KR101900390B1 - Composition for enhancing terpene biosynthesis in plant - Google Patents

Abstract

A composition for promoting plant terpene biosynthesis comprising a terpene synthase gene, an HMG-CoA reductase gene and a biotin carboxyl carrier protein (BCCP1) gene, and a gene for promoting plant terpene biosynthesis The present invention can be used to produce terpenes in a high yield.

Description

TECHNICAL FIELD The present invention relates to a composition for enhancing plant terpene biosynthesis,

The present invention relates to a plant comprising a 3-hydroxy-3-methylglutaryl-coenzyme A reductase (HMG-CoA reductase) HMGR gene and a biotin carboxyl carrier protein 1 (BCCP1) gene together with a terpene synthase (TPS) The present invention relates to a terpene biosynthesis accelerating composition and a method for promoting plant terpene biosynthesis using the gene, and may be useful in the field of plant molecular breeding by promoting terpene biosynthesis.

The problem of improving plant productivity due to environmental degradation and population growth is becoming the most important issue. Thus, in recent years, efforts have been made to increase crop yield and biomass using molecular breeding techniques, while increasing crop yield through traditional breeding. In other words, in order to improve the photosynthesis efficiency of plants in agriculture and forestry, recombinant nucleic acid molecules manipulated with genes related to photosynthesis have been partially introduced and introduced into plants, and this approach is not limited to one plant species It is also applicable to plant species.

On the other hand, terpene or isopropenide is a substance group in which plants and microorganisms synthesize and synthesize isoprene units and exudes out of the body, and constitutes molecules essential for photosynthesis of plants such as carotenoids and chlorophyll side chains, It plays an important role in the cell physiology of plants such as plant hormones Abscisic acid and gibberellin. It also carries out chemical communication between plants and insects. In addition to menthol and menthol, such as (-) - α-bisabolol and pinene, It is used as an important drug such as artemisinin and taxol. Terpenes are classified according to the number of constituent isoprene units (C ₅ ). Sesequiterpenes (C ₅ × 3 units) and triterpenes (C ₅ × 6) are mainly produced in the cytoplasm of plants. Their precursor isoprene units are mainly supplied via the mevalonic acid pathway present in the cytoplasm 2-C-methyl-D-erythritol-4-phosphate, which mainly supplies isoprene units to plastids; MEP) pathways. The source of the mevalonic acid pathway is acetyl-CoA derived from citric acid by the isocitrate degrading enzyme in the cytoplasm. Unlike the mevalonic acid pathway present in cytoplasm, monoterpene (C ₅ × 2), diterpene (C ₅ × 4), and tetra terpene (C ₅ × 8) are photosynthetic products of pyruvic acid and glyceraldehyde- It is known to be composed of isoprene units supplied by the MEP pathway derived from phosphoric acid. Glyceraldehyde-3-phosphate is converted to acetyl-CoA by pyruvate dehydrogenase (PDH) via pyruvic acid and then converted to malonyl-CoA by acetyl-CoA carboxylating enzyme (ACC). In plants, the chromosome ACC consists of a subunit of biotin carboxyl carrier protein 1 (BCCP1), a biotin carboxylase (BC) and a carboxyl transferase (CT), and overexpresses these subunit genes, particularly BCCP1 Or complementary sequence RNA, the activity of ACC of the plant is decreased, but it is known that there is no significant change in phenotype of the overexpressing plant.

These terpenes have traditionally been extracted from plants and have been used recently, but with the development of synthetic biology / metabolism engineering, it has become possible to commercially produce terpenes by biotechnological techniques by transplanting the terpene gene of a plant into E. coli or yeast. In the case of accumulating terpenes through molecular breeding in a plant that accumulates specific terpenes, it is already commercially available in the case of dogsugury mugwort. However, the production of terpenes by transplanting genes into other plants is necessary for the accumulation place of terpenes and the synthesis of terpenes The supply of the metabolites, the toxicity of the terpene and the terpene precursor are not solved and the high yield has not yet been achieved. In general, it has been reported that in order to enhance terpene biosynthesis in the cytoplasm, the yield of terpene can be increased by overexpressing HMG-CoA reductase, which is a limiting factor of mevalonic acid pathway, to activate the mevalonic acid pathway. However, it is known that the overproduction of HMG-CoA reductase, which is a rate-regulating enzyme in the mevalonic acid pathway, is far less than the overexpression of HMG-CoA reductase in the accumulation of terpene.

Other strategies include overexpression of terpene synthase (TPS) in the cytoplasm or the plastid. (FPS) or / and GGPS (geranylgeranyl diphosphate), which directly provide a sesquiterpene precursor, after the production of isopentenyl diphosphate (IPP), are overexpressed in the corresponding cytoplasm or plastid, The strategy of using expression promoters is to increase the production of terpenes.

