KR101898411B1 - Composition comprising the extract of Rosa rugosa Thunb for preventing or treating liver disease - Google Patents

Abstract

The present invention relates to a composition for the prevention or treatment of liver disease, which contains an extract of Bombyx mori as an active ingredient. The extract of Bombyx mori of the present invention is a composition for preventing or treating liver disease comprising Smad It can be used as an effective ingredient of a therapeutic agent for liver disease or a health functional food for prevention of liver disease by confirming that the effect of suppressing phosphorylation of molecules is excellent and does not cause toxicity to normal cells.

Description

[0001] The present invention relates to a composition for prevention or treatment of liver diseases,

The present invention relates to a composition for the prevention or treatment of liver diseases, which comprises an extract obtained by the granulation as an active ingredient.

The liver is the most active organ in the body in vivo, and is located between the body's digestive system and systemic circulatory system and functions to protect the body from exogenous substances. Since the in vivo substance entering the living body passes through the liver once, the liver has a higher risk of being exposed to many toxic substances than the other organs in addition to the nutrients. However, when the liver is regenerated, it is recovered to a normal state when there is some damage, but if the damage is sustained, the liver is completely destroyed and the hepatic function is lowered. do. If such liver damage is chronicized, liver fibrosis, cirrhosis, and liver cancer occur regardless of the cause.

The causes of liver damage include stressful chronic fatigue and excessive intake of food or alcohol containing fat, harmful substances such as virus infection, various medicines, and malnutrition.

As a method for treating liver diseases caused by liver damage, dietary therapy and pharmaceutical therapy are widely used, and these two methods are used in combination. In addition, there are silymarin and biphenyl dimethyl dicarboxylate (BDD) as typical therapeutic agents for liver disease. However, these drugs are also not suitable for treatment. Therapeutic agents can cause various side effects in the body and are not commercialized.

Therefore, it is urgently required to develop a new therapeutic agent for liver disease using natural products which have excellent therapeutic effects to replace conventional therapeutic agents and have no side effects even when administered in large amounts or for a long period of time.

On the other hand, bivalve refers to the gadfly flower of Rosa rugosa Thunb. It contains about 0.03% essential oil and its main components are citronellol, geraniol, nerol, eugenol and phenyl ethyl alcohol. Citronellol content reaches 60% and geraniol content Followed by nerol 5-10%, eugenol and phenyl ethyl alcohol 1%, respectively. In addition, they contain bitterness, tannin, fat, gallic acid, cyanin, yellowish yellow, wax, and β-carotene.

It is known that this mobilizing effect is effective for the treatment of the efficacy and the treatment of the menstrual irregularities such as fever, depression, and hemorrhage. Blood), but the efficacy for the treatment of liver disease has not been reported.

Therefore, the inventors of the present invention have completed the present invention by confirming that the extract of T. gingiva can be used as a material for the treatment and prevention of liver disease, since it has an activity of inhibiting the activity of Smad molecule by TGF-β1 which is increased upon hepatocyte injury.

1. Korean Patent Publication No. 2003-0036589 2. Korean Patent Publication No. 2007-0032520

It is an object of the present invention to provide a composition for inhibiting the activity of transforming growth factor beta 1 (TGF-beta 1) containing an extract of M. subtilis as an active ingredient.

Another object of the present invention is to provide a pharmaceutical composition for the treatment of liver cirrhosis or liver fibrosis comprising a composition containing an extract of Mung bean as an active ingredient.

It is still another object of the present invention to provide a health functional food for preventing and alleviating liver diseases, which comprises a composition containing an extract of Mung bean as an active ingredient.

In order to accomplish the above object, the present invention provides a composition for inhibiting the activity of transforming growth factor beta 1 (TGF-beta 1) containing an extract of Bombyx mori as an active ingredient.

In one embodiment of the present invention, the composition is characterized by inhibiting the expression of Smad, PAI-1, MMP-2, MMP-9 and? -SMA activated by TGF-?

In order to accomplish still another object of the present invention, the present invention provides a pharmaceutical composition for the treatment of liver cirrhosis or liver fibrosis comprising a composition containing an extract of Mizutariasis as an active ingredient.

