffers (for example, four different nucleoside triphosphates and polymerase such as DNA, RNA polymerase or reverse transcriptase) Stranded oligonucleotide that can serve as a starting point for template-directed DNA synthesis. The appropriate length of the primer may vary depending on the intended use. The primer sequence does not need to be completely complementary to the polynucleotide of mRNA of the MYH3 gene or its complementary polynucleotide, and can be used if it is sufficiently complementary to hybridize.

In the present invention, the primers may be polynucleotides consisting of the nucleotide sequences shown in SEQ ID NOs: 23 and 24, but the present invention is not limited thereto.

The term "antibody" of the present invention means a protein molecule that acts as a receptor for an antigen specifically recognizing an antigen, including an immunoglobulin molecule immunologically reactive with a specific antigen, and includes a polyclonal antibody, Clone antibodies, whole antibodies, and antibody fragments. The whole antibody is a structure having two full-length light chains and two full-length heavy chains, and each light chain is linked to a heavy chain by a disulfide bond. The whole antibody includes IgA, IgD, IgE, IgM and IgG, and IgG is a subtype and includes IgG1, IgG2, IgG3 and IgG4.

In the present invention, the antibody may be IgG, but it is not limited thereto, and a person skilled in the art will be able to select an appropriate antibody for the purpose of the invention.

The term "probe" of the present invention means a labeled nucleic acid fragment or peptide capable of specific binding with mRNA or protein. Specific examples include oligonucleotide probes, single stranded DNA probes, double stranded DNA probes, RNA probes, oligonucleotide peptide probes, polypeptide probes, and the like. .

In a specific embodiment of the present invention, mice transfected with the recombinant vector containing the MYH3 gene showed increased transcriptional activity of the MYH3 gene and increased expression of mRNA and protein (FIG. 7). In addition, the mouse has a greater number of red muscle fibers and adipocytes in the hind leg muscles than the wild type mouse, and the gene mRNA and protein affecting the slow type, which is a type of red muscle; And mRNA expression of lipogenic genes was significantly increased (Figs. 9 and 10).

This suggests that measuring the level of mRNA or protein expression of the MYH3 gene can determine the meat quality.

Since the MYH3 gene has an effect of improving intramuscular fat content and redness of an individual, the recombinant vector containing the MYH3 gene may be used to improve the meat quality of the transformant. In addition, by measuring the expression level of the gene, the meat quality can be objectively evaluated.

Fig. 1 is an image comparing appearance and sirloin photographs of the land race (a), which is an introduced species, and Jeju native pig (b), a native species.
FIG. 2 is a graph showing the results of linkage-linkage disequilibrium analysis (LDLA) according to confirmation of a QTL (quantitative trait locus) region of a meat quality trait determining gene. a is a descendant (LK axis group) obtained by crossing Jeju traditional pig and a land race pig, and b is a progeny (DK axis group) obtained by crossing Jeju traditional pig and durok pig.
FIG. 3 shows the result of LALD mapping showing the gene existing in the QTL region of the meat quality trait determining gene.
4 is a graph comparing mRNA expression levels of genes present in the QTL region. a is the sirloin (long root, longissimus), and b is the fuji (quadriceps).
Figure 5 shows a cleavage map of the CAGGS-EGFP-Puro vector.
FIG. 6 shows the cleavage map of the CAGGS-MYH3-Flag expression vector in which the MYH3 gene was recombined and the order of the genes in the vector.
FIG. 7 shows the MYH3 gene activity and expression pattern of a mouse transformed with a recombinant vector of MYH3 gene. a is an image showing the transcriptional activity of the MYH3 gene. P / C is a positive control; numbers marked in red (21, 24, 26, 27, 28) are transgenic mice showing MYH3 gene transcription activity; numbers in black (19, 20, 22, 23 , ≪ / RTI > 25) refers to a mouse that has been transformed but lacks the transcriptional activity of the MYH3 gene. b is an image showing the result of Western blotting analysis of the expression amount of MYH3 gene.
Fig. 8 shows a transformed mouse into which a porcine MYH3 gene is inserted.
Figure 9 is an image showing the appearance of the hind leg muscle (a) and muscle tissue (b, c) of the wild type mouse (WT) and the transgenic mouse (TG). b is a histochemical staining of the hindlimb muscle tissue with myosin ATPase, Type 1 / oxidative / slow fibers, red arrows are Type 1 / oxidative / slow fibers, blue arrows are Type 2a, a type of white muscle, Type 2b / Type 2 / glycolytic / fast fibers. The scale bar means 50 탆. c is an image of hind limb muscle tissue stained with Oil red O. The scale bar means 100 탆, and the area existing in the rectangle is enlarged and shown below.
FIG. 10 shows the results of confirming the intramuscular gene expression pattern of a transgenic mouse into which a porcine MYH3 gene has been inserted. a shows the results of qRT-PCR and Western blot analysis of mRNA and protein expression of genes related to the type of muscle fibers. Four months old wild-type mice (n = 3) and transgenic mice (n = 5) were used. b shows the results of qRT-PCR analysis of mRNA expression levels of genes related to the slow-type (left) and fast-type (right) muscles of the hind limb muscles. Four months old wild-type mice (n = 3) and transgenic mice (n = 4) were used. The results were obtained in three independent experiments, which were expressed as mean ± SEM (* P <0.05, ** P <0.01). c shows the result of staining the hindlimb muscles with hematoxylin and eosin. The arrow indicates the perimysium, and the triangle indicates the endomysium. d shows the results of qRT-PCR analysis of the mRNA expression level of the lipogenic gene.
11 is an image showing the structure and QTN (quantitative trait nucleotide) of the porcine MYH3 gene.
Fig. 12 is an image showing a pattern of cleavage of a causative base mutation affecting meat quality using HpyCH4IV restriction enzyme. 1/1 from the LANDRACE varieties (q / q), 1/2 from the mating varieties (q / Q) of the non-cutting, landrace and Jeju native pigs, ) 2/2 shows the truncated form.

Hereinafter, the present invention will be described in more detail with reference to examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

Example 1. Visual comparison of meat with pig meat

In order to compare the meat quality of Korean traditional black pork and land lace pig (intramuscular fat content and red meat), the shape of the sirloin was analyzed.

As a result, as shown in FIG. 1, it was confirmed that the fillet meat of the land race, which was introduced, was whitish and pale, while the fillet meat of Jeju native pig was black and red meat. Especially, marbling deposition was excellent.

From the above results, it can be seen that the regenerating pigs are superior in meat quality to land races.

Example  2. Meat quality of pigs A quantitative characteristic spot (quantitative trait locus; QTL ) analysis

Example 2-1. Identification of QTL regions of meat quality genes

(LK axis group) obtained by crossing Jeju traditional pig and land lace pig and a progeny (DK axis group) obtained by crossing Jeju traditional pig and durok pig were examined to identify genes determining the meat quality of pigs. Quantitative trait locus (QTL) analysis was performed on the meat quality (redness (a *), intramuscular fat content (IMF)).

As a result, as shown in FIG. 2 (a), it was confirmed that the vertical dotted line in the LK axis group was located on the 661 kb region of chromosome 12, and also, in the KD axis group, It was confirmed that it was located on the 661 kb region of chromosome 12.

From the above results, it was confirmed that the genes determining the red meat (redness) and intramuscular fat content were present in the same position irrespective of the variety of pigs, and they were found to exist within the 661 kb region of chromosome 12.

Example 2-2. Identification of Pig Flesh Transcript Genes

As a result of confirming that the gene for determining porcine meat quality was present within the 661 kb region of chromosome 12, the gene in the region was confirmed by LALD mapping.

As a result, as shown in FIG. 3, it was confirmed that nine genes of MYH3, MYH1, MYH2, MYH13, ADPRM, SCO1, TMEM220, ENSSSCG00000029441 and ENSSSCG00000018006 were present in the above meaty trait gene region.

Examples 2-3. Selection of genes related to pig meat quality traits

By confirming the nine genes determining the meat quality trait through the above Example 2-2, the genes most relevant to the determination of the meat quality traits among the genes were selected.

Relative mRNA expression levels of the nine genes were analyzed in LANDRACE and KNP loin (longissimus, longissimus) and Fuji (quadriceps).