In order to expand the source of acetyl-CoA introduced into the cytoplasmic mevalonate pathway, the precursor of acetyl-CoA or isethyl-CoA is prevented from being consumed in the pigment, ultimately activating the substance flow to the mevalonate pathway in the cytoplasm .

The present invention aims to provide a composition for promoting plant terpene biosynthesis comprising a target terpene synthase gene and an HMG-CoA reductase (HMGR) gene and a BCCP1 (biotin carboxyl carrier protein) gene.

Still another object of the present invention is to provide a method for promoting plant terpene biosynthesis comprising the step of introducing a terpene synthase gene, a HMG-CoA reductase (HMGR) gene and a BCCP1 (biotin carboxyl carrier protein) .

In order to accelerate the flow of substances in the terpene biosynthetic pathway, IPP synthesis pathway and overexpression of its downstream gene have been conventionally used together with the terpene synthase gene. However, the present invention is based on the fact that acetyl-CoA, which is a precursor of the IPP biosynthesis pathway, Suggesting ways to activate the flow of metabolites that are supplied.

Hereinafter, the present invention will be described in more detail.

In one example of the present invention, there is provided a composition for promoting plant terpene biosynthesis comprising a terpene synthase gene, an HMG-CoA reductase gene and a BCCP1 (biotin carboxyl carrier protein) gene.

The terpene synthase gene is not particularly limited and includes, for example, a monoterpene synthase gene derived from a plant or a microorganism, a sesquiterpene synthase gene, a diterpene synthase gene, a triterpene synthase gene, a tetra terpene synthase gene And may be, for example, (-) -? - bisabolol synthetic gene (BBS) consisting of the nucleotide sequence of Genbank SEQ ID NO: KJ020282, but is not limited thereto. The composition may contain a transformant vector into which a promoter is inserted to overexpress the terpene synthase gene or a microorganism transformed with the transformed vector.

 The HMG-CoA reductase gene is not particularly limited and may be derived, for example, from a yeast or a plant. For example, the HMG-CoA reductase gene may be composed of a nucleotide sequence of SEQ ID NO: Genbank NM_001182434 or may contain a modified gene such as truncated HMGR or tHMGR But is not limited thereto. The composition may contain an HMG-CoA reductase gene, a transformant vector into which a promoter is inserted to overexpress the HMG-CoA reductase gene, or a microorganism transformed with the transformed vector.

The BCCP1 gene is not particularly limited and may be derived from Arabidopsis thaliana. For example, it may be a gene consisting of a nucleotide sequence of SEQ ID NO: Genbank AT5G16390, but is not limited thereto. In addition, the composition may contain a transformant vector into which a promoter is inserted to overexpress the base sequence or a microorganism transformed with the transformed vector.

The composition of the present invention activates the mevalonic acid pathway by overexpression of the HMG-CoA reductase gene and at the same time lowers the consumption of acetyl-CoA in the plastidium to expand the source of acetyl-CoA, which is the source of the mevalonic acid pathway used for terpene biosynthesis in the cytoplasm It was confirmed that the terpene biosynthesis promoting effect was remarkably superior to the composition comprising the terpene synthetic gene, the HMG-CoA reductase gene and the BCCP1 gene alone. As an example of the recombinant gene used in the present invention, it includes the nucleotide sequence of tHMGR-2A-BCCP1 consisting of the sequence of SEQ ID NO: 1. The sequence 1 to 1506 of SEQ ID NO: 1 is a tHMGR gene sequence, the sequence 1507 to 1572 of SEQ ID NO: 1 is a 2A cut sequence (66bp) derived from foot-and-mouth disease virus, and the sequence 1573 to 2412 of SEQ ID NO: BCCP1 gene sequence.

In the present invention, 'overexpression' means that the plant native or foreign terpene synthase gene, HMG-CoA reductase gene and / or BCCP1 gene is expressed at a level higher than that expressed in a wild-type plant. And can be carried out, for example, by mutating or introducing a ribosome binding site or promoter and regulatory region located in the upstream stream from the structural gene to increase the number of copies of the appropriate gene, Expression cassettes into which an upstream stream from the structural gene has been introduced can act in the same manner. Methods of extending the life of mRNA may also increase expression. The gene may also be over-expressed by changing the composition of the medium and / or the culture technique.

In the present invention, the term 'transformation' refers to a molecular biologic phenomenon in which a DNA chain or plasmid having a different kind of gene from that of the original cell is bound to DNA originally present in the cell, . In particular, in the present invention, transformation means that a specific gene is inserted into a plant body. The method of expressing the transgene is not limited to the present invention, and the expression period may also be constant expression, temporary expression, or expression of the condition.