In order to accomplish still another object of the present invention, there is provided a health functional food for prevention and alleviation of liver disease comprising a composition containing an extract of Mizuta kata as an active ingredient.

In one embodiment of the invention, the extract is selected from the group consisting of water, C1-C4 alcohol, hexane, ethyl acetate, butylene glycol, propylene glycol, glycerin, acetic acid, ether, chloroform, Can be obtained by using a solvent to be selected.

In one embodiment of the present invention, the extract may be contained in an amount of 0.1 to 50% by weight based on the total weight% of the composition.

In one embodiment of the present invention, the liver disease may be liver cirrhosis, hepatic fibrosis, acute hepatitis, chronic hepatitis or liver cancer.

The present invention also provides a health functional food for preventing or ameliorating a liver disease containing an extract of Mizutaegi as an active ingredient.

In one embodiment of the invention, the extract is selected from the group consisting of water, C1-C4 alcohol, hexane, ethyl acetate, butylene glycol, propylene glycol, glycerin, acetic acid, ether, chloroform, Lt; / RTI > may be obtained using a solvent of choice.

In one embodiment of the present invention, the liver disease may be liver cirrhosis, hepatic fibrosis, acute hepatitis, chronic hepatitis or liver cancer.

In one embodiment of the present invention, the health functional food may be in the form of tablets, capsules, pills, or liquids.

The present invention relates to a composition for the prevention or treatment of liver disease, which contains an extract of Bombyx mori as an active ingredient. The extract of Bombyx mori of the present invention is a composition for preventing or treating liver disease comprising Smad It is possible to use as an effective ingredient of a therapeutic agent for liver disease or a health functional food for prevention of liver disease by confirming that the effect of suppressing phosphorylation of molecules is excellent and does not cause toxicity to normal cells.

FIG. 1 shows the result of analysis of cytotoxicity of the extract of Rice (RRE).
FIG. 2 shows inhibitory effect of TGF-β1-induced SBE on gene activity (2A) and suppression effect on TGF-β1-induced Smad2 and Smad3 phosphorylation (2B) of submerged extract (RRE).
FIG. 3 shows the inhibitory effect of TGF-β1-induced PAI-1 mRNA expression (3A) and protein expression (3B) on the granulosa extract (RRE).
FIG. 4 shows the effect of suppressing mRNA expression of MMP-2 and MMP-9 induced by TGF-β1 in the granulosa extract (RRE).
FIG. 5 shows the inhibitory effect of α-SMA induced by TGF-β1 on the protein expression of the granulosa extract (RRE).

The present invention is characterized in that it can be used as an active ingredient capable of preventing or treating liver disease for the first time.

As described in the prior art, the current therapeutic agents for liver diseases are not fundamentally treated, resulting in insufficient pharmacological efficacy and cause side effects in the body. Therefore, efforts have been made to discover novel liver disease drugs based on natural materials , The present inventors have confirmed through experiments that it is possible to use an extract obtained by the granulometry.

According to one embodiment of the present invention, the extract of the present invention inhibits the activity of the Smad molecule by the transgranular growth factor beta 1 (TGF-β1), which causes liver damage, and the target gene of the Smad molecule It was found that PAI-1 production inhibitory effect was excellent (see Experimental Examples 2 and 3).

In contrast, the inflammatory response caused by hepatocyte injury activates hepatic stellate cells in the dormant phase and secretes extracellular matrix and various cytokines and chemokines. Among them, the transforming growth factor beta 1 (TGF- β1) acts as a potent growth inhibitor in many cells and stimulates extracellular matrix production. In particular, when TGF-β1 is activated during liver fibrosis, remodeling of extracellular matrix, including the production and accumulation of collagen, increases in hepatic stellate cells, resulting in progression of liver fibrosis and loss of hepatic function (Cho IJ, Kim YW , Han CY, et al., E-cadherin antagonizes transforming growth factor β1 gene induction in hepatic stellate cells by inhibiting RhoA-dependent Smad3 phosphorylation, Hepatology. 2010; 52 (6): 2053-2064).

Therefore, inhibitors that inhibit TGF-beta 1 and TGF- beta 1 -activating factors can be used as therapeutic agents for the treatment of liver diseases.

