KR101898260B1 - Bacillus amyloliquefacience having antibacterial activity and uses thereof - Google Patents

Abstract

The Bacillus amyloliquefaciens RD 7-7 strain of the present invention (Accession No. KACC 92071P) produces a lot of viscous substance when inoculated at the time of fermentation with Chungkukjang, and has protease, amylase activity and amino nitrogen It has excellent fermentation characteristics because it has high content and low odor components generated during fermentation process. It has antimicrobial activity against various microorganisms and inhibits the growth of Bacillus cereus when co-cultured with Bacillus cereus, which causes food poisoning, And can be usefully used for producing excellent and safe fermented food.

Description

Bacillus amyloliquefacience having antibacterial activity and uses thereof {Bacillus amyloliquefacience having antibacterial activity and uses thereof}

The present invention relates to Bacillus amyloliquefaciens strains exhibiting antibacterial activity and uses thereof.

Soybeans have been used in various ways as a raw material for traditional fermented food in Korea and as a functional material derived from plants. Soybeans contain a lot of functional ingredients such as isoflavone, saponin, phytic acid, and oligo-saccharides. During fermentation, microbial-derived enzymes decompose soybean fibrous components, intracellular sugars, and proteins, thereby improving digestibility, such as amide, peptone, polyglutamate, and polypeptide. It is known that physiologically active substances are produced, which lowers blood pressure, dissolves blood clots, has anti-cancer effects, and increases antioxidants.

The most important factor determining nutrition and quality in soybean fermented foods is the type of microorganism involved, and various physiologically active substances are produced according to strains and fermentation conditions, resulting in different functionalities. When fermenting soybean fermented foods such as cheonggukjang or meju in soybean paste, Bacillus bacillus present in rice straw has been used. Bacillus sp. derived from rice straw secretes various enzymes (protease, amylase, cellulase, etc.) to produce various metabolites having physiological activity. The secreted protease has the properties of casein decomposition and gelatin decomposition, and plays a role in creating a unique taste and aroma during fermentation. It is known that the off-flavor of soybean fermented foods is determined by the growth environment of microorganisms such as alkylpyrazine, ammonia compounds and sulfur-containing compounds produced from Bacillus bacteria, as well as moisture, salinity, and temperature. In order to reduce unpleasant odors, studies on the production of fermented soybean products using fermented strains having a low degree of production of compounds causing unpleasant odors or changing material components have been reported. The mucous product of soybean fermentation is produced by levan-type fructan and polyglutamate, which Bacillus bacteria synthesized using soybean sugar and proteins as substrates.

Bacillus strains are often developed as industrial enzyme-producing bacteria because of their excellent productivity of hydrolytic enzymes, and the production of beta-galactosidase (β-galactosidase) of Bacillus licheniformis derived from Cheonggukjang and Bacillus amyloliquefaciens (B. amyloliquefaciens) and Bacillus subtilis (B. subtilis), which produce proteolytic enzymes and thrombolytic enzymes, and B. pumilus reported as a strain with excellent immune enhancing activity. Became. In addition, studies on improving the quality of fermented soybeans using the strain as a starter have been reported. Bacillus bacteria used as starters are spore-forming bacteria that grow in soil or water, and most of them have the property of decomposing organic matter. Safety is widely recognized.

Bacillus cereus (Bacillus cereus) is a Gram-positive bacillus, arranged in a chain shape, and has a flagellum, so it has mobility. It has strong resistance to heat by forming spores and is aerobic, which proliferates well under oxygen conditions, and develops at 7~49℃, and the optimum temperature is 28~35℃. A distinctive feature from other Bacillus genus is that it has a β-hemolysis shape, and produces a lecithinase to produce a milky-white positivity around the colony in the egg yolk reaction.

Bacillus cereus is a type of soil bacteria, so it is widely distributed in nature such as soil, dust, and sewage, contaminated with plants, causing decay or food poisoning, and causing opportunistic infections to animals. The detection rate is high, but the incidence of food poisoning is relatively low. However, it has been attracting attention for a long time due to its high incidence in Europe such as the UK, and has recently been detected in various foods in Korea and is subject to regulation. To prevent food poisoning, it is necessary to kill these bacteria (or spores) in food, or to inhibit germination and prevent proliferation. The heat resistance of Bacillus cereus spores has been reported as 1.2~7.5 minutes at 100℃.

Bacillus cereus is known to cause two types of food poisoning. The first is vomiting food poisoning caused by ingesting a toxin (cereulide) produced by the growth of Bacillus cereus in food, and the other is intestinal intestine within the human intestine after ingesting the growth cells or spores of Bacillus cereus bacteria. It is a diarrhea-type food poisoning caused by the production of enterotoxin (FEMS Microbiol Rev. 2008 Jul;32(4): 579-606).

Bacillus amyloliquefacience (Bacillus amyloliquefacience) is an aerobic bacterium that forms spores, is known to have excellent protein and starch degrading enzyme activity, and produces a natural antibacterial protein, Barnase (ribonuclease). It is also a microorganism that can be used as a raw material for food.

While researching to develop a strain with excellent Bacillus cereus inhibitory activity and fermentation characteristics, the researchers of Bacillus amyloliquefacience RD7-7 isolated from rice miso produced a lot of mucilage when inoculated during fermentation of Cheonggukjang. , Protease, amylase activity and amino nitrogen content are high, and the off-flavor component generated during fermentation is low, so it has excellent fermentation properties, excellent antibacterial activity against various microorganisms, and causes food poisoning. The present invention was completed by confirming that the growth of Bacillus cereus was inhibited when co-cultured with Bacillus cereus.

FEMS Microbiol Rev. 2008 Jul;32(4): 579-606.

It is an object of the present invention to provide a Bacillus amyloliquefaciens RD7-7 strain exhibiting antibacterial activity and a use thereof.

In order to achieve the above object, the present invention provides a Bacillus amyloliquefaciens RD7-7 strain that exhibits antimicrobial activity entrusted with accession number KACC 92071P.

In addition, the present invention is a starter for fermentation comprising one or more selected from the group consisting of Bacillus amyloliquefaciens RD7-7 strain, a culture of the strain, a concentrate of the culture, and a dried product of the culture as an active ingredient ( starter).

In addition, the present invention provides a fermented food produced using the Bacillus amyloliquefaciens RD7-7 strain of the present invention or the starter for fermentation of the present invention.

In addition, the present invention provides a method for producing fermented food comprising the step of inoculating the Bacillus amyloliquefaciens RD7-7 strain of the present invention or the starter for fermentation of the present invention.

In addition, the present invention provides a pharmaceutical composition for antibacterial containing as an active ingredient Bacillus amyloliquefaciens RD7-7 strain showing antimicrobial activity entrusted with the deposit number KACC 92071P.

In addition, the present invention provides a health functional food for antibacterial containing as an active ingredient Bacillus amyloliquefaciens RD7-7 strain, which exhibits antimicrobial activity entrusted with deposit number KACC 92071P.

In addition, the present invention provides a feed additive for antibacterial containing as an active ingredient Bacillus amyloliquefaciens RD7-7 strain exhibiting antimicrobial activity entrusted with deposit number KACC 92071P.