In the present invention, the 'plant' is not limited to a plant which can be transformed by insertion of the terpene synthase gene, the HMG-CoA reductase gene, and / or the BCCP1 gene sequence, but preferably includes rice, maize, wheat, oats, Ornamental plants such as tobacco, spotted caterpillars, caterpillars, caterpillars, caterpillars, radishes, radishes, pumpkins, green beans, sunflowers , Dyes such as red bean, cherry tree, persimmon, morning glory, dandelion, pepper, Chinese cabbage, red pepper, poplar, apple, potato, sweet potato, spinach, pea, sweetpotato, pear, chrysanthemum, and cyanobacteria, ), Single-cell photosynthetic bacteria such as Hwangseobyeon, Hwangseobyeon, and red (non-yellow) bacteria, and eukaryotic photosynthetic algae such as chlorella, Chlamydomonas, protosiphon, Tetracystis, And chlorococcum. ≪ Desc / Clms Page number 2 >

The plant may be a whole plant, a specific organ, or a specific tissue, for example, a root, epidermal cell or glandular trichome of a plant, preferably a epidermal cell. When the overexpression of the terpene synthase gene, HMG-CoA reductase gene and / or BCCP1 gene sequence is over-expressed in whole plants (systemic expression), the yield of promoting biosynthesis is excellent, and the expression / overexpression , The terpene biosynthetic intermediate or final product due to gene overexpression is markedly low in toxicity to the production plant or is not toxic. When terpenes are biosynthesized in the epidermal cells, the epidermal cells can accumulate by accumulating the terpenes which are active in the fatty acid metabolism and can cause necrosis of the plant tissues during overaccumulation. Thus, The plant tissue necrosis problem can be avoided.

The composition of the present invention comprises a terpene synthase gene, an HMG-CoA reductase gene, and / or a BCCP1 gene, wherein each gene includes, for example, a pinene synthase, a nerol synthase, a citral synthase, (-) - α-bisabolol synthase, valerenadiene synthase, amorphadiene synthase, α-humulene synthase, α / β-santalene synthase, β-bisabolene synthase and camphor synthase, menthol synthase, limonene synthase and linalool synthase. , Patchoulol synthase, (E) -β-farnesene synthase, δ-selinene synthase, γ-humulene synthase, germacrene C synthase, epi-cedrol synthase, germacrene D synthase, δ-guaien synthase, valencene synthase, bechisupirajien synthase And casbene synthase, taxadiene synthase, levopimaradiene synthase, abietadiene synthase, isopimaradiene synthase, and ent-copalyl diphosp 13-ene synthase, syn-stemod-13 (17) -ene synthase, syn-pimara-7,15-diene synthase, ent-sandaracopimaradiene synthase, ent-cassa-12,15-diene synthase 15 synthase, ent-kaur-15-ene synthase, ent-kaur-16-ene synthase, aphidicolan-16β-ol synthase, phyllocladan-16? -ol synthase, fusicocca- A diterpene synthase gene such as 2,10 (14) -diene synthase, sclareol synthase, cis-abienol synthase, manool synthase, larixol synthase, and clerodienyl diphosphate synthase, and may be a triterpene synthase gene.

The gene contained in the composition of the present invention may be derived from a plant such as Chamomile, Cryptomeria japonica, Cryptomeria japonica, Pepper, Orange, Mint, Fir, Agarwood, Tomato, Lettuce, Chicory, Barley, Tobacco, Yeast, But is not limited thereto.

The composition may preferably comprise a transformed vector inserted with a terpene synthase gene, an HMG-CoA reductase gene and / or a BCCP1 gene sequence together with an over-expression promoter, or a microorganism transformed with the transformed vector.

The transformed vector refers to a recombinant DNA molecule comprising a desired coding sequence and a suitable nucleic acid sequence necessary for expressing a coding sequence operably linked in a particular host organism. Promoters, enhancers, termination signals and polyadenylation signals available in eukaryotic cells are known. In the present invention, the transformation vector may be a plant which can be introduced into a plant cell by inserting a terpene synthase gene, an HMG-CoA reductase gene and / or BCCP1 gene sequence, or introduced into a microorganism inducing infection with a plant Expression vector.