Specifically, muscle tissue was sampled from the pork loin (Landrace) and the land race, and RNA was isolated using Trizol reagent (Ambion). After adjusting the RNA concentration of each tissue to 5 ㎍, cDNA (complement DNA) was synthesized using TOPscript cDNA synthesis kit (Enzynomics). Then, qRT-PCR experiment was performed using cDNA of each tissue. The qRT-PCR experiment was repeated 40 times at 95 ° C for 20 seconds, at 60 ° C for 20 seconds, and at 72 ° C for 20 seconds. The QRT-PCR experiment was performed using the QuatiTect SYBR Green PCR kit (Qiagen) and analyzed in real time using a thermal cycler (Qiagen) instrument. Primers used for a total of 9 gene analyzes are listed in Table 1 below.

gene division direction The base sequence (5 '- &gt; 3') pMYH3 SEQ ID NO: 3 Forward AAAAGCTCAGCATGAGCTCGA SEQ ID NO: 4 Reverse AGGGTCAGGAACCATGAAAAT pMYH1 SEQ ID NO: 5 Forward GTTCTGAAGAGGGTGGTAC SEQ ID NO: 6 Reverse AGATGCGGATGCCCTCCA pMYH2 SEQ ID NO: 7 Forward GGGCTCAAACTGGTGAAGC SEQ ID NO: 8 Reverse AGATGCGGATGCCCTCCA pMYH13 SEQ ID NO: 9 Forward CACAGGGCTCTGGCCGACAT SEQ ID NO: 10 Reverse CGTGCGCACAGGGGTGTAGT pADPRM SEQ ID NO: 11 Forward CATCCTGAGACCGTGCCTTCA SEQ ID NO: 12 Reverse TTCCGCATTTGGGTTGTGCT pSCO1 SEQ ID NO: 13 Forward TCCTCACGGACTCGGGGTTT SEQ ID NO: 14 Reverse GTGGGGTCTCTGCTGCCCTT pTMEM220 SEQ ID NO: 15 Forward CCCAGACGCAGAACTGTGGG SEQ ID NO: 16 Reverse GTTGTATGCCAAGCCGGCAG pENSSSCG00000029441 SEQ ID NO: 17 Forward TCGTGCTGGAGCAGGAGGAG SEQ ID NO: 18 Reverse AGGTGTCTGTGGCCTTGGGG pENSSSCG00000018006 SEQ ID NO: 19 Forward AGAACCAGCCCTTCGATGCC SEQ ID NO: 20 Reverse TGGCATACACATCCTCCGGC pGAPDH SEQ ID NO: 21 Forward GGGCATGAACCATGAGAAGT SEQ ID NO: 22 Reverse GGGCATGAACCATGAGAAGT

As a result, as shown in Figs. 4A and 4B, mRNA expression of the MYH3 gene was significantly higher in the sirloin and fuji of the native pig than in the landrace.

From the above results, it was found that the MYH3 gene is a major gene that determines the red color and the intramuscular fat content, among the meat quality traits of pigs.

Example 3: Construction of transgenic mouse into which porcine MYH3 gene was inserted

In order to confirm the in vivo activity of the gene, the MYH3 gene was identified as a gene determining the redness and muscle fat content among the meaty traits of pigs in Example 2, Transgenic mice transfected with the porcine MYH3 gene were prepared by the method according to 3-2.

Example 3-1. Production of Transformation Vector

First, a recombinant CAGGS-MYH3-Flag expression vector into which a MYH3 gene was inserted was prepared in order to construct a transgenic mouse into which a porcine MYH3 gene was inserted.

Specifically, in order to prepare a vector overexpressing the porcine MYH3, the whole base sequence of the mRNA of the porcine MYH3 gene was confirmed, and the DNA fragments were artificially synthesized by dividing into four portions in total. The first fragment was 1,417 bp, which was artificially synthesized by adding XbaI and BglII enzyme sites on both ends to both ends. BglII and SalI were synthesized at 1,745 bp for the second fragment, SalI and SacII at 1,777 bp for the third fragment, and SacII and EcoRI at the fourth and final 944 bp. The completed four DNA fragments were ligated using an enzyme site artificially bound to the ends to finally complete a gene fragment containing the entire mRNA of the porcine MYH3 gene.

Then, the CAGGS-EGFP-Puro vector as shown in Fig. 5 was digested with XbaI and EcoRI for introduction into the overexpressed vector, and then a whole fragment of the prepared porcine MYH3 gene mRNA was inserted to finally produce a porcine MYH3 transformant vector (Fig. 6).

The structure of the vector is shown in FIG. 6, and the nucleotide sequence of the vector is shown in SEQ ID NO: 2.

Example 3-2. Construction of transgenic mice

Example 3-2-1. How to make transgenic mice

Transgenic mice were constructed using the vectors prepared in Example 3-1.

Specifically, embryos of C57BL / 6n mice were obtained and the transformed vectors prepared above were introduced into the nucleus of embryos using microinjection.

As a result, a total of 47 F0 founders were identified.

Example 3-2-2. mRNA expression analysis to confirm the introduction of foreign gene

In order to confirm whether the MYH3 gene was introduced into the transgenic mouse prepared in Example 3-2-1, mRNA expression of the gene was analyzed.

Specifically, PCR conditions were repeated 40 times at 95 ° C for 30 seconds, at 60 ° C for 30 seconds, and at 72 ° C for 30 seconds, and the primers used were listed in Table 2 below.

gene division direction The base sequence (5 '- &gt; 3') pMYH3 SEQ ID NO: 23 Forward CCGAGAGCTGGAGTTTGA SEQ ID NO: 24 Reverse CTCCCATATGTCCTTCCGAGT

As a result, as shown in FIG. 7 (a), transgenic mice (21, 24, 26, 27, and 28) in which the MYH3 gene was inserted and expressed mRNA could be identified.

Example 3-2-3. Confirmation of introduction of foreign gene through analysis of protein expression

In order to confirm whether the MYH3 gene was introduced into the transgenic mouse prepared in Example 3-2-1, the expression of the gene was analyzed.

Specifically, after removing the fuzzy muscle tissue of the wild-type mouse (WT) and the transgenic mouse (TG), the tissue was degraded by adding the protease inhibitor to the RIPA buffer and ultrasonication. Subsequently, the protein and the protein were separated through a low-temperature centrifuge to recover proteins from the supernatant. The recovered protein was quantified using a BSA protein assay reagent (bio-rad), and then heated at 100 ° C. for about 10 minutes with 4 × protein loading buffer (1 ×). To perform Western blotting using the prepared protein, the protein was subjected to SDS-PAGE gel for about 2 hours. Then, the proteins were transferred to a PVDF membrane and blocked with 5% skim milk for 1 hour. The primary antibody (Anti-Flag M2 (F1804, Sigma-Aldrich) and b-actin , Cell signaling) was added and reacted overnight at 4 ° C. The next day, the cells were washed with TBST solution, reacted with the secondary antibody for 2 hours, treated with ECL reagent, and the signal of the antibody bound to the protein was confirmed using a LAS-300 luminescent image analyzer system (Fujifilm). The secondary antibodies used in the experiments were used differently according to the primary antibodies.

As a result, as shown in FIG. 7 (b), it was confirmed that the expression level of the MYH3 gene was the highest among the transgenic mice at 24 hours. Thus, the 24 transgenic mouse having the highest expression level of the transgene was used for breeding after mating, and its appearance is shown in FIG.

Example 3-3. Identification of muscle type in transgenic mice

In order to confirm the function of the MYH3 gene related to the determination of the meat quality trait, the meat quality of the transgenic mouse prepared in Example 3-2 was examined.

First, as can be seen from FIG. 9 (a), it was confirmed that the muscles of the hind legs of the pig MYH3 transgenic mice (W: TG) were redder than the wild type mice (WT).

Afterwards, ATPase staining was performed to further confirm the muscle morphology. The hindlimb muscles of wild-type and transgenic mice were harvested, treated overnight in a 30% sucrose solution, tissue-sectioned to 10 쨉 m at -25 째 C using an OCT compound, And fixed with PEA for 1 hour. After washing with running water for 10 minutes and washing with 60% isopropanol, ATPase stain lyopilized powder for histoenzymatic reaction kit (Bio-optica) was used according to the manufacturer's instructions Experiments were performed.

As a result, as shown in FIG. 9 (b), it was confirmed that the transgenic mouse (right; TG) in which the gene was inserted contained more red muscle in the hind limb muscle than the wild type mouse (left; WT) .

In addition, Oil Red O staining was performed to determine the distribution of fat in muscle tissue. Specifically, the tissue slice was reacted with 0.3% Oil Red O solution for 1 hour.