In addition, when the causative agent of liver damage is transient, activated hepatic stellate cells undergo apoptosis and extracellular matrix (ECM) increased by matrix metalloproteinases (MMP) It is decomposed and restored to the normal liver before it is damaged. However, if persistent liver damage occurs, ECM accumulation occurs excessively, resulting in permanent scarring, and the ECM constituting the scar is surrounded by hepatocytes, forming a nodule, which leads to pathologically irreversible cirrhosis (Friedman SL, Liver fibrosis - from bench to bedside, J Hepatol 2003; 38 Suppl 1: S38-53).

Therefore, inhibiting the activity of MMPs to inhibit the accumulation of extracellular matrix (ECM) during sustained liver injury can reduce liver damage. In this respect, the extract of the present invention of the present invention inhibits TMP-β1-induced ECM rearrangement-related genes MMP2 and MMP9 at gene expression levels (see Experimental Example 5).

Therefore, the extract of the present invention has an excellent effect of inhibiting the expression and activity of the factors affecting liver damage by the transforming growth factor beta 1 (TGF-beta 1) and TGF-beta 1, The present invention provides a pharmaceutical composition for the prevention or treatment of liver diseases containing an extract of Mizutaegi as an active ingredient.

The extract according to the present invention can be obtained by isolating and extracting the extract from the mashing using the extraction and separation methods known in the art, and the 'extract' defined in the present invention can be obtained by extracting an appropriate solvent And can be extracted from the mashing. Any suitable solvent that can be used to obtain the extract may be any of those accepted in the art, and water or an organic solvent may be used. Examples of the solvent include alcohols having 1 to 4 carbon atoms, acetone, ether, and the like, including purified water, methanol, ethanol, propanol, isopropanol, butanol, Various solvents such as benzene, chloroform, ethyl acetate, methylene chloride, hexane and cyclohexane may be used alone or in combination. But is not limited to.

As the extraction method, any one of the methods such as hot water extraction method, cold extraction method, reflux cooling extraction method, solvent extraction method, steam distillation method, ultrasonic extraction method, elution method and compression method can be selected and used. In addition, the desired extract may be further subjected to a conventional fractionation process or may be purified using a conventional purification method. There is no limitation on the method for producing the extract of the present invention, and any known method can be used.

Preferably, water is used as a solvent, and a crude extract can be obtained by hot water extraction.

In addition, the pharmaceutical composition of the present invention may be prepared by using pharmaceutically acceptable and physiologically acceptable adjuvants in addition to the above-mentioned effective ingredients. Examples of the adjuvants include excipients, disintegrants, sweeteners, binders, , A lubricant, a lubricant or a flavoring agent.

The pharmaceutical composition may be formulated into a pharmaceutical composition containing at least one pharmaceutically acceptable carrier in addition to the above-described active ingredients for administration.

The pharmaceutical composition may be in the form of granules, powders, tablets, coated tablets, capsules, suppositories, liquids, syrups, juices, suspensions, emulsions, drops or injectable solutions. For example, for formulation into tablets or capsules, the active ingredient may be combined with an oral, non-toxic pharmaceutically acceptable inert carrier such as ethanol, glycerol, water, and the like. Also, if desired or necessary, suitable binders, lubricants, disintegrants and coloring agents may also be included as a mixture. Suitable binders include, but are not limited to, natural sugars such as starch, gelatin, glucose or beta-lactose, natural and synthetic gums such as corn sweeteners, acacia, tracker candles or sodium oleate, sodium stearate, magnesium stearate, sodium Benzoate, sodium acetate, sodium chloride, and the like. Disintegrants include, but are not limited to, starch, methyl cellulose, agar, bentonite, xanthan gum and the like. Acceptable pharmaceutical carriers for compositions that are formulated into a liquid solution include sterile solutions suitable for the living body such as saline, sterile water, Ringer's solution, buffered saline, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, One or more of these components may be mixed and used. If necessary, other conventional additives such as an antioxidant, a buffer, and a bacteriostatic agent may be added. In addition, diluents, dispersants, surfactants, binders, and lubricants can be additionally added and formulated into injectable solutions, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like. Further, it can be suitably formulated according to each disease or ingredient, using the method disclosed in Remington's Pharmaceutical Science, Mack Publishing Company, Easton PA as an appropriate method in the field.

