KR101892140B1 - Method for detecting Zika virus using Loop-mediated isothermal amplification reaction and Biosample preconcentration device - Google Patents

Method for detecting Zika virus using Loop-mediated isothermal amplification reaction and Biosample preconcentration device Download PDF

Info

Publication number
KR101892140B1
KR101892140B1 KR1020160099585A KR20160099585A KR101892140B1 KR 101892140 B1 KR101892140 B1 KR 101892140B1 KR 1020160099585 A KR1020160099585 A KR 1020160099585A KR 20160099585 A KR20160099585 A KR 20160099585A KR 101892140 B1 KR101892140 B1 KR 101892140B1
Authority
KR
South Korea
Prior art keywords
sample
target
dielectric material
genetic material
membrane
Prior art date
Application number
KR1020160099585A
Other languages
Korean (ko)
Other versions
KR20180015945A (en
Inventor
이정훈
이도환
Original Assignee
광운대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 광운대학교 산학협력단 filed Critical 광운대학교 산학협력단
Priority to KR1020160099585A priority Critical patent/KR101892140B1/en
Publication of KR20180015945A publication Critical patent/KR20180015945A/en
Application granted granted Critical
Publication of KR101892140B1 publication Critical patent/KR101892140B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N30/00—Investigating or analysing materials by separation into components using adsorption, absorption or similar phenomena or using ion-exchange, e.g. chromatography or field flow fractionation
    • G01N30/02—Column chromatography
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/24011—Flaviviridae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2527/00—Reactions demanding special reaction conditions
    • C12Q2527/101—Temperature
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2531/00—Reactions of nucleic acids characterised by
    • C12Q2531/10—Reactions of nucleic acids characterised by the purpose being amplify/increase the copy number of target nucleic acid
    • C12Q2531/119—Strand displacement amplification [SDA]
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/005—Assays involving biological materials from specific organisms or of a specific nature from viruses
    • G01N2333/08—RNA viruses
    • G01N2333/18—Togaviridae; Flaviviridae

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Analytical Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pathology (AREA)
  • General Physics & Mathematics (AREA)
  • Virology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 표적 유전물질 검출 방법에 관한 것으로서, 핵산 성분을 포함하는 표적 유전물질이 포함되어 있는지 여부를 판단하고자 하는 시료를 미리 정해진 온도 구간에서 시약과 반응시켜, 상기 표적 유전물질의 적어도 일부분을 증폭시키는 단계, 상기 적어도 일부분이 증폭된 표적 유전물질이 포함된 시료를 생체 시료 농축 장치를 이용하여 상기 증폭된 표적 유전물질을 농축하는 단계 및 상기 농축된 표적 유전물질을 검출하는 단계를 포함한다.The present invention relates to a method for detecting a target genetic material, comprising reacting a sample to be tested whether or not a target genetic material containing a nucleic acid component is contained, with a reagent at a predetermined temperature range to amplify at least a part of the target genetic material Concentrating the amplified target genetic material using a biological sample concentrator; and detecting the enriched target genetic material. The method may further include the steps of:

Description

지카 바이러스 검출을 위한 등온증폭 및 농축장치를 이용한 지카 바이러스 검출 방법{Method for detecting Zika virus using Loop-mediated isothermal amplification reaction and Biosample preconcentration device}FIELD OF THE INVENTION [0001] The present invention relates to a Zikavirus detection method using isothermal amplification and concentration apparatus for detecting Zikavirus,

본 발명은 지카 바이러스 검출을 위한 등온증폭 및 농축장치를 이용한 검출 방법에 관한 것으로서, 등온증폭과 농축을 통해 검출 한계를 높여, 보다 단 시간 내에 검출이 가능하고, 결과의 높은 정확도를 얻을 수 있다.The present invention relates to a detection method using isothermal amplification and concentration apparatus for detection of Zicca virus, and can increase the detection limit through isothermal amplification and concentration, can be detected within a shorter time, and high accuracy of the result can be obtained.