As a result, as shown in FIG. 9 (c), it was confirmed that the degree of staining in the transgenic mouse (TG) was stronger than in the wild type mouse (left; WT) Of the total population.

These results suggest that MYH3 gene is a causative gene that accumulates red muscle and improves redness and accumulates muscle fat content.

Example 3-4. Identification of intramuscular gene expression patterns in transgenic mice

Example 3-4-1. Identification of expression pattern of white muscle / red muscle roughening gene

In order to confirm the function of the MYH3 gene related to the meat quality characterization, the expression pattern of the white muscle / red muscle roughening gene of the transgenic mouse prepared in Example 3-2 was examined.

Specifically, fuzzy muscle tissue of wild-type mouse (WT) and transgenic mouse (TG) was collected and qRT-PCR was performed by the method according to Example 2-3. The primers used at this time are listed in Table 3 below.

gene division direction The base sequence (5 '- &gt; 3') Myh7 SEQ ID NO: 25 Forward AGTCCCAGGTCAACAAGCTG SEQ ID NO: 26 Reverse TTCCACCTAAAGGGCTGTTG Myh2 SEQ ID NO: 27 Forward AGTCCCAGGTCAACAAGCTG SEQ ID NO: 28 Reverse GCATGACCAAAGGTTTCACA Myh1 SEQ ID NO: 29 Forward AGTCCCAGGTCAACAAGCTG SEQ ID NO: 30 Reverse CACATTTTGCTCATCTCTTTG Myh4 SEQ ID NO: 31 Forward AGTCCCAGGTCAACAAGCTG SEQ ID NO: 32 Reverse TTTCTCCTGTCACCTCTCAACA Myoglobin SEQ ID NO: 33 Forward GCAAGGCCCTGGAGCTCTTC SEQ ID NO: 34 Reverse GCTTGGTGGGCTGGACAGTG Tnnt1 SEQ ID NO: 35 Forward CCCCCGAAGATTCCAGAAGG SEQ ID NO: 36 Reverse TGCGGTCTTTTAGTGCAATGAG Tnni1 SEQ ID NO: 37 Forward ATGCCGGAAGTTGAGAGGAAA SEQ ID NO: 38 Reverse TCCGAGAGGTAACGCACCTT Tnnc1 SEQ ID NO: 39 Forward GCGGTAGAACAGTTGACAGAG SEQ ID NO: 40 Reverse CCAGCTCCTTGGTGCTGAT Aldoa SEQ ID NO: 41 Forward ACTCTCTGCTGACCGGGCTCT SEQ ID NO: 42 Reverse AATGCTTCCGGTGGACTCAT Pvalb SEQ ID NO: 43 Forward ATCAAGAAGGCGATAGGAGCC SEQ ID NO: 44 Reverse GGCCAGAAGCGTCTTTGTT Tnnt3 SEQ ID NO: 45 Forward GGAACGCCAGAACAGATTGG SEQ ID NO: 46 Reverse TGGAGGACAGAGCCTTTTTCTT Tnni2 SEQ ID NO: 47 Forward AGAGTGTGATGCTCCAGATAGC SEQ ID NO: 48 Reverse AGCAACGTCGATCTTCGCA Tnnc2 SEQ ID NO: 49 Forward ATGGCAGCGGTACTATCGACT SEQ ID NO: 50 Reverse CCTTCGCATCCTCTTTCATCTG GAPDH SEQ ID NO: 51 Forward GAAGGGCATCTTGGGCTACAC SEQ ID NO: 52 Reverse GCAGCGAACTTTATTGATGGTATT

Western blot was performed using the method according to Example 3-2-3, wherein the primary antibody used was Anti-Flag M2 (F1804, Sigma-Aldrich), MYH7 (SC-53089, Santa Cruz Biotechnology ), MYH4 (H00004622-B01P, Abnova) and b-actin (# 4970, Cell signaling).

As a result, as shown in FIG. 10 (a), mRNA and protein expression of MYH7 gene, which is a type of red muscle, was dramatically increased in transgenic mice compared with wild type mice.

As shown in FIG. 10 (b), in the transgenic mice, the fast type genes (Aldoa, Pvalb, Tnnf3, Tnnl2, and Tnnc2), which are a kind of white muscle, The genes affecting the slow type, myoglobin, Tnnt1, Tnnl1, and Tnnc1, all showed increased mRNA expression.

Example 3-4-2. Identification of expression patterns of fat accumulation patterns and related genes

In addition, in order to confirm the function of the MYH3 gene in the determination of meat quality traits, the fat accumulation pattern of the transgenic mouse prepared in Example 3-2 and the expression pattern of the related gene were examined.

First, to confirm the fat accumulation pattern, we tried to identify the morphology of the tissue, and we performed H & E (Hematoxylin and eosin) staining. Paraffin embedding was carried out using the muscle tissues of wild-type mouse (WT) and transgenic mouse (TG), and the tissue was cut into a thickness of 4 탆. Then, paraffin was removed by using xylene, dehydrated in the order of 100%, 95%, 75% and 50% alcohol, and then washed in running water for 5 minutes. Thereafter, the cells were treated with Myyer's hematoxylin solution for 1 minute, washed with flowing water for 20 minutes, treated with esoin for 1 minute, followed by dehydration and clearing, And the state of staining was confirmed.

In order to confirm the expression pattern of the fat accumulation gene in the muscle tissue of the transgenic mouse, qRT-PCR was performed by the method according to Example 2-3. The primers used at this time are listed in Table 4 below.

gene division direction The base sequence (5 '- &gt; 3') CD36 SEQ ID NO: 53 Forward AATGGCACAGACGCAGCCT SEQ ID NO: 54 Reverse GGTTGTCTGGATTCTGGA LPL SEQ ID NO: 55 Forward GTACCTGAAGACTCGCTCTC SEQ ID NO: 56 Reverse AGGGTGAAGGGAATGTTCTC Fabp4 SEQ ID NO: 57 Forward GATGCCTTTGTGGGAACCTG SEQ ID NO: 58 Reverse TCCTGTCGTCTGCGGTGATT Fto SEQ ID NO: 59 Forward GTCAGAGAGAAGGCCAATGA SEQ ID NO: 60 Reverse TAGCAGTCTCCCTGGTGAAG Pgc1a SEQ ID NO: 61 Forward CCCTGCCATTGTTAAGACC SEQ ID NO: 62 Reverse TGCTGCTGTTCCTGTTTTC Adiponectin SEQ ID NO: 63 Forward AATGGCACACCAGGCCGTGAT SEQ ID NO: 64 Reverse TCTCCAGGCTCTCCTTTCCTG

As a result, as shown in FIGS. 10C and 10D, it was confirmed that the expression of the lipogenic gene was significantly increased in the transgenic mouse as compared with the wild-type mouse in that the interval between the muscle cells was large and the fat was deposited therebetween .

These results indicate that the MYH3 gene not only affects the expression of the red muscle-associated gene but also promotes the formation of intramuscular fat.

Example 4. Genotype analysis of MYH3 gene

To analyze the genotype of the MYH3 gene, the 5'-UTR 3kb from the transcription start site (TSS) of the porcine MYH3 gene and the 3'-UTR 1kb from the stop codon were decoded .

As a result, QTN (i.e., MYH3-1805_-1810delGGACTG) was identified (indicated by a red dot) in the MYH3 gene that affects meat quality, as can be seen from Fig. Also, it was confirmed that a base mutation exists between LANDLACE and KNP, which is located at the 5'-UTR from the initiation codon (ATG) in exon 3. In the case of Jeju native pigs, it was confirmed that the site of -1805 bp to -1810 bp was defective, which confirmed the binding site of myogenesis regulatory factor (MRF).

Example 5. Judgment of Pig Breed through Identification of Genotype of MYH3 Gene

As a result of confirming the presence of a base mutation between the MYH3 gene of Landrace and Jeju native pig in Example 3, the base mutation was used to determine the meat quality of the pig.

Specifically, a primer (forward: 5'-TGG TCT TTC CTA ATT GGT GAC AT-3 '(SEQ ID NO: 65), reverse: 5'-AGT TTT GAG CAA GGC TTT TGT T-3' To amplify a portion containing the base mutation. 100 ng / ㎕ of DNA isolated from the blood of each pig was used as a template, and 10 × reaction buffer, 20 mM dNTP, 200 mM forward and reverse primers, and 1.5 units of Taq DNA polymerase (TaKaRa, Japan) The PCR reaction was carried out at 25 용량 by adding ionized water. PCR amplification was performed for 30 cycles using PTC-200 (MJ Research, USA). The annealing temperature of the primer was 60 ° C. The amplified product was electrophoresed on 2% agarose gel containing EtBr (ethidium bromide), and then amplified under UV.