A preferred example of the plant expression vector is a pEAQ-HT binary vector, which is a plasmid designed to produce an exogenous protein easily and rapidly in a plant. It uses the Cowpea Mosaic Virus hypertranslational "CPMV- HT " expression system, which can produce large amounts of recombinant proteins with high level of translation efficiency without viral replication with potential problems that could lead to genetic drift and biological contamination to be. Within the Transfer-DNA region (T-DNA) with the DNA to be transferred into the plant genome, there is a multiple cloning region (MCS) with various restriction enzymes between the 35S systemic expression promoter and the nopaline synthase (nos) terminator. And a modified 5'untrasnlated region (UTR) and 3'UTR sequence of RNA-2 that rely on RNA-1 encoding the viral replication machinery to encode viral coat proteins and viral movement proteins, Can be further enhanced. In addition, it contains the P19 gene, which is an inhibitor of gene silencing, so that the foreign gene T-DNA region is introduced into the plant genome and can be prevented from being recognized as an intruder in the plant. In the framework of the vector, the oriV , colE1 origin and trfA gene, which are essential for the amplification of the plasmid in E. coli and A. tumefaciens , are present and are resistant to kanamycin antibiotics The neomycin phosphotransferase (nptIII) gene of the protist is present. The following vector constructs are important for efficiently expressing large amounts of recombinant proteins in plants by introducing the gene of interest. The vector is a high-efficiency plant-applied vector, and is used for both temporary expression and normal expression.

In the plant expression vector according to an embodiment of the present invention, the promoter for overexpressing the terpene synthase gene, the HMG-CoA reductase gene and / or the BCCP1 gene may be CaMV 35S, actin, ubiquitin, pEMU, MAS, AUX or histone promoter But is not limited thereto. In this vector, the terminator can be a conventional terminator, such as nopaline synthase (nos), rice-amylase RAmy1 A terminator, phaseoline terminator, Agrobacterium tumefaciens, And the terminator of the Octopine gene of the present invention, but the present invention is not limited thereto. Regarding the need for vectors, such regions are known to increase the certainty and efficiency of transcription in plant cells.

The microorganism can be used without limitation as long as it causes an infection to a plant. For example, the microorganism can be various kinds of viruses or bacteria, and preferably a variety of Agrobacterium tuberculosis strains (LBA4404, C58C1, EHA105, EHA101, GV3101 Etc.) can be used.

Another example of the present invention includes a plant in which a terpene synthase gene, an HMG-CoA reductase gene and / or a BCCP1 gene sequence is inserted and these genes or base sequences are temporarily expressed.

The composition may be applied to all plants transiently expressing the terpene synthase gene, HMG-CoA reductase gene and / or BCCP1 gene.

The method of inserting the terpene synthase gene, HMG-CoA reductase gene and / or BCCP1 gene into a plant can be carried out by a method such as protoplast fusion, electroporation, gene gun method and plant pathogenic bacteria Agrobacterium Tome Pacifico Enschede (Agrobacterium tumefaciens ) may be used, but the present invention is not limited thereto.

The protoplast fusion method is a technique of fusing two cells having different traits using protoplasts in which the cell walls of plant cells have been removed (Christou. Trends in Plant Science, 1: 423-431, 1966) (Or electric shock method) is a method of increasing the DNA absorption of a cell by causing electric shock to the cell to temporarily create a small hole in the cell membrane.

In addition, the above-mentioned gene aggregation method is a method in which a target gene is coated on a metal (tungsten or gold) particle, and then the gene is introduced into a plant cell under the action of a high-pressure gas, .

In addition, the plant pathogenic bacteria Agrobacterium ( Agrobacterium < RTI ID = 0.0 > tumefaciens ) is a method in which when a strain is injected into a wounded plant leaf, a portion of the DNA (T-DNA) in the tumor-derived plasmid (Ti-plasmid) It is widely used for the introduction of genes into plants.

The plant transiently expressed by injection of the terpene synthase gene, HMG-CoA reductase gene and / or BCCP1 gene of the present invention is more effective than the plant transfected with the empty vector by activating the mevalonic acid pathway, The terpene biosynthesis in the plant can be promoted to be very excellent and terpenes can be produced with high yield.

As another example of the present invention, there is provided a plant comprising a step of introducing into a plant a promoter for overexpressing a terpene synthase gene, an HMG-CoA reductase gene and a BCCP1 (biotin carboxyl carrier protein) gene To provide a method for promoting terpene biosynthesis.

The above composition and the matters concerning the transiently expressed plant can be equally applied to the method for promoting plant terpene biosynthesis.

The terpene synthase gene, the HMG-CoA reductase gene, and / or the BCCP1 gene sequence may preferably be introduced into the plant together with a promoter for overexpressing the gene.

An Agrobacterium strain was transformed with a terpene synthase gene, an HMG-CoA reductase gene and / or a BCCP1 gene recombinant plasmid, which was prepared to transiently overexpress the above composition into Nicotiana bentamiana plants, and a suspension was prepared using the transformed strain The plants can be transiently overexpressed by inserting them into leaves and growing them for 7 days on plant growth.