지카 바이러스(Zika virus)는 플라비 바이러스와 플라비 바이러스 속에 속하는 바이러스로, 숲모기에 의해 감염하는 RNA를 함유한 바이러스이다. 사람에서는 지카열로 알려진 가벼운 증상의 병을 일으키는데, 이 병은 1950년대 이후로 아프리카에서 아시아에 이르는 좁은 적도 대 안에서 발생하는 것으로 알려졌다. 증상은 가벼운 뎅기열과 같고, 휴식을 취해 치료하며, 약이나 백신으로 예방할 수 없다. 또한, 현재로서는 지카 열병이 바이러스에 감염된 산모에게서 난 신생아의 소두증과 관련된 피해가 발생하는 사례도 발생하고 있다.Zika virus is a virus belonging to the genus Flaviviruses and Flaviviruses, which contains RNA infected by forest mosquitoes. In humans, it causes a mild symptom of disease known as chika fever, which has been known to occur in the narrow equatorial line from Africa to Asia since the 1950s. Symptoms are like mild dengue, can be rested and treated, and can not be prevented by drugs or vaccines. In addition, there is a case in which damage due to microcephaly of a newborn infected by a mother infected with a virus is present at present.

한편, 종래의 바이러스 진단법으로는 전자현미경 또는 형청학적 방법을 주로 사용하였다. 전자현미경을 이용한 방법은 바이러스의 존재를 확인할 수는 있지만 형태학적 특징으로 종을 진단하는 것은 거의 불가능하다. 혈청학적 방법 중 ELISA(Enzyme-Linked Immunosorbent Assay) 방법은 가장 일반적으로 사용되는 진단방법이나 중합효소 연쇄반응(Polymerase Chain Reaction, PCR) 진단법보다 검출감도가 약 1,000배정도 낮으며, 항체와 검사시료의 예상하지 못한 비특이적 반응으로 정확한 진단이 실패하는 경우가 자주 발생한다. 최근에는 바이러스를 진단하기 위하여 높은 검출감도와 편리성을 가지고 있는 PCR 방법을 일반적으로 많이 사용하고 있으나, PCR을 이용한 진단방법은 특이적인 프라이머(primer)의 개발이 매우 중요하며, 증폭된 반응산물을 전기영동(electrophoresis)으로 확인하고, 최종적으로는 염기서열분석(DNA sequencing)을 해야 하는 일련의 과정을 거쳐야 한다. 더불어 이러한 방법은 중합효소 연쇄반응기(Thermocycler)와 같은 전문적인 장비 및 이를 운용할 수 있는 전문인력이 요구되며, 최종확인을 위한 증폭산물의 염기서열분석은 고비용 및 고기술력을 요구하는 과정이다. 또한 이러한 일련의 과정들은 수행하는데 있어서 많은 시간이 소요되며 육안으로 식별 가능한 검출법이 아니기 때문에 분석 장비가 갖춰지지 않은 현장에서의 활용력은 현저히 떨어진다. 이와 같이 바이러스를 단시간 내에 효과적으로 검출하기 위해서는, 전문장비 없이 현장에서 실시간으로 검출할 수 있는 방법의 개발이 요구되고 있는 실정이다(한국특허공개번호제10-2010-0125766호).On the other hand, an electron microscope or a template method was mainly used as a conventional virus diagnosis method. Electron microscopy can detect the presence of virus but it is almost impossible to diagnose the species as a morphological feature. Among the serological methods, ELISA (Enzyme-Linked Immunosorbent Assay) method has a detection sensitivity about 1,000 times lower than that of the most commonly used diagnostic methods or Polymerase Chain Reaction (PCR) It is often the case that accurate diagnosis fails due to nonspecific reactions that have not occurred. In recent years, PCR methods with high detection sensitivity and convenience have been widely used for the diagnosis of viruses. However, it is very important to develop specific primers for the diagnostic method using PCR. It must be confirmed by electrophoresis and finally subjected to a sequence of DNA sequencing. In addition, this method requires specialized equipment such as a thermocycler and a professional manpower to operate it, and sequencing of the amplification product for final confirmation is a process requiring high cost and high technology. In addition, this process is time-consuming to perform and is not visually detectable. Therefore, the ability to use analytical equipment in the field is significantly reduced. In order to efficiently detect the virus in such a short time, development of a method capable of detecting in real time on the spot without professional equipments is required (Korean Patent Laid-Open No. 10-2010-0125766).