Bacillus amyloliquefaciens RD7-7 strain of the present invention inhibits the growth of Bacillus cereus when co-cultured with Bacillus cereus, which causes food poisoning, has excellent antibacterial activity against various microorganisms, and is inoculated during fermentation of Cheonggukjang. If it does, it produces a lot of viscous substances, has high protease, amylase activity and amino nitrogen content, and has low off-flavor components generated during the fermentation process, so it has excellent fermentation properties and quality, and is suitable for the manufacture of safe fermented foods. It can be usefully used.

1 is a diagram illustrating the morphology of Bacillus amyloliquefacience RD7-7 strain observed with a scanning electron microscope.
2 is a diagram showing a standard curve of real-time PCR.
3 is a diagram showing the results of reverse transcription polymerase chain reaction (PCR) of groEL and nheA genes of Bacillus cereus in a co-culture of Bacillus cereus and Bacillus amyloliquefaciens RD7-7 strain.
Figure 4 is a diagram showing the quantitative real-time PCR (quantitative real-time polymerase chain reaction) results of the groEL and nheA genes of Bacillus cereus in the co-culture of Bacillus cereus and Bacillus amyloliquefaciens RD7-7 strain.
5 is a diagram showing the expression level of AtpB protein of Bacillus cereus in a co-culture of Bacillus cereus and Bacillus amyloliquefaciens RD7-7 strain by western blotting.
6 is a diagram showing the fermentation state of Cheonggukjang inoculated with Bacillus cereus and Bacillus amyloliquefaciens RD7-7 strains at different ratios.
7 is a diagram showing the expression level of the AtpB protein of Bacillus cereus in a fermented product of Cheonggukjang co-inoculated with Bacillus cereus and Bacillus amyloliquefaciens RD7-7 strains by western blotting.
8 is a diagram showing the results of measuring the number of microorganisms in a sample extract of fermented soybean inoculated with various Bacillus bacteria:
Control: experimental group not inoculated with Bacillus;
HJ18-4: Experimental group inoculated with Bacillus subtilis HJ18-4;
RD7-7: Experimental group inoculated with Bacillus amyloliquefaciens RD7-7;
HJ5-2: Experimental group inoculated with Bacillus amyloliquefaciens HJ5-2; And
HJ39-5: Experimental group inoculated with Bacillus amyloliquefaciens HJ39-5.
9 is a diagram showing the results of measuring protease and amylase activity in a sample extract of fermented soybean inoculated with various Bacillus bacteria:
Control: experimental group not inoculated with Bacillus;
HJ18-4: Experimental group inoculated with Bacillus subtilis HJ18-4;
RD7-7: Experimental group inoculated with Bacillus amyloliquefaciens RD7-7;
HJ5-2: Experimental group inoculated with Bacillus amyloliquefaciens HJ5-2; And
HJ39-5: Experimental group inoculated with Bacillus amyloliquefaciens HJ39-5.
10 is a diagram showing the result of measuring the reducing sugar content in a sample extract of fermented soybean inoculated with various Bacillus bacteria:
Control: experimental group not inoculated with Bacillus;
HJ18-4: Experimental group inoculated with Bacillus subtilis HJ18-4;
RD7-7: Experimental group inoculated with Bacillus amyloliquefaciens RD7-7;
HJ5-2: Experimental group inoculated with Bacillus amyloliquefaciens HJ5-2; And
HJ39-5: Experimental group inoculated with Bacillus amyloliquefaciens HJ39-5.
10 is a diagram showing the result of measuring amino nitrogen content in a sample extract of fermented soybean inoculated with various Bacillus bacteria:
Control: experimental group not inoculated with Bacillus;
HJ18-4: Experimental group inoculated with Bacillus subtilis HJ18-4;
RD7-7: Experimental group inoculated with Bacillus amyloliquefaciens RD7-7;
HJ5-2: Experimental group inoculated with Bacillus amyloliquefaciens HJ5-2; And
HJ39-5: Experimental group inoculated with Bacillus amyloliquefaciens HJ39-5.

Hereinafter, the present invention will be described in detail.

The present invention provides a Bacillus amyloliquefacience RD7-7 strain that exhibits antimicrobial activity entrusted with accession number KACC 92071P.

The strain is preferably isolated from rice miso, but is not limited thereto.

The antimicrobial activity is against any one selected from the group consisting of Listeria monocytogenes, Escherichia coli, Staphylococcus aureus, Salmonella enteric and Bacillus cereus. This is preferred, and according to a specific embodiment of the present invention, it is more preferred that it is Bacillus cereus.

Bacillus amyloliquefaciens RD7-7 strain of the present invention has excellent antimicrobial activity against various microorganisms (see Table 1), and when co-cultured with Bacillus cereus, which causes food poisoning, the groEL and nheA genes of Bacillus cereus It reduces the expression and expression of AtpB protein (see FIGS. 3 to 5), produces a lot of mucous substances during fermentation of Cheonggukjang (see FIG. 6), and has protease, amylase activity, and amino nitrogen content. It is high (see Figs. 9 to 11), and the off-flavor component generated during the fermentation process is low (Table 9), so it can be used to manufacture fermented foods with excellent safety and quality.

In addition, the present invention is a starter for fermentation comprising one or more selected from the group consisting of Bacillus amyloliquefaciens RD7-7 strain, a culture of the strain, a concentrate of the culture, and a dried product of the culture as an active ingredient ( starter).

The fermentation starter refers to a preparation or composition comprising any one selected from the group consisting of a microorganism including lactic acid bacteria or bacteria involved in fermentation, a culture thereof, a concentrate of the culture, and a dried product of the culture, and fermentation The dragon starter is used to provide microorganisms that can grow in fermented foods or dominant species by adding them in the production of fermented foods. In the case of manufacturing fermented food using the fermentation starter, the quality of the fermented food can be regulated by microorganisms included in the fermentation starter, or the speed or stage of fermentation can be controlled, and fermentation that achieves a specific purpose You can make food. In addition, the fermentation starter may further include commonly used additives.

Bacillus amyloliquefaciens RD7-7 strain of the present invention inhibits the growth of Bacillus cereus when co-cultured with Bacillus cereus, which causes food poisoning, has excellent antibacterial activity against various microorganisms, and is inoculated during fermentation of Cheonggukjang. If so, it produces a lot of viscous substances, has high proteolytic enzyme, amylase activity and amino nitrogen content, and has low off-flavor components generated during the fermentation process, so it is useful as a starter for fermentation in the manufacture of safe fermented foods with excellent fermentation properties and quality. Can be used.

In addition, the present invention provides a fermented food produced using the Bacillus amyloliquefaciens RD7-7 strain or the fermentation starter of the present invention.

The fermented food refers to a food prepared by adding one or two or more microorganisms such as lactic acid bacteria or enzymes and using the fermentation action of the microorganism, and in detail, a food prepared by adding and aging fermented food seeds to a food substrate. it means. The fermented food includes all non-sterile open fermented foods such as alcoholic beverages, breads, kimchi, salted fish, miso, soy sauce, cheese, butter, and yogurt.

The fermented food may be Cheonggukjang, and in the case of Cheonggukjang prepared by adding the Bacillus amyloliquefaciens RD7-7 strain or a fermentation starter, Bacillus amyloliquefaciens RD7-7 strain causes food poisoning. The growth of cereus is inhibited, and the safety, taste and flavor of chungkukjang are improved because proteolytic enzyme, amylase enzyme activity, and amino nitrogen content are high.