Then, the 'A ▼ CGT' portion of the base sequence of the causative base mutation was cleaved by using HpyCH4IV restriction enzyme. The amplified PCR product was digested with restriction enzymes (HpyCH4IV). The restriction enzyme reaction conditions were 3 μl of PCR amplification product, 1 μl of 10X buffer, 0.3 μl of restriction enzyme and 5.7 μl of DW, Lt; 0 &gt; C overnight. Electrophoresis was performed on 2% agarose gel containing EtBr (ethidium bromide) to confirm the cleavage pattern of the landrace and Jeju native pig MYH3 gene by restriction enzyme.

As a result, as shown in FIG. 12, it was confirmed that the LANDLACE pig having poor meat quality did not cleave the gene, resulting in one band at 250 bp (1/1; non-cleaved type) The Korean traditional pig (KNP) was confirmed to have two bands at 167 and 77 bp by cleavage of the gene (2/2; truncated form). In addition, it was confirmed that the hybrid cultivars of Landrace and Jeju native pigs were represented by two bands at 250 and 167 bp (1/2, cut type).

Through the above results, it was confirmed that the pigs could be distinguished from the native pigs by confirming the mutation of MYH3, which is a gene that determines the meat quality of pigs, as well as judging the meat quality of the pigs.

From the above description, it will be understood by those skilled in the art that the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. In this regard, it should be understood that the above-described embodiments are to be considered in all respects as illustrative and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention without departing from the scope of the present invention as defined by the appended claims.