The present invention can promote the biosynthesis of terpenes in plants more efficiently than the overexpression of each gene including the terpene synthase gene, HMG-CoA reductase gene and BCCP1 gene, It can be usefully used in fields.

BRIEF DESCRIPTION OF THE DRAWINGS Fig. 1 is a schematic diagram illustrating the structure of a vector used in one embodiment of the present invention.
Figure 2 illustrates a schematic structure of a vector used in another embodiment of the present invention.
Fig. 3 shows the tissue necrosis caused by the toxicity of the terpene synthase gene, the HMG-CoA reductase gene and the plant in which the BCCP1 gene is expressed systemically.
Fig. 4 shows the tissue necrosis caused by the toxicity of the terpene synthase gene, the HMG-CoA reductase gene and the BCCP1 gene-expressing plant specifically expressed in the epidermal cells.

The present invention will be described in more detail by way of the following illustrative examples, but the scope of protection of the present invention is not intended to be limited to the following examples.

Example 1: Preparation of plants containing the terpene synthase gene and the HMG-CoA reductase gene and the BCCP1 gene

A vector (P35S: BBS) further comprising a (-) -? - bisabolol synthase (BBS) gene as a terpene synthase gene, a vector containing only a whole body expression promoter (CaMV 35S) , A vector (P35S: BCCP1) containing the BCCP1 gene, a vector (P35S: tHMGR) containing the HMG-CoA reductase gene and a vector (P35S: tHMGR-2A- BCCP1, SEQ ID NO: 1).

This gene is derived from yeast-derived HMG-CoA reductase gene (Genbank SEQ ID NO: NM_001182434), (-) -? - bisabolol synthase (BBS) gene (Genbank SEQ ID NO: KJ020282) and Arabidopsis thaliana (Sainsbury et al., Plant Biotechnology Journal 7: 682-693, 2009) with the systemic expression promoter (CaMV 35S) of the first promoter region as the BCCP1 gene of the first promoter region (Genbank SEQ ID NO: AT5G16390). The schematic structure of the vector is schematically shown in Fig.

Specifically, the RNA of HMG-CoA reductase gene was extracted from yeast, and cDNA was synthesized and amplified by PCR. Here, primers having the sequences of SEQ ID NOs: 2 and 3 in Table 1 were used. The RNA of BCCP1 gene was extracted from Arabidopsis thaliana and cDNA was synthesized. Then, PCR amplification was carried out using primers having sequences of SEQ ID NOS: 4 and 5 in Table 1 below.

SEQ ID NO: Explanation order SEQ ID NO: 2 HMG-CoA gene
Forward primer 5'-CGCTCTAGAACTAGTGGATCCATGGTTTTAACCAATAAAACAGTCATTTC-3 ' SEQ ID NO: 3 HMG-CoA gene
Reverse primer 5'- CCCGCCAACTTGAGAAGGTCAAAATTCAAAGTCTGTTTCACGGATTTAATGCAGGTGACGGAC-3 ' SEQ ID NO: 4 BCCP1 gene
Forward primer 5'-TTCTCAAGTTGGCGGGAGACGTCGAGTCCAACCCTGGGCCCATGGCGTCTTCGTCGTTCTCA-3 ' SEQ ID NO: 5 BCCP1 gene
Reverse primer 5'-GGTACCGGGCCCCCCCTCGAGCTACGGTTGAACCACAAACAGAGG-3 '

The amplified two PCR products were purified and sub-cloned into pBluescript II KS vector digested with Bam HI and Xho I restriction enzymes by Gibson assemble method. (SEQ ID NO: 6: 5'-CTGCCCAAATTCGCGACCGGTATGGTTTTAACCAATAAAACAGTCATTTC-3 ') of the HMG-CoA reductase gene and the reverse primer of the BCCP1 gene (SEQ ID NO: 7: 5'- ACCAGAGTTAAAGGCCTCGAGCTACGGTTGAACCACAAACAGAGG- 3') after confirming the nucleotide sequence of the recombinant plasmid, , And cloned into pEAQ-HT vector digested with Age I and Xho I restriction enzymes.