The Bacillus amyloliquefaciens RD7-7 strain or fermentation starter can be applied to any food field manufactured by fermenting food ingredients including soybeans.

The fermented food can be prepared by adding and aging the Bacillus amyloliquefaciens RD7-7 strain or a fermentation starter to the food, and at this time, the amount of strain used is appropriately adjusted according to the type of fermented food and the type of spawn. good.

Bacillus amyloliquefaciens RD7-7 strain of the present invention inhibits the growth of Bacillus cereus when co-cultured with Bacillus cereus, which causes food poisoning, has excellent antibacterial activity against various microorganisms, and is inoculated during fermentation of Cheonggukjang. If it does, it generates a lot of mucous substances, has high proteolytic enzyme, amylase activity and amino nitrogen content, and has low off-flavor components generated during the fermentation process, so it can be usefully used in the manufacture of safe fermented foods with excellent fermentation properties and quality. have.

In addition, the present invention provides a fermented food manufacturing method comprising the step of inoculating the Bacillus amyloliquefaciens RD7-7 strain or the starter for fermentation of the present invention.

The fermented food manufacturing method may be a cheonggukjang manufacturing method, and in the case of a cheonggukjang manufacturing method comprising the step of inoculating the Bacillus amyloliquefaciens RD7-7 strain or a fermentation starter, soybeans are immersed at 20°C for 18 hours Then increasing the temperature at 100° C. for 2 hours; Cooling the increased soybeans to 40° C. or less, and inoculating and mixing the Bacillus amyloliquefaciens RD7-7 strain or fermentation starter selection strain on soybeans; And fermenting for 36 hours in an incubator at a humidity of 70% and a temperature of 37°C.

Bacillus amyloliquefaciens RD7-7 strain of the present invention inhibits the growth of Bacillus cereus when co-cultured with Bacillus cereus, which causes food poisoning, has excellent antibacterial activity against various microorganisms, and is inoculated during fermentation of Cheonggukjang. If so, it produces a lot of viscous substances, has high proteolytic enzyme, amylase activity and amino nitrogen content, and has low off-flavor components generated during the fermentation process. I can.

In addition, the present invention provides a pharmaceutical composition for antibacterial comprising Bacillus amyloliquefaciens RD7-7 strain showing antimicrobial activity entrusted with deposit number KACC 92071P.

The Bacillus amyloliquefaciens RD7-7 strain is preferably isolated from rice miso, but is not limited thereto.

The antimicrobial activity is any one or more selected from the group consisting of Listeria monocytogenes, Escherichia coli, Staphylococcus aureus, Salmonella enteric and Bacillus cereus. It is preferable that it is antibacterial activity against, and according to a specific embodiment of the present invention, it is more preferable that it is Bacillus cereus.

The composition of the present invention contains 0.1 to 99.9% by weight of an active ingredient including the Bacillus amyloliquefacians RD7-7 strain of the present invention based on the total weight of the composition, and contains a pharmaceutically acceptable carrier, excipient, or diluent. can do.

The composition of the present invention may be in various oral or parenteral dosage forms. In the case of formulation, it is prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants that are usually used. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and these solid preparations include at least one excipient in one or more compounds, such as starch, calcium carbonate, sucrose, or lactose ( lactose), gelatin, etc. In addition, in addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral administration include suspensions, liquid solutions, emulsions, syrups, etc., but may include various excipients, such as wetting agents, sweeteners, fragrances, and preservatives, in addition to water and liquid paraffin, which are commonly used simple diluents. have. Preparations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, and suppositories.

As the non-aqueous solvent and the suspension solvent, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate may be used. As a base for suppositories, witepsol, macrogol, twin tween) 61, cacao butter, laurin paper, glycerogelatin, and the like may be used.

The composition of the present invention may be administered orally or parenterally, and when administered parenterally, it is preferable to select an injection method for external use of the skin or intraperitoneal, rectal, intravenous, muscle, subcutaneous, intrauterine dural or cerebrovascular injection. It is used externally to the skin.

The dosage of the composition of the present invention varies depending on the patient's weight, age, sex, health status, diet, administration time, administration method, excretion rate, and severity of disease, and the daily dosage is Bacillus amyloliquefaciens. Based on the amount of the active ingredient containing the RD7-7 strain, 0.01 to 1000 mg, preferably 30 to 500 mg / kg, more preferably 50 to 300 mg / kg, to be administered 1 to 6 times a day. I can.

The composition of the present invention can be used alone or in combination with surgery, radiation therapy, hormone therapy, chemotherapy, and methods using biological response modifiers.

In addition, the present invention provides a health functional food for antibacterial comprising Bacillus amyloliquefacience RD7-7 strain showing antimicrobial activity entrusted with deposit number KACC 92071P.

The health functional food of the present invention may contain various flavoring agents or natural carbohydrates as additional ingredients. The natural carbohydrates described above are monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As the sweetener, natural sweeteners such as taumatin and stevia extract, or synthetic sweeteners such as saccharin and aspartame can be used. The ratio of the natural carbohydrate may be selected from 0.01 to 0.04 parts by weight, specifically about 0.02 to 0.03 parts by weight per 100 parts by weight of the health functional food of the present invention.

In addition to the above, the health functional food of the present invention includes various nutrients, vitamins, electrolytes, flavors, coloring agents, pectic acid and salts thereof, alginic acid and salts thereof, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, Carbonating agents used in carbonated beverages and the like may be contained. These components may be used independently or in combination. Although the ratio of these additives is not very important, it is generally selected from 0.01 to 0.1 parts by weight per 100 parts by weight of the health food of the present invention.

In addition, the present invention provides an antibacterial feed additive comprising Bacillus amyloliquefacience RD7-7 strain, which exhibits antimicrobial activity entrusted with deposit number KACC 92071P.

Since the feed additive has antimicrobial activity, it is possible to prevent bacterial diseases by constantly ingesting them by poultry, livestock, etc., and to improve bacterial diseases that have already occurred. Feed can be classified into several categories depending on nutritional value, main ingredient, distribution, moisture content, blending status, and processing type, and forage, roughage, thick feed, supplemental feed, protein feed, starch feed, fatty feed or fiber feed can be used. .

The feed additive may additionally contain an acceptable carrier, for example, the feed additive may be used as it is or a known carrier or stabilizer may be added. In addition, if necessary, various nutrients such as vitamins, amino acids, minerals, antioxidants, antibiotics, antibacterial agents, and other additives may be added, and the shape may be powder, granules, pellets, suspensions, etc. . The feed additive of the present invention may be supplied alone or mixed with feed.

Hereinafter, the present invention will be described in detail by examples and experimental examples.

However, the following examples and experimental examples are merely illustrative of the present invention, and the contents of the present invention are not limited by the following examples and experimental examples.

<Example 1> Confirmation of various antibacterial spectra of fermented microorganisms derived from fermented soybean food

To confirm the antibacterial spectrum of fermented microorganisms derived from fermented soybean food, Listeria monocytogenes, Escherichia coli, Staphylococcus aureus, Salmonella enteric and Bacillus cereus ) Was subjected to an agar spot assay.