등온증폭법(Loop-mediated isothermal amplification, LAMP)은 기존의 PCR 방법과 유사하나 기존 PCR 방법은 변성, 접합, 및 신장의 세 단계를 반복적으로 수행하면서 유전자의 증폭을 시행하기 때문에 반응과정 중 지속적으로 온도의 변화를 필요로 하는 반면, 등온증폭법은 고정된 일정온도에서 접합 및 신장이 가능한 장점을 가지고 있다. 이는 기존 PCR 방법에 사용되는 Taq DNA 중합효소(Taq DNA polymerase)를 사용하는 대신, 핵산말단가수분해(exonuclease) 기능을 갖고 있는 Bst DNA 중합효소(Bst DNA polymerase)를 사용함으로써, 열에 의존하지 않고 DNA의 이중나선 구조의 변성을 유발할 수 있기 때문이다. 따라서 등온증폭법은 유전자를 증폭하는 동안 온도의 변화를 필요로 하지 않기 때문에 전문장비 없이 손쉽게 고정된 온도에서 유전자 증폭을 가능하게 한다.The isothermal amplification method (LAMP) is similar to the conventional PCR method, but the conventional PCR method repeatedly performs three steps of denaturation, splicing, and elongation to amplify the gene, The isothermal amplification method has the advantage of being able to bond and stretch at a fixed temperature. This is because Bst DNA polymerase (Bst DNA polymerase), which has the function of exonuclease of nucleic acid, is used instead of Taq DNA polymerase used in the conventional PCR method, Of the double helix structure. Therefore, isothermal amplification does not require a temperature change during amplification of the gene, which makes gene amplification possible at fixed temperature with no special equipment.

한국 공개 특허 제10-2013-0055040호 (2013.05.28공개)Korean Patent Publication No. 10-2013-0055040 (published on May 28, 2018)

본 발명은 상기와 같은 종래 기술상의 문제점을 해결하기 위하여 안출된 것으로, 지카 바이러스를 검출하기 위한 등온증폭반응 및 농축장치를 이용한 검출방법을 제공하는 것을 그 목적으로 한다.Disclosure of Invention Technical Problem [8] Accordingly, the present invention has been made keeping in mind the above problems occurring in the prior art, and an object of the present invention is to provide an isothermal amplification reaction for detecting Zikavirus and a detection method using the concentrator.

상기 목적을 달성하기 위한 본 발명의 일 예에 따른 표적 유전물질 검출 방법은, a)핵산 성분을 포함하는 표적 유전물질이 포함되어 있는지 여부를 판단하고자 하는 시료를 미리 정해진 온도 구간에서 시약과 반응시켜, 상기 시료 중 상기 표적 유전물질에 해당하는 일 부분이 증폭하는 단계, b)상기 적어도 일부분이 증폭된 표적 유전물질이 포함된 시료를 생체 시료 농축 장치를 이용하여 상기 증폭된 표적 유전물질을 농축하는 단계 및 c)상기 농축된 표적 유전물질을 검출하는 계를 포함할 수 있다.According to an aspect of the present invention, there is provided a method for detecting a target dielectric material, comprising the steps of: a) reacting a sample to determine whether or not a target dielectric material containing a nucleic acid component is contained, with a reagent at a predetermined temperature range Amplifying a portion of the sample corresponding to the target genetic material; b) amplifying the amplified target genetic material using a biological specimen concentrator, the sample including the target genetic material at least partially amplified; And c) a system for detecting the enriched target dielectric material.

본 발명에서, 핵산 성분을 포함하는 표적 유전물질이 포함되어 있는지 여부를 판단하고자 하는 시료를 미리 정해진 온도 구간에서 시약과 반응시켜, 상기 시료 중 상기 표적 유전물질에 해당하는 일 부분이 증폭하는 단계는 a1)상기 핵산 성분을 포함하는 표적 유전물질이 포함되어 있는지 판단하고자 하는 시료를 전처리하는 단계, a2)상기 전처리된 시료와 상기 표적 유전물질에 반응하는 시약을 혼합하는 단계, a3)상기 혼합된 시료와 상기 시약을 상기 미리 정해진 온도 구간에서 유지하는 단계 및 a4)상기 미리 정해진 온도 구간에서 상기 표적 유전물질의 적어도 일부분이 증폭하는 단계를 더 포함할 수 있다.In the present invention, a step of reacting a sample to be tested whether a target dielectric material containing a nucleic acid component is included with a reagent at a predetermined temperature range and amplifying a portion corresponding to the target dielectric material in the sample a1) pre-treating a sample to determine whether a target dielectric material containing the nucleic acid component is included, a2) mixing the pretreated sample with a reagent that reacts with the target dielectric material, and a3) And maintaining the reagent at the predetermined temperature interval, and a4) amplifying at least a portion of the target dielectric material at the predetermined temperature interval.