<110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION)          Jeju National University Industry-Academic Cooperation Foundation <120> A recombinant vector comprising MYH3 gene and use thereof <130> KPA161030-KR <160> 66 <170> KoPatentin 3.0 <210> 1 <211> 5823 <212> DNA <213> Sus scrofa <400> 1 atgagcagcg acactgaaat ggaagtgttc ggcatagccg ctcccttcct ccgcaagtcg 60 gaaaaggaga ggatcgaggc gcagaaccag cccttcgatg ccaaaaccta ctgcttcgtg 120 gtcgactcga aggaagagta cgccaagggg aaaattaaga gcacccagga tgggaaggtc 180 acggtggaga ccgaagacaa caggaccctg gtggtgaagc cggaggatgt gtatgccatg 240 aaccccccca agtttgaccg gatcgaggac atggccatgc tgacgcacct gaacgagccg 300 gccgtgctgt acaacctcaa ggaccggtac acctcctgga tgatctatac ctactcgggc 360 ctcttctgtg tcaccgtcaa cccctacaag tggctgccgg tgtacaaccc cgaggtggtg 420 gagggctacc gaggcaaaaa gcgccaggag gccccgcccc acatcttctc catctccgac 480 aacgcctatc agttcatgtt gacagatcgt gaaaaccagt ccattctgat caccggagaa 540 tccggggcgg gaaagactgt gaacaccaag agggtcatcc agtactttgc aacaattgct 600 gccactgggg acctcgccaa gaagaaggac tccaagatga aggggactct ggaggaccag 660 atcatcagcg ccaacccgct gctggaggcc ttcggcaacg ccaagaccgt gaggaacgac 720 aactcgtccc gcttcggcaa gttcatccga atccattttg gtaccaccgg gaagctggcc 780 tccgcagaca tcgaaacata tctgctcgaa aaatcgagag tgaccttcca gctgaaggct 840 gagaggagct accacatctt ctaccagatt ctctccaaca agaagccgga gctcatagag 900 ctgctgctca ttacaaccaa ccccttcgac tacccgttca tcagccaggg cgagatcctc 960 gtggccagca ttgatgatgc cgaggagctg ctagccacgg atagtgccat cgacatcctg 1020 ggcttcaccc cagaggagaa atctggactc tacaagctga cgggcgccgt gatgcactac 1080 gggaacatga agttcaagca gaagcaacgg gaggagcagg cagagccgga cggcacggaa 1140 gtggctgaca agacagccta cctcatgggc ctgaactctt cggacctcct gaaggctttg 1200 tgcttcccca gagtcaaagt tgggaacgag tatgttacca agggccagac cgtggatcag 1260 gtgcaccacg cggtgaacgc actctccaaa tccgtctacg agaagctctt cctgtggatg 1320 gtcacccgca tcaaccagca gctggacacc aagctgccca ggcagcactt catcggcgtc 1380 ttggacatcg cgggctttga gatctttgag tataacagcc tggagcagct gtgcatcaac 1440 ttcaccaacg agaaactgca acagtttttc aaccaccaca tgttcgtgct ggagcaggag 1500 gagtacaaga aggaaggcat cgagtggacg ttcatcgact tcgggatgga cctggccgcc 1560 tgcatcgagc tcatcgagaa gcccatgggc atcttctcca tcctggagga ggagtgcatg 1620 ttccccaagg ccacagacac ctccttcaag aacaagctct atgaccagca cctgggcaag 1680 tctgccaact tccagaagcc caaggtgctc aagggcaggg ccgaggccca cttctccctg 1740 atccactacg cgggcaccgt ggactacagt gtctcgggct ggctggagaa gaacaaggac 1800 cccctgaacg agacggtggt cgggctgtac cagaagtcct ccaaccggct cctggcgcac 1860 ctctacgcga ccttcgccac ggccgacgct gacagcggaa agaagaaagt tgccaagaaa 1920 aagggttctt ccttccaaac cgtctctgcc cttttcaggg aaaacctgaa caagctgatg 1980 tcgaatttaa ggacgactca ccctcacttt gtgcgctgta tcattcccaa tgaaaccaaa 2040 accccagggg ccatggaaca tagcctggtc ctgcaccagc tgaggtgtaa cggcgtgctg 2100 gagggcatcc gcatctgcag gaagggcttc cccaatcgga tcctctacgg ggattttaaa 2160 caaagatacc gcgtgctgaa tgccagcgcc atccccgagg gacagttcat cgacagcaag 2220 aaggcgtgtg aaaagctgtt ggcgtccatc gatattgacc acactcagta caaattcgga 2280 cacaccaagg tgttcttcaa ggccggcttg ctgggaaccc tggaggaaat gcgggacgac 2340 cgcctggcca agctcatcac ccggacgcaa gccgtgtgca ggggcttcct catgcgcgtg 2400 gaattccaga agatggtgca gagaagggag tccatcttct gcatccagta caacatccga 2460 gccttcatga acgtcaagca ctggccctgg atgaaactct tcttcaagat caagcctctg 2520 ctgaagagcg cagagaccga gaaggagatg gccaccatga aggaggagtt ccagaaaacc 2580 aaggaggaac tcgccaagtc agaggcaaag aggaaggaac tggaggaaaa gatggtgact 2640 ctggtacaag agaagaacga cctgcagctc caagtacaag ctgaaagtga aaacttgttg 2700 gatgcagagg aaagatgtga ccagctgatc aaagccaagt ttcagctgga ggccaaaatc 2760 aaggaggtga ctgagagagc tgaggatgag gaagagatca atgccgagct gacggccaag 2820 aagaggaaac tggaggatga gtgctcagaa ctgaagaaag acatcgatga ccttgagctg 2880 acactggcca aggttgaaaa ggagaaacat gccacagaga acaaggttaa aaaccttact 2940 gaggaactgg ccggcttgga tgaaaccatt gcgaagttga ccagggagaa gaaggccctc 3000 caggaggccc accagcagac cctggatgac ctccaagctg aagaggacaa agtcaactcc 3060 ttaagcaaaa tcaagagcaa actggaacag caggtggacg atctggaaag ctccctagaa 3120 caagagaaga agctccgggt cgacctggaa aggaataaaa ggaagcttga gggtgacttg 3180 aagcttgccc aggagtccat actggatctg gagaatgaca agcaacagct ggatgaaagg 3240 ctcaagaaga aggattttga gtccagtcag ctgcagagca aagtggaaga tgagcagacc 3300 ctgggcctcc agtttcagaa gaaaattaaa gagctccagg ctcgaatcga ggagctggag 3360 gaagagattg aggccgagag ggccacccgc gccaagacgg agaagcagcg cagcgactac 3420 gcccgggagc tggaggagct gagcgagcgg ctggaggagg cggggggcgt cacatccacg 3480 cagatcgagc tgaacaagaa gcgcgaggcc gagttcctga agctgcgccg ggacctggag 3540 gaggccaccc tgcagcacga ggccacagtg gctgcgctga ggaagaagca cgcggacagc 3600 gtggctgagc tgggggagca gatcgacaac ctgcagaggg tcaagcagaa gctggagaag 3660 gagaagagcg aattcaagct ggagctggac gacctggccg gcaacgtgga gagcgtgtcc 3720 aaggcgaagg ccaacctgga aaaaatctgc cgcaccctgg aggatcagct aagcgaggcc 3780 aggggcaaga acgaggaaat ccagaggagc atgagcgagc tgaccatgca gaagtcccgt 3840 cttcagacgg aggccggtga gctgagtcgt caactcgaag agaaagagag cacagtatca 3900 cagctttcca gagagagag agcgtttacc cagcaaatag aagagctcaa gaggagagg 3960 gaggaggaga gcaaggccaa gaacgccctg gcgcacgccc tgcagtcctc ccgccacgac 4020 tgcgacctgc tgcgggaaca gtatgaggag gagcaggaag ccaaggccga gctgcagagg 4080 gcgctgtcca aggccaacag cgaggttgcc cagtggagga ccaagtacga gacggacgcc 4140 atccagcgca cggaggagct ggaggaggcc aagaaaaagc ttgctcagcg ccttcaggat 4200 tccgaggag aggtggaggc agtgaacgcc aagtgtgcct ccctggagaa gaccaagcag 4260 aggctgcaag cggaggtgga ggacctgatg gtggacgtgg acagagccaa ctctctggct 4320 gctgcgctgg acaagaagca gagaaacttc gacaaggtgc tcgccgagtg gaaaacaaag 4380 tgtgaggaga gccaggcaga gctggaggca gctctgaagg aatcccgctc cttgagcacc 4440 gagctcttca agctgaaaaa tgcctacgaa gaagccttag atcaacttga aactgtgaag 4500 cgagaaaata agaacttgga gcaggagata gcagatctca cagaacaaat tgctgagaac 4560 ggtaaaacca tccatgaact ggagaaatca agaaagcaga tcgagctgga gaaggctgat 4620 atccagctgg ctcttgagga agcagaggcc gcccttgagc acgaagaggc caagatcctc 4680 cgaatccagc tggaactgac ccaggtgaaa tcggaaatcg acaggaagat ggctgagaaa 4740 gacgaagaga tcgagcagct caagaggaac taccagagaa ccgtggagac gatgcagagc 4800 gccttggacg ccgaggtgcg gagccgcaac gaggccatca ggatcaagaa gaagatggag 4860 ggggacctga acgagatcga gatccagctg agccacgcca accgccaggc cgcggagacc 4920 ctcaaacacc tccggggcgt ccaaggacag ctgaaggaca cccagctcca cctggacgac 4980 gctctccgag gccaggagga cctgaaggag cagctggcca tcgtggagcg cagagccagc 5040 ctgctgcagg ccgaggtgga ggagctgcgg gcctccctgg agcagacgga gagggcccgg 5100 aaactggcag agcaggagct cctggacgcc aacgagaggg tgcagctgct ccacacccag 5160 aacaccagcc tcatccacac caagaagaag ctggagacgg acctgatgca gctccagagc 5220 gaggtcgagg acgccagcag ggatgcgagg aacgccgagg agaaggcgaa gaaggccacc 5280 accgacgcgg ccatgatggc cgaggagctg aagaaggagc aggacaccag cgcccacctg 5340 gagcggatga agaagaacct ggagcagacg gtgaaggacc tgcagcaccg cctggacgag 5400 gcggaacagt tggccctgaa gggcgggaag aagcagatcc agaagctgga ggccagaatc 5460 cgagagctgg agtttgagct tgagggggag cagaagaaga acacggagtc tgtcaagggc 5520 ctcaggaaat acgagcggcg ggtcaaggag ttaacttacc agagtgaaga ggacaggaag 5580 aatgtgctga gattacagga cctggtggac aaacttcaag cgaaggtcaa gtcctacaag 5640 aggcaggcgg aggaggctga tgaacaagcc aatgctcatc tcaccaagtt ccgaaaagct 5700 cagcatgagc tcgaggaggc tgaagaacgg gctgatatcg ccgaatctca ggtcaataag 5760 cttcgcgcaa agacccgaga cttcacctcc agccggatgg tggtccatga gagcgaagag 5820 tga 5823 <210> 2 <211> 12238 <212> DNA <213> Artificial Sequence <220> <223> CAGGS-MYH3-Flag vector <400> 2 gtcgacattg attattgact agttattaat agtaatcaat tacggggtca ttagttcata 60 gcccatatat