<1-1> Bacillus amyloliquefaciens RD7-7 strain identification method

The strain identification of Bacillus amyloliquefaciens RD7-7 was analyzed by 16r DNA Sequencing. 16S rDNA gene sequencing was performed by extracting the chromosomal DNA of the strain according to the manufacturer's instructions using a DNA separation kit (GenEX genomic Sx DNA kit, GeneAll Biotechnology Co., Seoul, Korea). After amplifying the 16S rDNA gene fragment of the isolated strain by polymerase chain reaction (PCR) using primers'-AGAGTTTGATCATGGCTCAG-3', SEQ ID NO: 13) and 1492R (5'-GGATACCTTGTTACGACTT-3', SEQ ID NO: 14), The base sequence was analyzed (Genocell, Daejeon, Korea). The results were compared with the nucleotide sequence of the NCBI GenBank database (http://ncbi.nlm.nih.gov) to confirm the phylogenetic relationship.

<1-2> Baby Spot Assay

After dispensing nutrient agar containing 0.5% of food poisoning-causing bacteria (OD: 0.4) into a petri dish and hardening it at room temperature, 10 μl each of the selected strains (OD: 0.4) isolated from soybean release foods After dropping onto the medium and incubating for 24 to 48 hours at 37°C, the diameter of the generated clear zone was measured to measure the activity (-, not shown; +, 0.30 mm; ++, 0.31-0.5 mm; and ++) +, 0.51-0.80 mm).

As a result, as shown in Table 1, it was possible to confirm the antibacterial activity of the fermenting microorganisms, and Bacillus amyloliquefaciens RD7-7 strain having excellent antibacterial activity against Bacillus cereus was selected, and the form of the strain is shown in FIG. Shown (Fig. 1).

name Bell Antibacterial activity R1 ¹ R2 ² R3 ³ R4 ⁴ R11 ⁵ RD5-4 Bacillus amyloliquefaciens subsp .
plantarum FZB42(T) + + + + RD7-5 Bacillus tequilensis NRRL B-41771(T) +++ ++ + ++ RD7-7 Bacillus amyloliquefaciens subsp . amyloliquefaciens DSM 7(T) ++ ++ + ++ +++ RD12-3 Bacillus amyloliquefaciens subsp . amyloliquefaciens DSM 7(T) - - - - - RD13-6 Bacillus subtilis subsp .
inaquosorum BGSC 3A28(T) - - - - - RD13-9 Bacillus methylotrophicus CBMB205(T) - - - - - HJ11-1 Bacillus subtilis strain ZT-4-5 + - + + - HJ11-3 Bacillus subtilis strain BRZ6 ++ - + + +

¹ Listeria monocytogenes, ² Escherichia coli, ³ Staphylococcus aureus, ⁴ Salmonella enteric and ⁵ Bacillus cereus

< Experimental Example 1> Bacillus Amyloliquefascience ( Bacillus amyloliquefaciens ) Confirmation of the growth inhibitory effect of Bacillus cereus KACC10004 of RD7-7 strain

<1-1> Confirmation of growth inhibition of Bacillus cereus strain by measuring the number of bacteria

In order to confirm the Bacillus amyloliquefaciens RD7-7 strain inhibiting the growth of Bacillus cereus, the two bacteria were co-cultured and the number of bacteria was measured.

Specifically, Bacillus cereus 0.5% and Bacillus amyloliquefacience RD7-7 0.125%, 0.25%, 0.5% and 1% were mixed and inoculated in 5 ml of LB medium (Luria-Bertani broth) and cultured at 37°C for 24 hours After that, it was diluted 10 steps in a sterilized saline solution by a decimal dilution method. Then, the dilution was dispensed into a Bacillus cereus selective medium, CHROMagar, and cultured at 37° C. for 24 hours, and the number of Bacillus cereus strains was measured.

As a result, as shown in Table 2, the experimental group in which Bacillus cereus and Bacillus amyloliquefaciens RD7-7 strain were co-cultured inhibited the growth of Bacillus cereus depending on the concentration of Bacillus amyloliquefaciens RD7-7 strain. The experimental group co-cultured with the control Bacillus amyloliquefaciens R48 KACC 15866 strain did not inhibit the growth of Bacillus cereus (Table 2).

Sample cfu/ml Survival rate (%) Control (Bacillus cereus KACC10004) 2.65×10 ⁸ Bacillus amyloliquefaciens
RD 7-7 0.13% 2.71×10 ⁷ 88.24 0.25% 1.36×10 ⁷ 84.67 0.50% 9.35×10 ⁵ 70.88 One% 4.20×10 ³ 43.01 Bacillus amyloliquefaciens
KACC 15866 0.13% 3.40×10 ⁸ 101.28 0.25% 2.70×10 ⁸ 100.10 0.50% 3.05×10 ⁸ 100.72 One% 3.00×10 ⁸ 100.64

<1-2> Real-time Polymerase chain reaction ( real time polymerase chain reaction ) ThisConfirmation of inhibition of the growth of dissolved Bacillus cereus

In order to confirm the growth inhibitory effect of Bacillus cereus in the culture broth co-cultured with Bacillus cereus and Bacillus amyloliquefaciens RD7-7 strains of Experimental Example <1-1>, real time polymerase chain reaction (PCR) was performed. Performed.

Specifically, Bacillus cereus 0.5% and Bacillus amyloliquefaciens RD7-7 0.125%, 0.25%, 0.5% and 1% co-cultured culture solution was diluted stepwise by 10, 100, 500 and 1000 times to QIAamp DNA mini DNA was extracted according to the manufacturer's protocol using kit (QIAGEN, USA). Thereafter, real-time PCR was performed on the groEL gene using a Bacillus cereus real time PCR kit under the conditions of Table 3 below, and the standard curve is the co-culture solution diluted by 10, 100, 500 and 1000 times. It was derived using the number of strains on one medium and the threshold cycle (C(t)) value of real-time PCR.

PCR step Temperature time Number of cycles Uracil-N-glycosylase 50℃ 2 minutes One preheat 95℃ 10 minutes One Denaturation 95℃ 30 seconds 40 Annealing 55℃ 50 seconds

As a result, a standard curve was derived as shown in FIG. 2 (FIG. 2), and as shown in Table 4, it was confirmed that the growth of Bacillus cereus was inhibited by the Bacillus amyloliquefaciens RD7-7 strain, which It exhibited the same tendency as the opinion of Experimental Example <1-1>.

Sample C(t) y =-3.9756x+49.693
log cfu/ml Control (Bacillus cereus KACC10004) 18.46 7.86 Bacillus amyloliquefaciens
RD 7-7 0.125% 19.08 7.70 0.25% 21.29 7.14 0.5% 23.41 6.61 One% 25.07 6.19 Bacillus amyloliquefaciens
KACC 15866 0.125% 16.85 8.26 0.25% 15.99 8.48 0.5% 16.47 8.36 One% 16.64 8.31

<1-3> Confirmation of inhibition of growth of Bacillus cereus through confirmation of the amount of transcription of toxin-related genes

In order to confirm the growth inhibitory effect of Bacillus cereus, the amount of transcription of the groEL and nheA genes, which are toxin-related genes of Bacillus cereus, was confirmed.