In one embodiment of the present invention, the granular extract of the present invention may be contained in an amount of 0.1 to 50% by weight based on the total weight of the composition.

The liver diseases that can be treated, prevented or ameliorated by the extract of the present invention include, but are not limited to, liver cirrhosis, liver fibrosis, acute hepatitis, chronic hepatitis or liver cancer.

In particular, the extract of the present invention has the effect of inhibiting the action of TGF-beta 1 and thus protecting liver damage. Recently, TGF-beta 1 has been found to be an important mediator of hepatic fibrosis and cirrhosis.

Among the liver diseases described above, cirrhosis is characterized by morphological features of fibrous tissue proliferation and regenerative nodule formation as a result of extensive destruction of normal liver tissue due to chronic inflammation, and secondly, deformation of liver blood vessels and liver function (Bataller B, Brenner DA, Hepatic Fibrosis. In: Arias IM et al., The liver biology and pathobiology, 5th ed., Wiley-Blackwell, 2009, p.433-452). Symptoms of cirrhosis can be manifested in a wide variety of symptoms, such as spider blood vessels appearing on the skin, abnormal metabolism of the hormones, redness of the palms more than normal, men do not destroy female hormones, resulting in bigger chest and lower sexual function. As the spleen grows larger, it can be touched on the left side, revenge can be swollen, both legs swollen, and extended blood vessels can protrude to the outside of the skin. In addition, jaundice may appear due to a decrease in liver function, and the personality may change or become unconscious due to hepatic coma. If the esophageal variceal hemorrhage is present, the blood may be ejaculated or blackened or stained. (Goldmann DR, Complete home medical guide, DK publishing, 2003, p.643-651).

 These liver cirrhosis is a disease that manifests the proliferation and regeneration nodule of the fibrous tissue. It is impossible to return to the normal state, and the treatment for cirrhosis is not to cure but to make full use of the present liver function. In the case of viral cirrhosis, drugs such as peginterferon or antiviral agent can be used to suppress the cause, but there is no therapeutic agent for actively treating cirrhosis.

In addition, hepatic fibrosis (hepatic fibrosis) is a condition in which the balance of synthesis and degradation of connective tissues is lost, and connective tissues accumulate in the liver tissues and are accompanied by necrosis or inflammation. In particular, hepatic stellate cells (HSCs), which play a role in the storage of vitamin A under normal liver function, are rapidly transformed into myofibroblasts by acute chronic liver damage and rapidly proliferate to form collagen, It is known to promote the fibrotic process of the liver by increasing and transferring the production of extracellular matrix such as proteoglycan, hyaluronan and the like to produce excessive connective tissue [Friedman et al., Proc. Natl. Acad. Sci. USA, 82: 8681 (1985) Gressner et al., Biochem. Biophys. Res. Commun., 151: 222 (1988) Gressner et al., J. Hepatol., 22: 28 (1995)]. In this process, TGFβ is produced, secreted and activated from various cells in the liver, especially Cooper cells or TGFβ-activated hepatocytes, and induces the proliferation and differentiation of hepatic stellate cells, thereby causing collagen-like extracellular matrix and it plays an important role in causing over production and accumulation of extracellular matrix.

The liver cancer may also be caused by the symptoms such as liver cirrhosis and liver fibrosis, which are the liver damage diseases described above, and may be caused by the continuous causative action of liver damage, and thus the extract of the present invention may be effective for the treatment of liver cancer.

In addition, the composition of the present invention can be used as a food composition in addition to a pharmaceutical composition for the treatment and prevention of liver diseases. In addition to containing the extract as an active ingredient, the food composition contains various flavors Or natural carbohydrate as an additional ingredient.

Examples of the above-mentioned natural carbohydrates include monosaccharides such as glucose, fructose and the like; Disaccharides such as maltose, sucrose and the like; And polysaccharides, for example, conventional sugars such as dextrin, cyclodextrin and the like, and sugar alcohols such as xylitol, sorbitol and erythritol. The above-described flavors can be advantageously used as natural flavorings (tau martin), stevia extracts (e.g., rebaudioside A, glycyrrhizin, etc.) and synthetic flavors (saccharin, aspartame, etc.).