본 발명에서, 상기 시약은 상기 표적 유전물질에 반응하는 프라이머 및 효소를 포함할 수 있다.In the present invention, the reagent may include a primer and an enzyme that react with the target dielectric material.

또한, 상기 시료를 미리 정해진 온도 구간에서 증폭하는 것은, 램프(LAMP) 반응을 이용하여 증폭할 수 있다.In addition, amplification of the sample at a predetermined temperature range can be amplified by using a lamp reaction.

본 발명에서, 상기 표적 유전물질은 지카 바이러스(Zika Virus)일 수 있다.In the present invention, the target genetic material may be Zika Virus.

또, 상기 a)단계에서 상기 미리 정해진 온도는 72도일 수 있다.In the step a), the predetermined temperature may be 72 degrees.

또, 상기 a3)단계는, 10분 내지 20분 동안 수행될 수 있다.Also, the step a3) may be performed for 10 minutes to 20 minutes.

본 발명의 c)단계에서 상기 표적 유저물질을 검출하는 것은, 상기 농축된 시료를 크로마토그래피를 이용하여 검출할 수 있다.Detecting the target user substance in step c) of the present invention can detect the concentrated sample using chromatography.

본 발명에서, 상기 생체 시료 농축 장치는 미리 정해진 간격으로 접혀질 수 있고, 접혀지는 기본 단위가 되는 복수개의 베이스 유닛들을 포함하는 베이스, 상기 베이스의 적어도 일부 영역에 위치하여 처리 대상 시료의 흡착을 방지하고 저장 공간 또는 이동 경로를 구분하는 코팅층, 상기 코팅층에 의하여 영역이 정의되고 상기 베이스 유닛에 각각 위치하며, 상기 핵산 성분을 포함하는 표적 유전물질이 포함되어 있는지 여부를 판단하고자 하는 시료에 포함되어 분리하고자 하는 상기 표적 유전물질 또는 상기 시료에서 상기 상기 표적 유전물질을 제외한 분리 대상 물질을 적어도 일부 흡착하여 저장하거나 이동 경로를 제공하는 복수개의 레저버들 및 상기 레저버들 중 적어도 일부의 레저버와 적어도 일부 중첩하여 위치하며 이온을 선택적으로 투과시키는 선택적 이온 투과층을 더 포함할 수 있다.In the present invention, the biological sample concentration apparatus may include: a base including a plurality of base units that can be folded at predetermined intervals and to be a basic unit to be folded; A coating layer for discriminating a storage space or a moving path, a region defined by the coating layer, each located in the base unit, contained in a sample to be examined whether or not a target dielectric material containing the nucleic acid component is contained, A plurality of reservoirs for adsorbing and storing at least a portion of the target dielectric material to be separated or the separation target material excluding the target dielectric material in the sample to provide a movement path, and at least a part of at least some of the reservoirs And is selectively permeable to ions And a selective ion-permeable layer.

또한, 상기 베이스 유닛은 필요에 따라 적어도 하나를 절취하여 상기 시료의 타겟 물질 또는 분리 대상 물질을 선택적으로 채득할 수 있고, 상기 복수개의 레저버들은 처리 대상이 되는 시료 또는 도전성 액체로 점습되고, 상기 코팅층은 알코올 지방산 에스터로서 왁스(Wax, 蠟)를 포함할 수 있다.In addition, the base unit may selectively remove at least one target material or a separation target material by cutting at least one of them, if necessary, and the plurality of reservoirs are wetted with a sample or a conductive liquid to be treated, The coating layer may contain wax (wax) as an alcohol fatty acid ester.