ggagttccgc gttacataac ttacggtaaa tggcccgcct ggctgaccgc 120 ccaacgaccc ccgcccattg acgtcaataa tgacgtatgt tcccatagta acgccaatag 180 ggactttcca ttgacgtcaa tgggtggact atttacggta aactgcccac ttggcagtac 240 atcaagtgta tcatatgcca agtacgcccc ctattgacgt caatgacggt aaatggcccg 300 cctggcatta tgcccagtac atgaccttat gggactttcc tacttggcag tacatctacg 360 tattagtcat cgctattacc atgggtcgag gtgagcccca cgttctgctt cactctcccc 420 atctcccccc cctccccacc cccaattttg tatttattta ttttttaatt attttgtgca 480 gcgatggggg cggggggggg gggggcgcgc gccaggcggg gcggggcggg gcgaggggcg 540 gggcggggcg aggcggagag gtgcggcggc agccaatcag agcggcgcgc tccgaaagtt 600 tccttttatg gcgaggcggc ggcggcggcg gccctataaa aagcgaagcg cgcggcgggc 660 gggagtcgct gcgttgcctt cgccccgtgc cccgctccgc gccgcctcgc gccgcccgcc 720 ccggctctga ctgaccgcgt tactcccaca ggtgagcggg cgggacggcc cttctcctcc 780 gggctgtaat tagcgcttgg tttaatgacg gctcgtttct tttctgtggc tgcgtgaaag 840 ccttaaaggg ctccgggagg gccctttgtg cgggggggag cggctcgggg ggtgcgtgcg 900 tgtgtgtgtg cgtggggagc gccgcgtgcg gcccgcgctg cccggcggct gtgagcgctg 960 cgggcgcggc gcggggcttt gtgcgctccg cgtgtgcgcg aggggagcgc ggccgggggc 1020 ggtgccccgc ggtgcggggg ggctgcgagg ggaacaaagg ctgcgtgcgg ggtgtgtgcg 1080 tgggggggtg agcagggggt gtgggcgcgg cggtcgggct gtaacccccc cctgcacccc 1140 cctccccgag ttgctgagca cggcccggct tcgggtgcgg ggctccgtgc ggggcgtggc 1200 gcggggctcg ccgtgccggg cggggggtgg cggcaggtgg gggtgccggg cggggcgggg 1260 ccgcctcggg ccggggaggg ctcgggggag gggcgcggcg gccccggagc gccggcggct 1320 gtcgaggcgc ggcgagccgc agccattgcc ttttatggta atcgtgcgag agggcgcagg 1380 gacttccttt gtcccaaatc tggcggagcc gaaatctggg aggcgccgcc gcaccccctc 1440 tagcgggcgc gggcgaagcg gtgcggcgcc ggcaggaagg aaatgggcgg ggagggcctt 1500 cgtgcgtcgc cgcgccgccg tccccttctc catctccagc ctcggggctg ccgcaggggg 1560 acggctgcct tcggggggga cggggcaggg cggggttcgg cttctggcgt gtgaccggcg 1620 gctctagagc caccatgagc agcgacactg aaatggaagt gttcggcata gccgctccct 1680 tcctccgcaa gtcggaaaag gagaggatcg aggcgcagaa ccagcccttc gatgccaaaa 1740 cctactgctt cgtggtcgac tcgaaggaag agtacgccaa ggggaaaatt aagagcaccc 1800 aggatgggaa ggtcacggtg gagaccgaag acaacaggac cctggtggtg aagccggagg 1860 atgtgtatgc catgaacccc cccaagtttg accggatcga ggacatggcc atgctgacgc 1920 acctgaacga gccggccgtg ctgtacaacc tcaaggaccg gtacacctcc tggatgatct 1980 atacctactc gggcctcttc tgtgtcaccg tcaaccccta caagtggctg ccggtgtaca 2040 accccgaggt ggtggagggc taccgaggca aaaagcgcca ggaggccccg ccccacatct 2100 tctccatctc cgacaacgcc tatcagttca tgttgacaga tcgtgaaaac cagtccattc 2160 tgatcaccgg agaatccggg gcgggaaaga ctgtgaacac caagagggtc atccagtact 2220 ttgcaacaat tgctgccact ggggacctcg ccaagaagaa ggactccaag atgaagggga 2280 ctctggagga ccagatcatc agcgccaacc cgctgctgga ggccttcggc aacgccaaga 2340 ccgtgaggaa cgacaactcg tcccgcttcg gcaagttcat ccgaatccat tttggtacca 2400 ccgggaagct ggcctccgca gacatcgaaa catatctgct cgaaaaatcg agagtgacct 2460 tccagctgaa ggctgagagg agctaccaca tcttctacca gattctctcc aacaagaagc 2520 cggagctcat agagctgctg ctcattacaa ccaacccctt cgactacccg ttcatcagcc 2580 agggcgagat cctcgtggcc agcattgatg atgccgagga gctgctagcc acggatagtg 2640 ccatcgacat cctgggcttc accccagagg agaaatctgg actctacaag ctgacgggcg 2700 ccgtgatgca ctacgggaac atgaagttca agcagaagca acgggaggag caggagagc 2760 cggacggcac ggaagtggct gacaagacag cctacctcat gggcctgaac tcttcggacc 2820 tcctgaaggc tttgtgcttc cccagagtca aagttgggaa cgagtatgtt accaagggcc 2880 agaccgtgga tcaggtgcac cacgcggtga acgcactctc caaatccgtc tacgagaagc 2940 tcttcctgtg gatggtcacc cgcatcaacc agcagctgga caccaagctg cccaggcagc 3000 acttcatcgg cgtcttggac atcgcgggct ttgagatctt tgagtataac agcctggagc 3060 agctgtgcat caacttcacc aacgagaaac tgcaacagtt tttcaaccac cacatgttcg 3120 tgctggagca ggaggagtac aagaaggaag gcatcgagtg gacgttcatc gacttcggga 3180 tggacctggc cgcctgcatc gagctcatcg agaagcccat gggcatcttc tccatcctgg 3240 aggaggagtg catgttcccc aaggccacag acacctcctt caagaacaag ctctatgacc 3300 agcacctggg caagtctgcc aacttccaga agcccaaggt gctcaagggc agggccgagg 3360 cccacttctc cctgatccac tacgcgggca ccgtggacta cagtgtctcg ggctggctgg 3420 agaagaacaa ggaccccctg aacgagacgg tggtcgggct gtaccagaag tcctccaacc 3480 ggctcctggc gcacctctac gcgaccttcg ccacggccga cgctgacagc ggaaagaaga 3540 aagttgccaa gaaaaagggt tcttccttcc aaaccgtctc tgcccttttc agggaaaacc 3600 tgaacaagct gatgtcgaat ttaaggacga ctcaccctca ctttgtgcgc tgtatcattc 3660 ccaatgaaac caaaacccca ggggccatgg aacatagcct ggtcctgcac cagctgaggt 3720 gtaacggcgt gctggagggc atccgcatct gcaggaaggg cttccccaat cggatcctct 3780 acggggattt taaacaaaga taccgcgtgc tgaatgccag cgccatcccc gagggacagt 3840 tcatcgacag caagaaggcg tgtgaaaagc tgttggcgtc catcgatatt gaccacactc 3900 agtacaaatt cggacacacc aaggtgttct tcaaggccgg cttgctggga accctggagg 3960 aaatgcggga cgaccgcctg gccaagctca tcacccggac gcaagccgtg tgcaggggct 4020 tcctcatgcg cgtggaattc cagaagatgg tgcagagaag ggagtccatc ttctgcatcc 4080 agtacaacat ccgagccttc atgaacgtca agcactggcc ctggatgaaa ctcttcttca 4140 agatcaagcc tctgctgaag agcgcagaga ccgagaagga gatggccacc atgaaggag 4200 agttccagaa aaccaaggag gaactcgcca agtcagaggc aaagaggaag gaactggagg 4260 aaaagatggt gactctggta caagagaaga acgacctgca gctccaagta caagctgaaa 4320 gtgaaaactt gttggatgca gaggaaagat gtgaccagct gatcaaagcc aagtttcagc 4380 tggaggccaa aatcaaggag gtgactgaga gagctgagga tgaggaagag atcaatgccg 4440 agctgacggc caagaagagg aaactggagg atgagtgctc agaactgaag aaagacatcg 4500 atgaccttga gctgacactg gccaaggttg aaaaggagaa acatgccaca gagaacaagg 4560 ttaaaaacct tactgaggaa ctggccggct tggatgaaac cattgcgaag ttgaccaggg 4620 agaagaaggc cctccaggag gcccaccagc agaccctgga tgacctccaa gctgaagagg 4680 acaaagtcaa ctccttaagc aaaatcaaga gcaaactgga acagcaggtg gacgatctgg 4740 aaagctccct agaacaagag aagaagctcc gggtcgacct ggaaaggaat aaaaggaagc 4800 ttgagggtga cttgaagctt gcccaggagt ccatactgga tctggagaat gacaagcaac 4860 agctggatga aaggctcaag aagaaggatt ttgagtccag tcagctgcag agcaaagtgg 4920 aagatgagca gaccctgggc ctccagtttc agaagaaaat taaagagctc caggctcgaa 4980 tcgaggagct ggaggaagag attgaggccg agagggccac ccgcgccaag acggagaagc 5040 agcgcagcga ctacgcccgg gagctggagg agctgagcga gcggctggag gaggcggggg 5100 gcgtcacatc cacgcagatc gagctgaaca agaagcgcga ggccgagttc ctgaagctgc 5160 gccgggacct ggaggaggcc accctgcagc acgaggccac agtggctgcg ctgaggaaga 5220 agcacgcgga cagcgtggct gagctggggg agcagatcga caacctgcag agggtcaagc 5280 agaagctgga gaaggagaag agcgaattca agctggagct ggacgacctg gccggcaacg 5340 tggagagcgt gtccaaggcg aaggccaacc tggaaaaaat ctgccgcacc ctggaggatc 5400 agctaagcga ggccaggggc aagaacgagg aaatccagag gagcatgagc gagctgacca 5460 tgcagaagtc ccgtcttcag acggaggccg gtgagctgag tcgtcaactc gaagagaaag 5520 agagcacagt atcacagctt tccagaagca agcaagcgtt tacccagcaa atagaagagc 5580 tcaagaggca gctggaggag gagagcaagg ccaagaacgc cctggcgcac gccctgcagt 5640 cctcccgcca cgactgcgac ctgctgcggg aacagtatga ggaggagcag gaagccaagg 5700 ccgagctgca gagggcgctg tccaaggcca acagcgaggt tgcccagtgg aggaccaagt 5760 acgagacgga cgccatccag cgcacggagg agctggagga ggccaagaaa aagcttgctc 5820 agcgccttca ggattccgag gagcaggtgg aggcagtgaa cgccaagtgt gcctccctgg 5880 agaagaccaa gcagaggctg caagcggagg tggaggacct gatggtggac gtggacagag 5940 ccaactctct ggctgctgcg ctggacaaga agcagagaaa cttcgacaag gtgctcgccg 6000 agtggaaaac aaagtgtgag gagagccagg cagagctgga ggcagctctg aaggaatccc 6060 gctccttgag caccgagctc ttcaagctga aaaatgccta cgaagaagcc ttagatcaac 6120 ttgaaactgt gaagcgagaa aataagaact tggagcagga gatagcagat ctcacagaac 6180 aaattgctga gaacggtaaa accatccatg aactggagaa atcaagaaag cagatcgagc 6240 tggagaaggc tgatatccag ctggctcttg aggaagcaga ggccgccctt gagcacgaag 6300 aggccaagat