The food composition of the present invention can be formulated in the same manner as the above pharmaceutical composition and used as a functional food or added to various foods. Foods to which the composition of the present invention can be added include, for example, beverages, meat, chocolates, foods, confectionery, pizza, ram noodles, other noodles, gums, candy, ice cream, alcoholic beverages, vitamin complexes, .

In addition, the food composition may contain various nutrients, vitamins, minerals (electrolytes), flavors such as synthetic flavors and natural flavors, colorants and aging agents (cheese, chocolate, etc.), pectic acid Alginic acid and its salts, organic acids, protective colloid thickeners, pH adjusting agents, stabilizers, preservatives, glycerin, alcohols, carbonating agents used in carbonated drinks, and the like. In addition, the food composition of the present invention may contain natural fruit juice and pulp for the production of fruit juice drinks and vegetable drinks.

Since the extract of the present invention, which is an effective ingredient of the present invention, is a natural substance and has little toxicity and side effects, it can be safely used even when taken for a long time.

The health functional food of the present invention can be manufactured and processed in the form of tablets, capsules, powders, granules, liquids, and circles for the purpose of improving and preventing liver damage.

In the present invention, the term " health functional food " refers to foods manufactured and processed using raw materials or ingredients having useful functions in accordance with Law No. 6727 on Health Functional Foods. Or to obtain a beneficial effect in health use such as physiological action.

The health functional foods of the present invention may contain conventional food additives and, unless otherwise specified, whether or not they are suitable as food additives are classified according to the General Rules for Food Additives approved by the Food and Drug Administration, Standards and standards.

Examples of the items listed in the above-mentioned "food additives" include chemical compounds such as ketones, glycine, calcium citrate, nicotinic acid, and cinnamic acid; Natural additives such as persimmon extract, licorice extract, crystalline cellulose, high color pigment and guar gum; L-glutamic acid sodium preparations, noodle-added alkalis, preservative preparations, tar coloring preparations and the like.

For example, the health functional food in the form of tablets may be prepared by granulating a mixture obtained by mixing the extract of the present invention as an active ingredient of the present invention with an excipient, a binder, a disintegrant and other additives in a usual manner, Or the mixture can be directly compression molded. In addition, the health functional food of the tablet form may contain a mating agent or the like if necessary.

The hard capsule of the capsule form of the health functional food can be prepared by filling a normal hard capsule with a mixture of an extract of the present invention as an active ingredient and an additive such as an excipient and the soft capsule is prepared by adding an extract And filling the mixture with a capsule base such as gelatin. The soft capsule may contain a plasticizer such as glycerin or sorbitol, a coloring agent, a preservative and the like, if necessary.

The ring-shaped health functional food can be prepared by molding a mixture of an extract of the present invention as an active ingredient of the present invention, an excipient, a binder, a disintegrant, and the like by a conventionally known method and, if necessary, Or it may be coated with a material such as starch, talc.

The granular health functional food may be prepared by granulating a mixture of the granular extract as an active ingredient of the present invention with an excipient, a binder and a disintegrant in a granular form by a known method, and if necessary, And the like.

The health functional food may be in the form of tablets, capsules, pills or liquids, and examples thereof include beverages, meat, chocolates, foods, confectionery, pizza, ramen, other noodles, gums, candy, ice cream, alcoholic beverages, And health supplement foods.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these examples are for illustrative purposes only and that the scope of the present invention is not construed as being limited by these examples.

Example 1. Preparation of materials and reagents

Transforming growth factor beta 1 (TGF-β1) was purchased from R & D Systems (Minneapolis, Minn., USA), and fetal bovine serum (FBS), penicillin and streptomycin were purchased from Gibco / BRL Eggenstein, Germany) and L-glutamine was purchased from Invitrogen (Carlsbad, CA, USA). Smad antibody was purchased from Cell Signaling Technology (Danvers, MA, USA) and PAI-1 antibody was purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA) and used in the following Examples and Experimental Examples.