Example  2. Agrobacterium-mediated Nicotiana Ventamiana  Transformation

In Example 1, the vector into which the HMG-CoA reductase gene and / or BCCP1 gene cDNA was inserted was transformed into Agrobacterium tumefaciens (LBA4404), a plant infectious strain. Then, the transformants were cultured in 5 mL of Luria broth containing 25 μg mL ^-1 of antibiotics rifampicin (25 μg mL ^-1 ) and kanamycin (50 μg mL ^-1 ) for 24 hours at 28 ° C and 250 rpm shaking incubator. The culture solution using a high speed centrifuge (4,000 rpm) at room temperature to collect the cells, injection buffer (10 mM MES, 10 mM MgCl 2 and 200 μM acetosyringone, pH 5.6) to prepare to re-suspending so as to provide a 0.5 OD ₆₀₀ value Respectively. For the simultaneous injection, the strain suspension containing other plasmids was mixed at a ratio of 1: 1 in the same manner as described above. Subsequently, the injection solution was homogenized at room temperature for 3 hours or longer under the dark condition, and a suspension prepared by syringe was injected into the hypocotyl surface of Nicotiana benthamiana or tobacco leaves cultured for 4-5 weeks. The plants inoculated with the solution were grown for 7 days at a temperature of 24 ° C and a relative humidity of 60% or less and at a plant growth of 16 hours / day and 8 hours at night.

When a plant successfully transforms with a foreign terpene synthase gene, it accumulates terpene that was not present in the original plant. Therefore, the presence of a new terpene in Nicotiana bentamiana confirmed the transfection.

Also, the expression of terpene gene does not necessarily have a linear relationship with the content of terpene due to problems of supply of precursors and divergence out of the plant. However, when a plant is successfully transformed into a foreign terpene synthase gene, Since the terpene is accumulated, the degree of gene expression can be estimated by the content of terpenes under the same conditions.

Example  4. Assessment of terpene biosynthesis promoting activity of transgenic plants (systemic expression)

Quantitative analysis of terpenes extracted from the leaves of the transgenic plants was carried out in order to evaluate the terpene biosynthesis promoting activity in the transgenic plants prepared in Example 3. For quantitative analysis, gas chromatography (6890 series, Agilent) equipped with a mass spectrometer (model 5973N, Agilent) was used. A strain transformed with the recombinant gene was inserted into the leaves of the plant of Example 3 and extracted with a solvent was used as a sample. 1 [mu] L of the sample was injected into the gas chromatograph and analyzed. The column used was DB-5MS (60 m × 0.25 mm inner diameter × 0.25 μ film thickness) and helium was flowed to 1 mL per minute with mobile phase gas. In addition, the injector was in a spiralless mode and the temperature of the injection port was set at 270 ° C. The temperature of the oven was raised to 100 ° C for 1 minute, then to 220 ° C for 1 minute, to 220 ° C for 1 minute, and to 320 ° C, to 20 ° C per minute. (-) - α-bisabolol (Sigma Aldrich) was used as a standard for the quantitative analysis of (-) - α-bisabolol. Amorpha-4,11-diene and valerena- (-) - α-cedrene (Sigma Aldrich) was calibrated to internal standard for quantitative analysis of diene and used as the mass standard.

The GS / MS results are shown in Table 2 below using vectors containing the 35S promoter expressing the whole body.

Gene combination Production of sesquiterpene (in μg / g fresh leaves) The control vector (empty vector) - p35S: BBS 24 p35S: BBS + p35S: HMGR 120 p35S: BBS + p35S: BCCP1 33 p35S: BBS + p35S: HMGR-2A-BCCP1 620

As shown in Table 1, when the HMG-CoA reductase gene and the BCCP1 gene were simultaneously overexpressed, the yield was 26 times higher than the overexpression of the BBS gene alone, the yield was 19 times higher than that of the BCCP1 gene alone and overexpression of the HMG-CoA reductase gene alone It was confirmed that the sesquiterpene was biosynthesized at a yield of about 5 times higher than that of the casein.

Example  5. Assessment of terpene biosynthesis promoting activity of transgenic plants (epidermal cells)

Transgenic plants were prepared in the same manner as in Examples 1 and 2 except that the ependymal cell-specific promoter and the CER6 promoter were introduced to specifically introduce the terpene synthase gene, the HMG-CoA reductase gene, and the BCCP1 gene into the epidermal cells of the plant Lt; / RTI >

In the vector preparation of Example 1 above, the CaMV 35S systemic expression promoter present in an empty vector was replaced with a epidermal cell-specific promoter. The epidermal-specific CER6 promoter was derived from the Arabidopsis thaliana and was composed of the nucleotide sequence of Genbank SEQ ID NO. At1g68530. Arabidopsis genomic DNA was extracted, amplified by PCR, and cloned into pEAQ vector digested with Pac I and Swa I restriction enzymes.

A primer having the sequence of SEQ ID NO: 8 (CER6 promoter forward primer: 5'-GCCAGTGAATTGTTAATTAACTTCGATATCGGTTGTTGACGATTAA-3 ') and SEQ ID NO: 9 (CER6 promoter reverse primer: 5'-AGATTTTAATAGATTTAAATCGTCGGAGAGTTTTAATGTATAATTGTATTATT-3') was used as the primer. The terpene synthase gene, the HMG-CoA reductase gene, and the BCCP1 gene to be introduced into the multiple cloning site are the same as those described in the preparation of the vector of Example 1 above. The schematic structure of the vector is schematically shown in Fig.