Specifically, mRNA was extracted from the co-culture solution of Experimental Example <1-1> using RNeasy plus mini kit (QIAGEN), and cDNA using a cDNA synthesis kit (amfiRivert Platinum cDNA synthesis Master Mix, GenDEPOT) from the mRNA Was synthesized. Then, using the synthesized cDNA, check the expression level of the gene by reverse transcription PCR (reverse transcription PCR, RT-PCR), and use iQ™ SYBR® Green Supermix (Bio-Rad) to determine the CFX96 Touch™ Real-Time Signals were quantified in the PCR Detection System and quantitatively compared and measured. PCR conditions and primers are as shown in Tables 5 and 6 below.

step Temperature time Number of cycles Early denaturation and enzymatic activity 95℃ 3 minutes One denaturalization 95℃ 15 seconds 33 (RT-PCR)
40 (qPCR) Combination 55℃ 30 seconds kidney 72℃ 30 seconds (qPCR) Melting curve 72℃ 30 seconds One

Sequence number primer Sequence (5'→3') Usage One groEL -L TGCAACTGTATTAGCACAAGCT RT-PCR, qPCR 2 groEL -R TTACCAACGCGCTCCATTGCTT RT-PCR, qPCR 3 nheA -L GTTAGGATCACAATCACCGC RT-PCR, qPCR 4 nheA -R ACGAATGTAATTTGAGTCGC RT-PCR, qPCR 5 nheC -L TGGATTCCAAGATGTAACG RT-PCR, qPCR 6 nheC -R ATTACGACTTCTGCTTGTGC RT-PCR, qPCR 7 entFM -L AAAGAAATTAATGGACAAACTCAAACTCA RT-PCR, qPCR 8 entFM -R GTATGTAGCTGGGCCTGTACGT RT-PCR, qPCR 9 ces -L GGTGACACATTATCATATAAGGTG RT-PCR, qPCR 10 ces -R ATTCAACATAATATTATACGCCGT RT-PCR, qPCR 11 16s-rRNA-L AGAGTTTGATCCTGGCTCAG RT-PCR, qPCR 12 16s-rRNA-R GGCTACCTTGTTACGACTT RT-PCR, qPCR

As a result, as shown in Figs. 3 and 4, the Bacillus amyloliquefaciens RD7-7 strain decreases the amount of transcription of the groEL and nheA genes of the Bacillus cereus strain in a concentration-dependent manner (Figs. 3 and 4). It was confirmed that the growth of the mouse was inhibited.

<1-4> Confirmation of inhibition of growth of Bacillus cereus through confirmation of AtpB protein expression level

To confirm the growth inhibitory effect of Bacillus cereus, western blotting was performed to confirm the expression level of the AtpB protein.

Specifically, SDS sample buffer was added to the cell pellet obtained by centrifuging the co-culture solution at 10,000 X g for 5 minutes, denatured at 100° C. for 10 minutes, and electrophoresis on a 12% SDS polyacrylamide gel. After electrophoresis, the gel was transferred to a nitrocellulose membrane. After blocking the membrane for 1 hour, an anti-AtpB primary antibody (Affinity purified rabbit anti-AtpB, Agrisera, Vannas, Sweden) was added and reacted for 1 hour, and TBS-T (Tris-buffered saline with 0.1%) Tween-20) solution was washed three times at 10 minute intervals. The membrane was again put into a horseradish peroxidase (HRP)-conjugated goat IgG secondary antibody (Bio-Rad, USA) solution and reacted for 1 hour. Thereafter, the membrane was washed three times with a TBS-T solution at intervals of 10 minutes and developed by sensitizing the X-ray film using a BM chemiluminescence blotting substrate (POD) (Roche, Mannheim, Germany). .

As a result, as shown in FIG. 5, it was confirmed that the Bacillus amyloliquefaciens RD7-7 strain reduced the expression of the AtpB protein of Bacillus cereus in a concentration-dependent manner compared to the control group (FIG. 5).

< Experimental Example 2> In soybean fermentation (Cheonggukjang) Bacillus Amyloliquefacience Confirmation of fermentation characteristics of RD 7-7 strain

In order to confirm the fermentation characteristics of Bacillus amyloliquefaciens RD7-7 strain and the growth inhibition effect of Bacillus cereus in soybean fermentation, experiments were conducted as follows.

<2-1> Preparation of fermented soybeans

Specifically, in order to prepare a fermented soybean, soybeans were immersed at 20°C for 18 hours and then increased at 100°C for 2 hours. Increased soybeans were cooled to 40°C or less, and then 1% (v/w) of ^{a culture medium (OD: 0.5, 10 8} CFU/ml) obtained by culturing the selected strain on 1 kg of soybeans in LB medium (Difco, USA) for 18 hours. ) After inoculation and mixing, it was placed in a styrofoam box (21×27×1.8 cm), and the control group was spontaneously fermented without inoculating the strain. Bacillus amyloliquefaciens RD7-7 strain and Bacillus cereus were inoculated at different rates, and fermentation conditions were fermented for 36 hours in an incubator with a humidity of 70% and a temperature of 37°C to prepare a soybean fermentation product.

<2-2> In soybean fermentation Bacillus Determine amyl Lowry kwipe Fermentation and Bacillus cereus growth inhibitory effect of sieon's RD7-7 strain

As a result, it was confirmed that sample 1 fermented by inoculating Bacillus amyloliquefaciens RD7-7 strain as shown in FIG. 6 had a much greater amount of gradual matter than the control group not inoculated with the bacteria, Bacillus amyloliquefé It was found that the fermentation properties of Seaence RD7-7 strain were excellent. In addition, in Sample 2, which was fermented by inoculating only Bacillus cereus, there was no gradual product, and it was confirmed that there was a pleasant smell, indicating that normal fermentation was not performed. In particular, in Samples 3 and 4 fermented by mixing Bacillus amyloliquefaciens RD7-7 and Bacillus cereus at 9:1 or 5:5, a lot of gradual products were generated due to the influence of Bacillus amyloliquefascience RD7-7. I could confirm that. (Fig. 6).

<Experimental Example 3> Confirmation of the growth inhibition effect of Bacillus cereus in fermented soybeans

In order to confirm the effect of inhibiting Bacillus cereus growth by Bacillus amyloliquefaciens RD7-7 strain in soybean fermentation, proteins were isolated from soybean fermented cells collected after pretreatment according to the method of Experimental Example <1-4>. And analysis to confirm the expression level of the AtpB protein.

As a result, it was confirmed that the expression level of AtpB protein decreased depending on the concentration of the RD7-7 strain when co-inoculated with the RD7-7 strain and Bacillus cereus, as shown in FIG. 7, and that the growth of Bacillus cereus was inhibited. It was found (Fig. 7).

<Experimental Example 4> Confirmation of fermentation characteristics of Bacillus amyloliquefaciens RD 7-7 strain

In order to confirm the fermentation characteristics of Bacillus amyloliquefaciens RD 7-7 strain, the experiment was performed as follows.

<4-1> Preparation of fermented soybeans and preparation of sample extract

Soybean fermentation was prepared according to the method of Experimental Example <2-1>, and the inoculated strains were Bacillus amyloliquefaciens RD7-7, Bacillus subtilis HJ18-4, Bacillus amyloliquefaciens HJ5-2, Bacillus amyloliquefacience HJ39-5 were used.