Example 2: Preparation of extracts from each case

The flowers were purchased from Daegu, Korea, washed with water and shaken. Then, 1.3 L of water was added to 100 g of dry weight, and the mixture was transferred for 3 hours. The extract thus obtained was filtered through a filter paper (No. 2 filter paper, Nalgene, New York, NY, USA) and then concentrated using a vacuum rotary condenser (EYELA CCA-1110, SER.NO.10406050, Tokyo, Japan) 28.5 g (yield: 28.5%) of a crude extract was obtained and used in the following experimental examples.

Example 3 Effect of Extract of Mung bean Extract on Hepatic Stellate Cells (LX-2 cell)

The following experiment was carried out to confirm the effect of the extract obtained from Example 1 on the survival rate of hepatic stellate cells (LX-2 cell, donated by Seoul National University College of Pharmacy) as follows.

Stromal cells (LX-2 cells) were cultured in a 24-well plate at 5 × 10 ⁴ cells / well for 10 minutes in 10% bovine serum, 100 U / ml penicillin, 100 μg / ml streptomycin and 1 The cells were cultured in a cell culture medium (Sanyo, Japan) at 37 ° C and 5% CO ₂ using DMEM supplemented with 10% L-glutamine (Dulbecco's modified Eagle's medium, Gibco / BRL, Eggenstein, Germany). The extracts were then treated at different concentrations and cell viability was measured. After cultivation, 3- (4,5- (dimethylthiazol) -2-yl) -2,5-diphenyltetrazolium (MTT, Sigma, St. Louis, Mo., USA) After adding 300 μl of 1.0 mg / ml and incubating for 4 hours, the medium was carefully removed, and the formazan crystals were dissolved in DMSO to obtain a Titertek Multiskan Automatic ELISA microplate reader , Model MCC / 340, Huntsville, Ala.), And the cell viability was expressed as a percentage of control cells using the formula shown in the following formula (1) Refers to a group obtained by treating the granular extract of the present invention by concentration.

&Quot; (1) "

Cell viability (% of control) = (absorbance of test sample) / (absorbance of control group) x 100

As a result of the analysis, when the extracts were treated with 10, 30, and 100 μg / ml for 24 hours, the extracts showed almost no cytotoxicity to cells and showed slight cytotoxicity even at a high concentration of 300 μg / ml 1). Accordingly, the inventors of the present invention have found that the extracts of the granulocyte-macrophyllum are stable in the body and do not cause toxicity to normal hepatocytes, and thus can be used safely as therapeutic agents or health functional foods for treating and improving liver diseases.

Example 4. Influence of TGF-beta1 on Smad Molecular Activation

The Smad bindin element (SBE) was used to determine whether the extract obtained in Example 1 had an effect on the molecular activity of a typical transcription factor Smad, which is an activation index of TGF-β1, which is induced by liver injury. Were analyzed by the reporter gene analysis method and Western blotting method as described below.

First, reporter gene analysis was performed by using a reporter gene (p-GL4.48, promega, Madison, Wis., USA) containing a Smad binding region in a liver cell line T-HSC / Cl-6 using FugeneHD lipofectamine reagent , And cells transfected with hygromycin were screened to prepare a recombinant cell line stably expressing the p-GL4.48 plasmid. The prepared recombinant cell lines were pretreated with 10, 30, and 100 μg / ml of extracts for 30 minutes, respectively, and treated with 5 ng / ml of TGF-β1 for 12 hours. Since these cells then lie sheath (lysis) luciferase reporter assay system kit (Luciferase Reporter Assay System ^TM, Promega Co.) T Terre Tech Multi Skan ohtometik Ella and a microplate reader (Titertek Multiskan microplate reader using Automatic ELISA , Model infinite M200, Huntsville, AL). The measured luciferase activity was corrected by the total protein content in cell lysate extract.