cctccgaatc cagctggaac tgacccaggt gaaatcggaa atcgacagga 6360 agatggctga gaaagacgaa gagatcgagc agctcaagag gaactaccag agaaccgtgg 6420 agacgatgca gagcgccttg gacgccgagg tgcggagccg caacgaggcc atcaggatca 6480 agaagaagat ggagggggac ctgaacgaga tcgagatcca gctgagccac gccaaccgcc 6540 aggccgcgga gaccctcaaa cacctccggg gcgtccaagg acagctgaag gacacccagc 6600 tccacctgga cgacgctctc cgaggccagg aggacctgaa ggagcagctg gccatcgtgg 6660 agcgcagagc cagcctgctg caggccgagg tggaggagct gcgggcctcc ctggagcaga 6720 cggagagggc ccggaaactg gcagagcagg agctcctgga cgccaacgag agggtgcagc 6780 tgctccacac ccagaacacc agcctcatcc acaccaagaa gaagctggag acggacctga 6840 tgcagctcca gagcgaggtc gaggacgcca gcagggatgc gaggaacgcc gaggagaagg 6900 cgaagaaggc caccaccgac gcggccatga tggccgagga gctgaagaag gagcaggaca 6960 ccagcgccca cctggagcgg atgaagaaga acctggagca gacggtgaag gacctgcagc 7020 accgcctgga cgaggcggaa cagttggccc tgaagggcgg gaagaagcag atccagaagc 7080 tggaggccag aatccgagag ctggagtttg agcttgaggg ggagcagaag aagaacacgg 7140 agtctgtcaa gggcctcagg aaatacgagc ggcgggtcaa ggagttaact taccagagtg 7200 aagaggacag gaagaatgtg ctgagattac aggacctggt ggacaaactt caagcgaagg 7260 tcaagtccta caagaggcag gcggaggagg ctgatgaaca agccaatgct catctcacca 7320 agttccgaaa agctcagcat gagctcgagg aggctgaaga acgggctgat atcgccgaat 7380 ctcaggtcaa taagcttcgc gcaaagaccc gagacttcac ctccagccgg atggtggtcc 7440 atgagagcga agaggattac aaggatgacg acgataagtg agaattcact cctcaggtgc 7500 aggctgccta tcagaaggtg gtggctggtg tggccaatgc cctggctcac aaataccact 7560 gagatctttt tccctctgcc aaaaattatg gggacatcat gaagcccctt gagcatctga 7620 cttctggcta ataaaggaaa tttattttca ttgcaatagt gtgttggaat tttttgtgtc 7680 tctcactcgg aaggacatat gggagggcaa atcatttaaa acatcagaat gagtatttgg 7740 tttagagttt ggcaacatat gccatatgct ggctgccatg aacaaaggtg gctataaaga 7800 ggtcatcagt atatgaaaca gccccctgct gtccattcct tattccatag aaaagccttg 7860 acttgaggtt agattttttt tatattttgt tttgtgttat ttttttcttt aacatcccta 7920 aaattttcct tacatgtttt actagccaga tttttcctcc tctcctgact actcccagtc 7980 atagctgtcc ctcttctctt atgaagatcc ctcgacctgc agttggggtt gcgccttttc 8040 caaggcagcc ctgggtttgc gcagggacgc ggctgctctg ggcgtggttc cgggaaacgc 8100 agcggcgccg accctgggtc tcgcacattc ttcacgtccg ttcgcagcgt cacccggatc 8160 ttcgccgcta cccttgtggg ccccccggcg acgcttcctg ctccgcccct aagtcgggaa 8220 gt; accctcgcag acggacagcg ccagggagca atggcagcgc gccgaccgcg atgggctgtg 8340 gccaatagcg gctgctcagc agggcgcgcc gagagcagcg gccgggaagg ggcggtgcgg 8400 gaggcggggt gtggggcggt agtgtgggcc ctgttcctgc ccgcgcggtg ttccgcattc 8460 tgcaagcctc cggagcgcac gtcggcagtc ggctccctcg ttgaccgaat caccgacctc 8520 tctccccagg gggatccacc ggagcttacc atgaccgagt acaagcccac ggtgcgcctc 8580 gccacccgcg acgacgtccc cagggccgta cgcaccctcg ccgccgcgtt cgccgactac 8640 cccgccacgc gccacaccgt cgatccggac cgccacatcg agcgggtcac cgagctgcaa 8700 gaactcttcc tcacgcgcgt cgggctcgac atcggcaagg tgtgggtcgc ggacgacggc 8760 gccgcggtgg cggtctggac cacgccggag agcgtcgaag cgggggcggt gttcgccgag 8820 atcggcccgc gcatggccga gttgagcggt tcccggctgg ccgcgcagca acagatggaa 8880 ggcctcctgg cgccgcaccg gcccaaggag cccgcgtggt tcctggccac cgtcggcgtc 8940 tcgcccgacc accagggcaa gggtctgggc agcgccgtcg tgctccccgg agtggaggcg 9000 gccgagcgcg ccggggtgcc cgccttcctg gagacctccg cgccccgcaa cctccccttc 9060 tacgagcggc tcggcttcac cgtcaccgcc gacgtcgagg tgcccgaagg accgcgcacc 9120 tggtgcatga cccgcaagcc cggtgcctga cgcccgcccc acgacccgca gcgcccgacc 9180 gaaaggagcg cacgacccca tgcatcggta cctttaagac caatgactta caaggcagct 9240 gtagatctta gccacttttt aaaagaaaag gggggactgg aagggctaat tcactcccaa 9300 cgaagacaag atctgctttt tgcttgtact gggtctctct ggttagacca gatctgagcc 9360 tgggagctct ctggctaact agggaaccca ctgcttaagc ctcaataaag cttgccttga 9420 gtgcttcaag tagtgtgtgc ccgtctgttg tgtgactctg gtaactagag atccctcaga 9480 cccttttagt cagtgtggaa aatctctagc agtagtagtt catgtcatct tattattcag 9540 tatttataac ttgcaaagaa atgaatatca gagagtgaga ggaacttgtt tattgcagct 9600 tataatggtt acaaataaag caatagcatc acaaatttca caaataaagc atttttttca 9660 ctgcattcta gttgtggttt gtccaaactc atcaatgtat cttatcatgt ctgctgcagc 9720 ccaagcttgg cgtaatcatg gtcatagctg tttcctgtgt gaaattgtta tccgctcaca 9780 attccacaca acatacgagc cggaagcata aagtgtaaag cctggggtgc ctaatgagtg 9840 agctaactca cattaattgc gttgcgctca ctgcccgctt tccagtcggg aaacctgtcg 9900 tgccagcgga tccgcatctc aattagtcag caaccatagt cccgccccta actccgccca 9960 tcccgcccct aactccgccc agttccgccc attctccgcc ccatggctga ctaatttttt 10020 ttatttatgc agaggccgag gccgcctcgg cctctgagct attccagaag tagtgaggag 10080 gcttttttgg aggcctaggc ttttgcaaaa agctaacttg tttattgcag cttataatgg 10140 ttacaaataa agcaatagca tcacaaattt cacaaataaa gcattttttt cactgcattc 10200 tagttgtggt ttgtccaaac tcatcaatgt atcttatcat gtctggatcc gctgcattaa 10260 tgaatcggcc aacgcgcggg gagaggcggt ttgcgtattg ggcgctcttc cgcttcctcg 10320 ctcactgact cgctgcgctc ggtcgttcgg ctgcggcgag cggtatcagc tcactcaaag 10380 gcggtaatac ggttatccac agaatcaggg gataacgcag gaaagaacat gtgagcaaaa 10440 ggccagcaaa aggccaggaa ccgtaaaaag gccgcgttgc tggcgttttt ccataggctc 10500 cgcccccctg acgagcatca caaaaatcga cgctcaagtc agaggtggcg aaacccgaca 10560 ggactataaa gataccaggc gtttccccct ggaagctccc tcgtgcgctc tcctgttccg 10620 accctgccgc ttaccggata cctgtccgcc tttctccctt cgggaagcgt ggcgctttct 10680 caatgctcac gctgtaggta tctcagttcg gtgtaggtcg ttcgctccaa gctgggctgt 10740 gtgcacgaac cccccgttca gcccgaccgc tgcgccttat ccggtaacta tcgtcttgag 10800 tccaacccgg taagacacga cttatcgcca ctggcagcag ccactggtaa caggattagc 10860 agagcgaggt atgtaggcgg tgctacagag ttcttgaagt ggtggcctaa ctacggctac 10920 actagaagga cagtatttgg tatctgcgct ctgctgaagc cagttacctt cggaaaaaga 10980 gttggtagct cttgatccgg caaacaaacc accgctggta gcggtggttt ttttgtttgc 11040 aagcagcaga ttacgcgcag aaaaaaagga tctcaagaag atcctttgat cttttctacg 11100 gggtctgacg ctcagtggaa cgaaaactca cgttaaggga ttttggtcat gagattatca 11160 aaaaggatct tcacctagat ccttttaaat taaaaatgaa gttttaaatc aatctaaagt 11220 atatatgagt aaacttggtc tgacagttac caatgcttaa tcagtgaggc acctatctca 11280 gcgatctgtc tatttcgttc atccatagtt gcctgactcc ccgtcgtgta gataactacg 11340 atacgggagg gcttaccatc tggccccagt gctgcaatga taccgcgaga cccacgctca 11400 ccggctccag atttatcagc aataaaccag ccagccggaa gggccgagcg cagaagtggt 11460 cctgcaactt tatccgcctc catccagtct attaattgtt gccgggaagc tagagtaagt 11520 agttcgccag ttaatagttt gcgcaacgtt gttgccattg ctacaggcat cgtggtgtca 11580 cgctcgtcgt ttggtatggc ttcattcagc tccggttccc aacgatcaag gcgagttaca 11640 tgatccccca tgttgtgcaa aaaagcggtt agctccttcg gtcctccgat cgttgtcaga 11700 agtaagttgg ccgcagtgtt atcactcatg gttatggcag cactgcataa ttctcttact 11760 gtcatgccat ccgtaagatg cttttctgtg actggtgagt actcaaccaa gtcattctga 11820 gaatagtgta tgcggcgacc gagttgctct tgcccggcgt caatacggga taataccgcg 11880 ccacatagca gaactttaaa agtgctcatc attggaaaac gttcttcggg gcgaaaactc 11940 tcaaggatct taccgctgtt gagatccagt tcgatgtaac ccactcgtgc acccaactga 12000 tcttcagcat cttttacttt caccagcgtt tctgggtgag caaaaacagg aaggcaaaat 12060 gccgcaaaaa agggaataag ggcgacacgg aaatgttgaa tactcatact cttccttttt 12120 caatattatt gaagcattta tcagggttat tgtctcatga gcggatacat atttgaatgt 12180 atttagaaaa ataaacaaat aggggttccg cgcacatttc cccgaaaagt gccacctg 12238 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> pMYH3 F-primer <400> 3 aaaagctcag catgagctcg a 21 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> pMYH3 R-primer <400> 4 agggtcagga accatgaaaa t 21 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> pMYH1 F-primer <400> 5 gttctgaaga gggtggtac 19 <210> 6 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> pMYH1 