The sample extract was homogenized to 100 ml by adding distilled water to 20 g of soybean fermented product, and then centrifuged (8,000×g, 10 min) to use the supernatant as a sample extract.

<4-2> Measurement of the number of microorganisms

In the sample extract obtained from the fermented soybean of Experimental Example <6-1>, the number of microorganisms was measured in the following manner.

Specifically, 1 g of each sample extract was diluted in 10 steps by a decimal dilution method using sterile physiological saline, and the diluted solution was incubated in a plate count agar (Difco) (37° C., 24 hours), The number of bacteria was counted, and the number of lactic acid bacteria was cultivated under anaerobic conditions (37° C., 48 hours) using a gas pack (gas pack, Oxoid, Hampshire, England) in a diluted solution (MRS agar, Difco). CFU/g).

As a result, as shown in FIG. 8, the control group had the lowest number of bacteria at 1.12×108 CFU/ml, and the fermented product inoculated with Bacillus amyloliquefacians HJ5-2 was the most at 3.00×109 CFU/ml. It was high. There is a difference in the number of viable bacteria according to the strain type, and as a result of measuring the number of lactic acid bacteria, the control group without inoculation of the bacteria had the highest number of bacteria at 1.40×108 CFU/ml, and the fermented soybean inoculated with the strain was 2.50×102 The number of bacteria was lower than that of the control group at ~7.30×104 CFU/ml. It is believed that this was a dominant species by inoculating Bacillus bacteria and inhibited the production of other bacteria (FIG. 8).

<4-3> Enzyme activity measurement

The activity of the protease was measured by modifying a known method (Korean J Food Sci Technol 30: 1333-13380). Specifically, 0.6% casein substrate solution (0.2 M phosphate buffer, pH 7.0) was added to 1 ml of the sample extract and reacted at 37° C. for 10 minutes. After the reaction, 5 ml of 0.44 M trichloroacetic acid (TCA) was added to stop the reaction. After that, the mixture was allowed to stand at room temperature for 30 minutes, and 5 ml of a 0.55 M sodium carbonate (Na2CO3) solution and a 4-fold diluted Folin reagent solution in 2 ml of the filtrate filtered through a filter paper (No.2, Whatman, Buckinghamshire, UK) After adding 1 ml, reacting at room temperature for 30 minutes, absorbance was measured at 660 nm. Standard tyrosine (tyrosine) was diluted step by step and analyzed by the same method, and 1 unit was calculated by converting the amount of releasing 1 µg of tyrosine for 1 minute using a standard curve.

Alpha-amylase activity was measured by the DUN (Dextrinogenic Unit of Nagase, Yoon KS. 1988., Kunkuk University, Seoul, Korea) method. Specifically, 1 ml of the sample extract was added to 3 ml of 1% soluble starch (in 0.02 M phosphate buffer, pH 7.0), reacted at 40° C. for 10 minutes, and then 10 ml of 1 M hydrochloric acid was added to stop the reaction. After adding 10 ml of an iodine solution (0.005% I2+0.05% KI) to color development, absorbance was measured at 660 nm. In the case of a blank test, 10 ml of 1 M hydrochloric acid (HCl) was added to stop the reaction, and then the sample extract was added to react and color. The amount of 1 ml of the crude enzyme solution decomposed 0.1 mg of starch in 1 minute was 1 It was calculated in units.

As a result, as shown in FIG. 9, the result of measuring protease activity showed that the soybean fermented product inoculated with Bacillus amyloliquefaciens RD7-7 strain had the highest activity at 647.92 unit/ml, and the strain was inoculated. The non-control group showed the lowest activity at 318.13 unit/ml. Since strains with high protein activity have been reported to reduce off-flavor and improve taste of Cheonggukjang, it was confirmed that the Bacillus amyloliquefaciens RD7-7 strain of the present invention can be usefully used in the production of Cheonggukjang (Fig. 9). ).

In addition, as shown in FIG. 9, the alpha-amylase activity was the highest in the control group not inoculated with the strain at 33.39 unit/ml, which is believed to be due to the influence of various microorganisms due to natural fermentation. Soybean fermentation products inoculated with Bacillus amyloliquefaciens RD7-7 or Bacillus subtilis HJ18-4 showed the highest activity at 20.82 and 18.45 unit/ml, respectively. Since amylase activity can be said to be an important enzyme in terms of quality because it is involved in the sweetness component of sugar, it was confirmed that the RD7-7 strain of the present invention can be usefully used in the production of cheonggukjang (FIG. 10).

<4-4> Measurement of reducing sugar

The reducing sugar content was measured by the DNS method (dinitrosalicylic acid, Anal Biochem 2: 127-132.). Specifically, 1 ml of the diluted sample extraction solution was added to 3 ml of the DNS reagent, reacted at 37°C for 5 minutes, cooled, and then the absorbance was measured at 550 nm, and the reducing sugar content was calculated from a standard curve using glucose.

As a result, as a result of measuring the amount of reducing sugar as shown in FIG. 10, the content was 1.31 to 2.35%, and the soybean fermented product inoculated with Bacillus subtilis HJ18-4 was found to have a high content (2.35%).

<4-5> Measurement of amino nitrogen

The amino nitrogen content was measured by a known Formol titration method (Korean J Food Preserv 14: 356-363.). Specifically, 2 to 3 drops of 0.5% phenolphthalein solution were added to a mixture of 5 ml of sample extract, 10 ml of neutral formalin and 10 ml of distilled water, and 0.1 N sodium hydroxide (NaOH) was added thereto. It was calculated using the appropriate amount until it became pale red and the appropriate amount of the blank experiment.

As a result, as shown in FIG. 11, the amino nitrogen measurement result showed a content of 112.85 ~ 227.69 mg%, and Bacillus amyloliquefacience RD7-7, which had high protease activity, had the highest content of 227.96 mg%. Amino nitrogen is used as a measure of the degree of fermentation of soybean fermented foods as it originates from amino acids produced by proteolytic enzymes produced by microorganisms during fermentation and fermentation. Therefore, soybean fermentation products inoculated with Bacillus amyloliquefacience RD7-7 It was confirmed that this fermentation was carried out a lot.

<4-6> Measurement of amino acids and organic acids

The free amino acid content was analyzed according to a known method (Korean J Food & Nutr 25:505-512.). Specifically, 3 g of the sample extract was taken, 30 ml of 70% ethanol was added, homogenized for 1 hour, and centrifuged at 21,000×g for 15 minutes. Then, the supernatant was repeatedly extracted twice with 25 ml of 70% ethanol, and the extracts were combined and concentrated under reduced pressure with a rotary evaporator (EYELA A-3S, Rikakikai Co., Ltd., Tokyo, Japan). This concentrate was dissolved in 20 ml of 0.02 N hydrochloric acid, diluted 10-fold, filtered through a 0.45 μm membrane filter (Merck Millipore, Darmstadt, Germany), and analyzed using an automatic amino acid analyzer (Blochrom 30, Biochrom Ltd., Cambrdge, UK). I did.