Western blotting was performed by lysis buffer [20 mM Tris Cl (10 mM), phosphate buffered saline (1 mM), phosphate buffered saline (pH 7.5), 1% Triton X-100, 137 mM sodium chloride, 10% glycerol, 2 mM EDTA, 1 mM sodium orthovanadate, 25 mM beta glycerophosphate 100 μl of b-glycerophosphate, 2 mM sodium pyrophosphate, 1 mM phenylmethylsulfonylfluoride, 1 mg / ml leupeptin) was scraped with a scraper and heated to 15,000 ㅧ g at 4 ° C Lt; / RTI > for 30 minutes. Then, 50 μg of the quantified protein was electrophoresed on 10% SDS-PAGE, transferred to nitrocellulose paper and reacted with p-Smad2, p-Smad3 and Smad2 / 3 antibodies, and then the secondary antibody, And reacted with horseradish peroxidase-conjugated anti-rabbit IgG antibody. The expression levels of p-Smad2, p-Smad3 and Smad2 / proteins were determined using ECL detection reagents (Amersham Biosciences Corp., Piscataway, NJ, USA) and analyzed using an image analyzer Image analyzing system, Ultra-Violet Products Ltd., Upland, CA, USA).

As a result of the analysis by the above analysis method, in the case of the reporter gene analysis, the gene expression activity of the Smad bindin element (SBE) derived from TGF-β1 was decreased in a concentration-dependent manner (See FIG. 2A), Western analysis showed that the phosphorylation of Smad2 and Smad3 increased by TGF-β1 in a dose-dependent manner (see FIG. 2B).

Therefore, the inventors of the present invention found that the herbal extract of the present invention inhibits the expression of Smad by TGF-β1 and inhibits the activity of these proteins through inhibition of phosphorylation of Smad2 and Smad3 .

Example 5 Effect of Extract of Mulberry Seed on Inhibition of PAI-1 Production

The expression of plasminogen activator inhibitor-1 (PAI-1), a typical target gene with SBE in the promoter, was examined to confirm whether the inhibition of the Smad molecule activity by the extract of Mungbean sprouts could directly inhibit the expression of the target gene. Respectively. For this purpose, the inventors of the present invention conducted real-time RT-PCR and Western blotting to determine whether the extract of the present invention inhibits PAI-1 produced by activation of TGF-β1 leading to hepatic damage.

Real-time RT-PCR was performed by using LX-2 cells in combination with 10, 30, 100 μg / ml and 5 ng / ml of TGF-β1. Total RNA was isolated from the cells. PAI-1 mRNA was transformed into cDNA and amplified by PAI-1 selective polymerase chain reaction. The primer sequences of PAI-1 used for real-time RT-PCR are shown in Table 1.

Target gene Primer sequence Size (bp) PAI-1 Sense: TCGTCCAGCGGGATCTGA 512 Antisense: CCTGGTCATGTTGCCTTTC

Western blotting was performed by co-incubating the hepatic stellate cells (LX-2 cells) with 10, 30, 100 μg / ml and 5 ng / ml TGF-β1 for 24 hours and then lysing buffer [20 mM Tris Cl (pH 7.5), 1% Triton X-100, 137 mM sodium chloride, 10% glycerol, 2 mM EDTA, 1 mM sodium orthovanadate, 25 mM beta glycerophosphate 100 μl of b-glycerophosphate, 2 mM sodium pyrophosphate, 1 mM phenylmethylsulfonylfluoride, 1 mg / ml leupeptin) was scraped with a scraper and heated to 15,000 ㅧ g at 4 ° C For 30 minutes to remove debris. 50 μg of the quantified protein was subjected to electrophoresis on 10% SDS-PAGE, transferred to nitrocellulose paper and bound to the PAI-1 antibody, and then the secondary antibody, horseradish peroxidase conjugated anti-rabbit IgG (horseradish peroxidase-conjugated anti-rabbit IgG) antibody. The degree of protein expression was determined using ECL detection reagents (Amersham Biosciences Corp., Piscataway, NJ, USA) and analyzed using an image analyzing system (Ultra-Violet Products Ltd., Tokyo, Japan) for densitometric analysis. , Upland, CA, USA) were used.

As a result, the expression of TGF-β1-induced PAI-1 mRNA was decreased by treatment with the extract of the present invention (see FIG. 3A), and these results indicate that PAI-1 is expressed not only at the gene level, -1 < / RTI > protein levels (see FIG. 3B).