The GS / MS of the sesquiterpene produced by the introduction of the vector containing the epidermal cell-specific expression CER6 promoter was analyzed by the same method as in Example 4, and the results are shown in Table 3 below.

Gene combination Production of sesquiterpene (in μg / g fresh leaves) The control vector (empty vector) - p35S: BBS 26 pCER6: BBS 7 pCER6: BBS + pCER6: HMGR 10 pCER6: BBS + pCER6: HMGR-2A-BCCP1 73

As shown in Table 2, the yield of the whole body expression of Example 4 was reduced to about 1/9, but the volume of epidermal cells of spinach, a typical dicotyledonous plant, was only about 5% Actual yield per cell volume was comparable to systemic expression.

Example  6. Toxicity assessment

The phytotoxicity of terpenes accumulated in the plants evaluated in Examples 4 and 5 for evaluation of terpene biosynthesis promotion was evaluated. Plant toxicity was visually determined through necrotic tissue and the results are shown in FIGS. 3 and 4.

As can be seen from FIG. 3, the necrosis of the tissues occurred significantly in the whole-body-expressing plant, whereas in the case of the epidermal-cell-specific expression, unlike the systemic expression, no change in the apparent necrosis of the transformed leaves was observed Respectively.

<110> Seoul National University R & DB Foundation <120> Composition for enhancing terpene biosynthesis in plant <130> DPP20163930 <160> 9 <170> Kopatentin 1.71 <210> 1 <211> 2412 <212> DNA <213> Truncated HMGR-2A-BCCP1 <400> 1 atggttttaa ccaataaaac agtcatttct ggatcgaaag tcaaaagttt atcatctgcg 60 caatcgagct catcaggacc ttcatcatct agtgaggaag atgattcccg cgatattgaa 120 agcttggata agaaaatacg tcctttagaa gaattagaag cattattaag tagtggaaat 180 acaaaacaat tgaagaacaa agaggtcgct gccttggtta ttcacggtaa gttacctttg 240 tacgctttgg agaaaaaatt aggtgatact acgagagcgg ttgcggtacg taggaaggct 300 ctttcaattt tggcagaagc tcctgtatta gcatctgatc gtttaccata taaaaattat 360 gactacgacc gcgtatttgg cgcttgttgt gaaaatgtta taggttacat gcctttgccc 420 gttggtgtta taggcccctt ggttatcgat ggtacatctt atcatatacc aatggcaact 480 acagagggtt gtttggtagc ttctgccatg cgtggctgta aggcaatcaa tgctggcggt 540 ggtgcaacaa ctgttttaac taaggatggt atgacaagag gcccagtagt ccgtttccca 600 actttgaaaa gatctggtgc ctgtaagata tggttagact cagaagaggg acaaaacgca 660 attaaaaaag cttttaactc tacatcaaga tttgcacgtc tgcaacatat tcaaacttgt 720 ctagcaggag atttactctt catgagattt agaacaacta ctggtgacgc aatgggtatg 780 aatatgattt ctaaaggtgt cgaatactca ttaaagcaaa tggtagaaga gtatggctgg 840 gaagatatgg aggttgtctc cgtttctggt aactactgta ccgacaaaaa accagctgcc 900 atcaactgga tcgaaggtcg tggtaagagt gtcgtcgcag aagctactat tcctggtgat 960 gttgtcagaa aagtgttaaa aagtgatgtt tccgcattgg ttgagttgaa cattgctaag 1020 aatttggttg gatctgcaat ggctgggtct gttggtggat ttaacgcaca tgcagctaat 1080 ttagtgacag ctgttttctt ggcattagga caagatcctg cacaaaatgt tgaaagttcc 1140 aactgtataa cattgatgaa agaagtggac ggtgatttga gaatttccgt atccatgcca 1200 tccatcgaag taggtaccat cggtggtggt actgttctag aaccacaagg tgccatgttg 1260 gacttattag gtgtaagagg cccgcatgct accgctcctg gtaccaacgc acgtcaatta 1320 gcaagaatag ttgcctgtgc cgtcttggca ggtgaattat ccttatgtgc tgccctagca 1380 gccggccatt tggttcaaag tcatatgacc cacaacagga aacctgctga accaacaaaa 1440 cctaacaatt tggacgccac tgatataaat cgtttgaaag atgggtccgt cacctgcatt 1500 aaatccgtga aacagacttt gaattttgac cttctcaagt tggcgggaga cgtcgagtcc 1560 aaccctgggc ccatggcgtc ttcgtcgttc tcagtcacat ctccagctga tgctgcttcc 1620 gtctatgcag tcactcaaac ctcctcgcac ttcccaatcc aaaaccgctc tcgcagagtt 1680 tctttccgtc tctctgctaa gcccaagctt cgctttctct ccaagcctag tcgcagtagc 1740 taccctgtgg tgaaagcaca atctaacaag gttagtactg gtgcatcatc aaatgctgcc 1800 aaagttgatg ggccatcatc agctgaagga aaggagaaaa actcattgaa ggagtcgtct 1860 gcttcttctc ctgaattagc tacagaagag tctatttctg agttccttac ccaagtaaca 1920 actcttgtca agcttgtgga ttcaagagac attgttgagt tgcagttgaa acaactcgac 1980 tgtgaactag tcattcgaaa aaaagaagcc ttacctcaac ctcaagctcc tgcatcttat 2040 gttatgatgc agcaaccaaa tcaaccatct tatgcccagc aaatggctcc tcccgctgca 2100 cctgctgctg ccgcaccagc cccttctacg ccagcctctc tgcctccacc atccccacct 2160 actccagcca aatcgtcact tcctactgtt aaaagcccca tggctggcac attctaccgt 2220 agtcctgcac ctggtgaacc accctttatt aaggttggag acaaagtgca gaaggggcaa 2280 gttctatgca ttgttgaagc catgaagtta atgaatgaaa tagagtctga ccataccgga 2340 accgtagtcg atattgtcgc agaagacggc aagcctgtca gcctcgacac tcctctgttt 2400 gtggttcaac cg 2412 <210> 2 <211> 50 <212> DNA <213> HMG-CoA forward primer <400> 2 cgctctagaa ctagtggatc catggtttta accaataaaa cagtcatttc 50 <210> 3 <211> 63 <212> DNA <213> HMG-CoA reverse primer <400> 3 cccgccaact tgagaaggtc aaaattcaaa gtctgtttca cggatttaat gcaggtgacg 60 gac 63 <210> 4 <211> 62 <212> DNA <213> BCCP1 forward primer <400> 4 ttctcaagtt ggcgggagac gtcgagtcca accctgggcc catggcgtct tcgtcgttct 60 ca 62 <210> 5 <211> 45 <212> DNA <213> BCCP1 reverse primer <400> 5 ggtaccgggc cccccctcga gctacggttg aaccacaaac agagg 45 <210> 6 <211> 50 <212> DNA <213> forward primer <400> 6 ctgcccaaat tcgcgaccgg tatggtttta accaataaaa cagtcatttc 50 <210> 7 <211> 45 <212> DNA <213> reverse primer <400> 7 accagagtta aaggcctcga gctacggttg aaccacaaac agagg 45 <210> 8 <211> 46 <212> DNA <213> forward primer <400> 8 gccagtgaat tgttaattaa cttcgatatc ggttgttgac gattaa 46 <210> 9 <211> 53 <212> DNA <213> reverse primer <400> 9 agattttaat agatttaaat cgtcggagag ttttaatgta taattgtatt att 53