In addition, for analysis of the organic acid content, 3 g of the sample extract and 30 ml of distilled water were placed in a 50 ml flask and sonicated for one hour. After cooling to room temperature, distilled water was filled to the mark, filtered through filter paper (No.2, Whatman), filtered through a 0.45 µm membrane filter (Merck Millipore), and used as a test solution. The organic acid standard was dissolved in the same solvent as the sample and used to prepare a calibration curve. Organic acid analysis was performed by high-performance liquid chromatography (HPLC, Agilent technologies, Palo Alto, CA, USA), and the column was cap cell pak C18-AQ (80A, Shiseido, Tokyo, Japan), and a detector ( detector) was UV 210 nm, the mobile phase was _{analyzed using 0.1 M first ammonium phosphate (NH 4} H ₂ PO ₄ , pH 2.5) and the flow rate was 1.0 ml/min.

As a result, as shown in Table 7, the amino acid content of glutamic acid was detected the most with 3.18-3.39%, aspartic acid 1.87-2.07%, leucine 1.28-1.48%, and Lysine was detected in the order of 1.05-1.18% and arginine 1.03-1.32%. The total amino acid content was the highest at 18.38 and 17.07% of soybean fermented products inoculated with Bacillus amyloliquefaciens HJ5-2 and Bacillus amyloliquefaciens HJ39-5 (Table 7). During soybean fermentation, proteins are decomposed by various enzymes derived from Bacillus sp., glutamic acid and aspartic acid, which have a bitter taste, valine, isoleucine, and leucine. , Methionine and phenylalanine, sweet alanine, glycine, and free amino acids such as lysine are produced and combined to give the unique taste and flavor of fermented soybeans (J Agric Food Chem 48: 716-723.).

amino acid(%) Control ¹ RD7-7 ² HJ5-2 ³ HJ18-4 ⁴ HJ39-5 ⁵ Aspartic acid 1.87 1.90 2.07 1.89 1.92 Threonine 0.57 0.57 0.61 0.54 0.57 Serine 0.83 0.82 0.85 0.81 0.84 Glutamic acid 3.18 3.25 3.39 3.38 3.31 Proline 0.90 0.99 1.09 0.91 0.93 Glycine 0.69 0.71 0.75 0.69 0.71 Alanine 0.78 0.76 0.91 0.77 0.78 Cysteine 0.09 0.07 0.08 0.08 0.08 Valine 0.89 0.90 0.99 0.89 0.93 Methionine 0.20 0.19 0.23 0.19 0.22 Isoleucine 0.81 0.83 0.91 0.80 0.83 Leucine 1.38 1.38 1.48 1.28 1.37 Tyrosine 0.60 0.60 0.70 0.54 0.64 Phenylalanine 0.94 0.97 1.07 1.02 0.94 Histidine 0.46 0.46 0.51 0.48 0.46 Lysine 1.08 1.07 1.18 1.05 1.06 Arginine 1.31 1.22 1.32 1.03 1.21 Tryptophan 0.27 0.27 0.27 0.25 0.27 Total amount 16.83 16.94 18.38 16.62 17.07

¹ control group: experimental group not inoculated with Bacillus, ² HJ18-4: experimental group inoculated with ^{Bacillus subtilis HJ18-4, 3} RD7-7: experimental group inoculated with Bacillus amyloliquefascience RD7-7, ⁴ HJ5-2 : Experimental group inoculated with ^{Bacillus amyloliquefascience HJ5-2, and 5} HJ39-5: Experimental group inoculated with Bacillus amyloliquefascience HJ39-5.

In addition, as shown in Table 8, as for the organic acid content, oxalic acid was detected from 36.51 to 63.57 mg/100 g in all experimental groups, and succinic acid was 600.15 to 600.15 in the control and RD7-7 inoculated soybean fermented products. 429.49 mg/100 g was detected (Table 8). In the case of the control group, a higher organic acid content was detected than the soybean fermentation product inoculated with the strain, which is due to the production of organic acid by lactic fermentation, which is considered to be associated with a higher number of lactic acid bacteria in the control group than that of the Bacillus inoculated fermentation product.

Organic acid (mg/100 g) Control ¹ RD7-7 ² HJ5-2 ³ HJ18-4 ⁴ HJ39-5 ⁵ Citric acid Non-detection Non-detection Non-detection Non-detection Non-detection Succinic acid 600.15 429.49 Non-detection Non-detection Non-detection Lactic acid Non-detection Non-detection Non-detection Non-detection Non-detection Oxalic acid 63.57 57.05 40.3 65.28 36.51 Fumaric acid Non-detection Non-detection Non-detection Non-detection Non-detection Malic acid Non-detection Non-detection Non-detection Non-detection Non-detection

¹ control group: experimental group not inoculated with Bacillus, ² HJ18-4: experimental group inoculated with ^{Bacillus subtilis HJ18-4, 3} RD7-7: experimental group inoculated with Bacillus amyloliquefascience RD7-7, ⁴ HJ5-2 : Experimental group inoculated with ^{Bacillus amyloliquefascience HJ5-2, and 5} HJ39-5: Experimental group inoculated with Bacillus amyloliquefascience HJ39-5.

<4-7> Fragrance analysis

Add 10 ml of the extraction solvent (diethyl ether: pentane=1:1) to 2 g of the sample extract, extract with shaking (20°C, 15 hr), centrifuge (8,000 rpm, 10 min) and add sodium sulfate to the supernatant. ) 1 g was added to adsorb moisture. Thereafter, the supernatant was filtered (No. 2, Whatman), and the filtrate was re-filtered using a 0.2 µm syringe filter (Merck Millipore) to be used as an analysis sample. Fragrance component analysis was performed using GC/MS (QP2010, Shimadzu, Kyoto, Japan), and the column was HP-innowax (60 m/ID 0.25 μm, Agilent, Santa Clara, CA, USA). The oven temperature was maintained at 40° C. for 5 minutes, then increased to 230° C. at 2° C. per minute, and maintained for 30 minutes. The injection temperature was 250° C., helium (He) was used as the carrier gas, and the column flow rate was 0.74 ml/min. Compound identification was identified by searching the mass spectrum obtained by GC-MS with the Wiley 275 data base, and for quantitative analysis, the content of each compound was an internal standard substance (4-methyl-2-pentanol) at a concentration of 50 ppm. It was quantified using.

As a result, as shown in Table 9, 3 types of esters, 6 types of ketones, 2 types of aldehydes, 4 types of alcohols, 2 types of hydrocarbons, and pyrazines Two kinds, four kinds of acids and four other kinds of fragrance components were detected. 23 kinds of fragrance components were detected in the soybean fermentation inoculated with Bacillus amyloliquefacience RD7-7 or Bacillus subtilis HJ18-4, and 15 kinds of fragrance components were detected in the soybean fermentation inoculated with HJ39-5. . Trimethyl-pyrazine and tetramethyl-pyrazine were detected as pyrazines known as volatile fragrance components in Cheonggukjang, and tetramethyl-pyrazine, known as an irritating odor of Cheonggukjang, was RD7-7 and HJ39-5 strains. It was not detected in the fermentation (Table 9). Among the acids known as unpleasant odors of Cheonggukjang, butyric acid and valeric acid were slightly lower in Bacillus amyloliquefacians RD7-7 and Bacillus subtilis HJ18-4 than other strains. Accordingly, it was confirmed that the Bacillus amyloliquefaciens RD7-7 strain of the present invention had less off-flavor during the fermentation process.