Example 6 Effect of Extract of Mung Bean on Inhibition of MMPs Production

In order to examine whether the extract of the present invention obtained in Example 1 affects the expression of ECM rearrangement related genes, which is known to be increased by TGF-β1, which is increased during liver injury, MMP-2 and MMP- 9 mRNA expression was assayed by real-time RT-PCR as follows.

Real-time RT-PCR was performed by using LX-2 cells in combination with 10, 30, 100 μg / ml and 5 ng / ml of TGF-β1. Total RNA was isolated from the cells. The MMP-2 and MMP-9 mRNAs were converted into cDNAs, and the DNAs were amplified by reverse transcriptase polymerase chain reaction using MMP-2 and MMP-9 selective primers. Respectively. The primer sequences of MMP-2 and MMP-9 used for real-time RT-PCR are shown in Table 2.

Target gene Primer sequence Size (bp) MMP-2 Sense: GTATTTGATGGCATCGCTCA 196 bp
Antisense: CATTCCCTGCAAAGAACACA MMP-9 Sense: CACTGTCCACCCCTCAGAGC 263bp
Antisense: GCCACTTGTCGGCGATAAGG

As a result, mRNA expression of TGF-β1-induced MMP-2 and MMP-9 was decreased by the treatment of the extract of the present invention, and the degree of decrease was proportional to the treatment concentration of the extract 4).

Example  7. Everything  When the extract is α- SMA  Effect on production inhibition

In order to confirm the effect of the extract of the present invention on α-smooth muscle actin (α-SMA) which is an activation index of hepatic stellate cells generated by activation of TGF-β1 leading to liver injury, Respectively.

That is, the lysate buffer [20 mM Tris Cl (pH 7.5) was added to the hepatic stellate cells (LX-2 cells) for 10 min, 10 μg / ml and 100 μg / ml of TGF- ), 1% Triton X-100, 137 mM sodium chloride, 10% glycerol, 2 mM EDTA, 1 mM sodium orthovanadate, 25 mM beta glycerophosphate (b- 100 μl of 1 mM glycerophosphate, 2 mM sodium pyrophosphate, 1 mM phenylmethylsulfonylfluoride, and 1 mg / ml leupeptin) was scraped with a scraper and incubated at 15,000 ㅧ g for 30 minutes at 4 ° C And the debris was removed by centrifugation. 50 μg of the quantified protein was subjected to electrophoresis on 10% SDS-PAGE, transferred to Nitrocellulose paper and bound to the α-SMA antibody, and then the secondary antibody, horseradish peroxidase conjugated anti-rabbit IgG (horseradish peroxidase-conjugated anti-rabbit IgG) antibody. The degree of protein expression was determined using ECL detection reagents (Amersham Biosciences Corp., Piscataway, NJ, USA) and analyzed using an image analyzing system (Ultra-Violet Products Ltd., Tokyo, Japan) for densitometric analysis. , Upland, CA, USA) were used.

As a result of the analysis, it was confirmed that the protein expression of α-SMA induced by TGF-β1 was inhibited by the ascidian extract of the present invention, as shown in FIG.

Through the above experimental results, the inventors of the present invention have found that the extract of the present invention can inhibit liver damage, particularly liver damage caused by TGF-β1, and can inhibit TGF-β1-induced lower signaling It was found that the liver damage can be restored, improved and treated by controlling the expression and activity of various factors.

Claims (8)

A composition for treating or alleviating liver cirrhosis or liver fibrosis by inhibiting the activity of transforming growth factor beta 1 (TGF-beta 1)
Characterized in that it is obtained by adding freshly blossomed flowers of the corresponding flowers and adding 7.7 parts by weight of freshly blossomed flowers of dried flowers to 100 parts by weight of water and transferring the blossoming water for 3 hours to cure or relieve liver cirrhosis Composition. The method according to claim 1,
Wherein the composition inhibits the expression of Smad, PAI-1, MMP-2, MMP-9 and? -SMA activated by TGF-? 1. The method according to claim 1,
Wherein the extract is contained in an amount of 0.1 to 50% by weight based on the total weight% of the composition. delete delete delete delete A health functional food for preventing or alleviating liver cirrhosis or liver fibrosis comprising the composition of claim 1.

Images