R-primer <400> 6 agatgcggat gccctcca 18 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> pMYH2 F-primer <400> 7 gggctcaaac tggtgaagc 19 <210> 8 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> pMYH2 R-primer <400> 8 agatgcggat gccctcca 18 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> pMYH13 F-primer <400> 9 cacagggctc tggccgacat 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> pMYH13 R-primer <400> 10 cgtgcgcaca ggggtgtagt 20 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> pADPRM F-primer <400> 11 catcctgaga ccgtgccttc a 21 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> pADPRM R-primer <400> 12 ttccgcattt gggttgtgct 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> pSCO1 F-primer <400> 13 tcctcacgga ctcggggttt 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> pSCO1 R-primer <400> 14 gtggggtctc tgctgccctt 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> pTMEM220 F-primer <400> 15 cccagacgca gaactgtggg 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> pTMEM220 R-primer <400> 16 gttgtatgcc aagccggcag 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> pENSSSCG00000029441 F-primer <400> 17 tcgtgctgga gcaggaggag 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > pENSSSCG00000029441 R-primer <400> 18 aggtgtctgt ggccttgggg 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> pENSSSCG00000018006 F-primer <400> 19 agaaccagcc cttcgatgcc 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> pENSSSCG00000018006 R-primer <400> 20 tggcatacac atcctccggc 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> pGAPDH F-primer <400> 21 gggcatgaac catgagaagt 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> pGAPDH R-primer <400> 22 gggcatgaac catgagaagt 20 <210> 23 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> pMYH3 F-primer <400> 23 ccgagagctg gagtttga 18 <210> 24 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> pMYH3 R-primer <400> 24 ctcccatatg tccttccgag t 21 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Myh7 F-primer <400> 25 agtcccaggt caacaagctg 20 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Myh7 R-primer <400> 26 ttccacctaa agggctgttg 20 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Myh2 F-primer <400> 27 agtcccaggt caacaagctg 20 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Myh2 R-primer <400> 28 gcatgaccaa aggtttcaca 20 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Myh1 F-primer <400> 29 agtcccaggt caacaagctg 20 <210> 30 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Myh1 R-primer <400> 30 cacattttgc tcatctcttt g 21 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Myh4 F-primer <400> 31 agtcccaggt caacaagctg 20 <210> 32 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Myh4 R-primer <400> 32 tttctcctgt cacctctcaa ca 22 <210> 33 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Myoglobin F-primer <400> 33 gcaaggccct ggagctcttc 20 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Myoglobin R-primer <400> 34 gcttggtggg ctggacagtg 20 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Tnnt1 F-primer <400> 35 cccccgaaga ttccagaagg 20 <210> 36 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Tnnt1 R-primer <400> 36 tgcggtcttt tagtgcaatg ag 22 <210> 37 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Tnni1 F-primer <400> 37 atgccggaag ttgagaggaa a 21 <210> 38 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Tnni1 R-primer <400> 38 tccgagaggt aacgcacctt 20 <210> 39 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Tnnc1 F-primer <400> 39 gcggtagaac agttgacaga g 21 <210> 40 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Tnnc1 R-primer <400> 40 ccagctcctt ggtgctgat 19 <210> 41 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Aldoa F-primer <400> 41 actctctgct gaccgggctc t 21 <210> 42 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Aldoa R-primer <400> 42 aatgcttccg gtggactcat 20 <210> 43 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Pvalb F-primer <400> 43 atcaagaagg cgataggagc c 21 <210> 44 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Pvalb R-primer <400> 44 ggccagaagc gtctttgtt 19 <210> 45 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Tnnt3 F-primer <400> 45 ggaacgccag aacagattgg 20 <210> 46 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Tnnt3 R-primer <400> 46 tggaggacag agcctttttc tt 22 <210> 47 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Tnni2 F-primer <400> 47 agagtgtgat gctccagata gc 22 <210> 48 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Tnni2 R-primer <400> 48 agcaacgtcg atcttcgca 19 <210> 49 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Tnnc2 F-primer <400> 49 atggcagcgg tactatcgac t 21 <210> 50 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Tnnc2 R-primer <400> 50 ccttcgcatc ctctttcatc tg 22 <210> 51 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GAPDH F-primer <400> 51 gaagggcatc ttgggctaca c 21 <210> 52 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> GAPDH R-primer <400> 52 gcagcgaact ttattgatgg tatt 24 <210> 53 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> CD36 F-primer <400> 53 aatggcacag acgcagcct 19 <210> 54 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> CD36 R-primer <400> 54 ggttgtctgg attctgga 18 <210> 55 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LPL F-primer <400> 55 gtacctgaag actcgctctc 20 <210> 56 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LPL R-primer <400> 56 agggtgaagg gaatgttctc 20 <210> 57 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Fabp4 F-primer <400> 57 gatgcctttg tgggaacctg 20 <210> 58 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Fabp4 R-primer <400> 58 tcctgtcgtc tgcggtgatt 20 <210> 59 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Fto F-primer <400> 59 gtcagagaga aggccaatga 20 <210> 60 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Fto R-primer <400> 60 tagcagtctc cctggtgaag 20 <210> 61 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Pgc1 alpha F-primer <400> 61 ccctgccatt gttaagacc 19 <210> 62 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Pgc1 alpha R-primer <400> 62 tgctgctgtt cctgttttc 19 <210> 63 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Adiponectin F-primer <400> 63 aatggcacac caggccgtga t 21 <210> 64 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Adiponectin R-primer <400> 64 tctccaggct ctcctttcct g 21 <210> 65 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> MYH3 variation F-primer <400> 65 tggtctttcc taattggtga cat 23 <210> 66 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> MYH3 variation R-primer <400> 66 agttttgagc aaggcttttg tt 22

Claims (8)

A recombinant vector for enhancing intramuscular fat content or meat color red, comprising the MYH3 gene consisting of the nucleotide sequence of SEQ ID NO: 1.
delete delete 2. The vector of claim 1, wherein said vector comprises a CAGGS promoter.
A composition capable of measuring the expression level of mRNA or protein of MYH3 gene.
6. The composition of claim 5, wherein the agent is a primer or a probe that specifically binds to the mRNA.
7. The composition according to claim 6, wherein the primer is a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NOs: 23 and 24.
6. The composition of claim 5, wherein the agent is an antibody or a probe that specifically binds to the protein.

Images