Claims (8)

A) a vector comprising a HMG-CoA reductase gene and a BCG1 (biotin carboxyl carrier protein 1) gene together with a promoter that overexpresses the two genes, and B) a terpene synthase gene and the gene A composition for promoting plant terpene biosynthesis, comprising a microorganism transformed with a vector containing an over-expressing promoter. delete The method of claim 1, wherein the terpene synthase gene, the HMG-CoA gene, and the BCCP1 gene are selected from the group consisting of Chamomile, Cryptomeria japonica, Cryptomeria japonica, Pepper, Orange, Mint, Fir, Agar, Tomato, Lettuce, Chicory, Wherein the composition is derived from at least one selected from the group consisting of yeasts, and Arabidopsis. The method of claim 1, wherein the promoter is a constitutive promoter or epidermal cell-specific over-expression promoter,
Wherein the plant is at least one selected from the group consisting of plant whole and skin color of epidermal cells. The composition according to claim 1, wherein the plant terpene is at least one selected from the group consisting of monoterpene, diterpene, triterpene, tetra terpene and sesquiterpene. 6. The composition of claim 5, wherein the plant terpene is sesquiterpene. A) a vector comprising a HMG-CoA reductase gene and a BCG1 (biotin carboxyl carrier protein) gene together with a promoter that overexpresses the two genes, B) a terpene synthase gene, Producing a microorganism transformed with a vector containing a promoter; And
A method for promoting plant terpene biosynthesis, comprising the step of infecting the plant with the transformed microorganism. 8. The method of promoting plant terpene biosynthesis according to claim 7, wherein the A) vector comprises a base sequence consisting of the sequence of SEQ ID NO: 1.

Images