Unit (ppm) Fragrance ingredients RT1(min) RD7-7 HJ5-2 HJ18-4 HJ39-5 Ester
(esters) 2-propenoin acid, 2-propenyl ester 6.233 0.46 0.45 0.16 Non-detection formic acid, ethyl ester 7.074 1.52 0.60 1.92 1.42 acetic acid, ethyl ester 8.486 78.00 71.82 71.65 76.45 Ketone
(ketones) 2-methyl-3-heptanone 6.445 2.44 2.53 2.08 2.36 2-butanone 8.893 Non-detection 6.11 Non-detection 2,3-butanedione 11.905 2.74 2.09 3.04 2.05 acetoin 30.852 185.25 93.28 290.90 246.37 2,2-dimethyl-cyclohexanone-4,4-d2 59.011 Non-detection 4.02 Non-detection Non-detection 2-oxazolidinone 59.023 4.27 3.04 Non-detection Aldehyde
(aldehydes) 2-methyl-propanal 8.928 2.29 Non-detection 2.56 2.52 acetaldehyde 11.733 0.76 0.75 0.64 0.63 Alcohol
(alcohols) ethanol 9.875 0.91 1.04 0.32 0.63 2-butanol 14.072 4.57 4.32 4.16 4.41 1,3-butanediol 47.951 58.20 22.05 44.14 69.51 1-butanol 61.597 1.37 Non-detection Hydrocarbon
(hydrocarbons) benzene 10.164 89.73 87.62 83.48 90.95 1h-indene 44.410 0.46 0.75 Non-detection Non-detection Pyrazine
(pyrazines) trimethyl-pyrazine 38.684 0.61 3.43 1.92 Non-detection tetramethyl-pyrazine 43.192 Non-detection 2.68 2.24 Non-detection mountain
(acids) isobutyric acid 49.061 0.76 8.34 2.56 Non-detection isovaleric acid 55.069 1.68 46.34 2.08 3.94 propanoic acid 60.788 0.91 34.57 4.00 0.95 carbonic acid 63.165 0.76 Non-detection 1.76 Non-detection Etc cyclohexane 6.107 17.22 17.29 16.15 17.50 1-phenyl-4-penten-1-yne 65.112 Non-detection Non-detection 6.24 Non-detection 2-methyl-naphthalene 66.999 2.74 2.24 1.60 1.42 3-[(trimethylsilyl)oxy]furan 70.852 1.07 Non-detection 0.64 Non-detection

<4-8> Statistical analysis

The experimental results were measured in 3 repetitions, and the significance between the mean values was verified using the SPSS system (Statistical Package for Social Sciences, SPSS Inc., Chicago, IL, USA) soft-ware package (version 12), with a P<0.05 level. It was tested by Duncan's multiple range test.

<110> Foundation of Agri. Tech. Commercialization&Transfer <120> Bacillus amyloliquefacience having antibacterial activity and uses thereof <130> 2017P-11-043 <160> 14 <170> KopatentIn 2.0 <210> 1 <211> 22 <212> DNA <213> Bacillus cereus <400> 1 tgcaactgta ttagcacaag ct 22 <210> 2 <211> 22 <212> DNA <213> Bacillus cereus <400> 2 ttaccaacgc gctccattgc tt 22 <210> 3 <211> 20 <212> DNA <213> Bacillus cereus <400> 3 gttaggatca caatcaccgc 20 <210> 4 <211> 20 <212> DNA <213> Bacillus cereus <400> 4 acgaatgtaa tttgagtcgc 20 <210> 5 <211> 19 <212> DNA <213> Bacillus cereus <400> 5 tggattccaa gatgtaacg 19 <210> 6 <211> 20 <212> DNA <213> Bacillus cereus <400> 6 attacgactt ctgcttgtgc 20 <210> 7 <211> 29 <212> DNA <213> Bacillus cereus <400> 7 aaagaaatta atggacaaac tcaaactca 29 <210> 8 <211> 22 <212> DNA <213> Bacillus cereus <400> 8 gtatgtagct gggcctgtac gt 22 <210> 9 <211> 24 <212> DNA <213> Bacillus cereus <400> 9 ggtgacacat tatcatataa ggtg 24 <210> 10 <211> 24 <212> DNA <213> Bacillus cereus <400> 10 attcaacata atattatacg ccgt 24 <210> 11 <211> 20 <212> DNA <213> Bacillus cereus <400> 11 agagtttgat cctggctcag 20 <210> 12 <211> 19 <212> DNA <213> Bacillus cereus <400> 12 ggctaccttg ttacgactt 19 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic nucleotide <400> 13 agagtttgat catggctcag 20 <210> 14 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> synthetic nucleotide <400> 14 ggataccttg ttacgactt 19

Claims (11)

Bacillus amyloliquefacience RD7-7 strain deposited with accession number KACC 92071P.
The Bacillus amyloliquefaciens strain RD7-7 according to claim 1, wherein the strain is isolated from rice doenjang.
The method according to claim 1, wherein the strain is selected from the group consisting of Listeria monocytogenes, Escherichia coli, Staphylococcus aureus, Salmonella enteric, and Bacillus cereus. A strain of Bacillus amyloliquefaciens RD7-7 having an antibacterial activity against any one or more selected bacteria.
A starter for fermentation comprising as an active ingredient at least one selected from the group consisting of Bacillus amyloliquefaciens strain RD7-7 of claim 1, a culture of the strain, a concentrate of the culture, and a dried product of the culture.
A fermented food produced using the Bacillus amyloliquefaciens strain RD7-7 of claim 1 or the fermentation starter of claim 4.
The fermented food according to claim 5, wherein the fermented food is soybeans.
The fermented food according to claim 5, wherein the fermented food is chunggukjang.
A method for producing a fermented food comprising the step of inoculating the raw material with the Bacillus amyloliquefaciens strain RD7-7 of claim 1 or the fermentation starter of claim 4.
Listeria monocytogenes, Escherichia coli, Staphylococcus aureus, Bacillus amyloliquefaciens RD7-7, which are deposited as accession numbers KACC 92071P and contain Bacillus amyloliquefacience RD7-7 as an active ingredient, A pharmaceutical composition for preventing or treating infection by any one or more pathogens selected from the group consisting of Salmonella enteric and Bacillus cereus.
Deposited under accession number KACC 92071P and selected from the group consisting of Listeria monocytogenes, Escherichia coli, Staphylococcus aureus, Salmonella enteric and Bacillus cereus (Bacillus amyloliquefacience) RD7-7, which exhibits antimicrobial activity against any one or more of the bacterium belonging to the genus Bacillus amyloliquefaciens, as an active ingredient.
Deposited under accession number KACC 92071P and selected from the group consisting of Listeria monocytogenes, Escherichia coli, Staphylococcus aureus, Salmonella enteric and Bacillus cereus (Bacillus amyloliquefacience) strain RD7-7 which exhibits an antimicrobial activity against any one or more of the bacterium belonging to the genus Bacillus amyloliquefaciens as an active ingredient.

Images