또한, 상기 생체 시료 농축 장치는 접착층, 상기 접착층상의 일직선상에 서로 이격되어 형성된 2개의 패턴된 선택적 이온투과 멤브레인들, 상기 선택적 이온투과 멤브레인들 사이와 양끝에 하나씩 패턴되어 형성된 다공성 멤브레인을 포함하고, 상기 선택적 이온투과 멤브레인들의 양끝에 형성된 상기 다공성 멤브레인은 버퍼레저버이고, 상기 선택적 이온투과 멤브레인들 사이에 형성된 상기 다공성 멤브레인은 반응멤브레인일 수 있다.In addition, the biological sample concentration apparatus includes an adhesive layer, two patterned selective ion-permeable membranes spaced from each other on a straight line on the adhesive layer, and a porous membrane formed between the selective ion-permeable membranes and patterned on both ends, The porous membrane formed at both ends of the selective ion-permeable membranes may be a buffer reservoir, and the porous membrane formed between the selective ion-permeable membranes may be a reactive membrane.

본 발명에서, 양끝의 각 상기 버퍼레저버에 전원을 인가하고 상기 반응 멤브레인에 상기 표적 유전물질이 포함되어 있는지 판단하고자 하는 시료를 투여하여 상기 반응 멤브레인에 생체분자를 농축하기 위한 것일 수 있다.In the present invention, it is possible to apply a power to each of the buffer reservoirs at both ends and to concentrate the biomolecules on the reaction membrane by administering a sample to determine whether the target membrane material is contained in the reaction membrane.

본 발명에서, 상기 버퍼레저버 및 상기 반응 멤브레인은 셀룰로오스 페이퍼로 이루어질 수 있다.In the present invention, the buffer reservoir and the reaction membrane may be made of cellulose paper.

따라서, 본발명의 증폭 및 농축 장치 및 방법은 지카 바이러스나 신종 플루와 같이 검출하고자 하는 표적 물질을 등온 증폭 및 농축하여 빠르고 정확하게 검출할 수 있도록 한다.Therefore, the amplification and concentration apparatus and method of the present invention enable isothermal amplification and concentration of the target substance to be detected, such as Zicavirus or H1N1 virus, to be detected quickly and accurately.

도1은 본 발명의 일 실시예에 따른 표적 유전물질 검출 방법을 설명하기 위한 도면이다.
도2는 본 발명의 일 실시예에 따른 생체 시료 농축 장치(1)를 나타낸다.
도3은 본 발명의 또 다른 일 실시예에 따른 생체 시료 농축 장치(2)의 측면도이다.
도4는 본 발명의 또 다른 일 실시예에 따른 생체 시료 농축 장치(2)의 분해 사시도와 상면도를 나타낸다.
도5는 본 발명의 일 실시예에 따른 지카 RNA의 검출결과를 나타내는 도면이다.
도6은 본 발명의 일 실시예에 따른 또 다른 지카 RNA의 검출결과를 나타내는 도면이다.
도7은 본 발명의 일 실시예에 따른 램프 반응을 위한 최적 dNTP 농도를 나타내는 도면이다.1 is a view for explaining a method of detecting a target dielectric material according to an embodiment of the present invention.
2 shows a biological sample concentration apparatus 1 according to an embodiment of the present invention.
3 is a side view of a biological sample concentration apparatus 2 according to another embodiment of the present invention.
4 shows an exploded perspective view and a top view of a biological sample concentration apparatus 2 according to another embodiment of the present invention.
5 is a diagram showing the detection results of Zicat RNA according to an embodiment of the present invention.
FIG. 6 is a diagram showing the detection result of another zuca RNA according to an embodiment of the present invention.
Figure 7 is a plot of optimal dNTP concentration for lamp response in accordance with one embodiment of the present invention.

첨부된 도면들을 참조하여 본 발명을 일 실시예에 따라 상세히 설명한다.The present invention will be described in detail with reference to the accompanying drawings.

이하 첨부 도면들 및 첨부 도면들에 기재된 내용들을 참조하여 본 발명의 실시예를 상세하게 설명하지만, 본 발명이 실시예들에 의해 제한되거나 한정되는 것은 아니다.Hereinafter, embodiments of the present invention will be described in detail with reference to the accompanying drawings and accompanying drawings, but the present invention is not limited to or limited by the embodiments.

본 발명의 명세서에서 사용되는 용어는 본 발명에서의 기능을 고려하면서 가능한 현재 널리 사용되는 일반적인 용어를 선택하였으나, 이는 해당 분야에 종사하는 기술자의 의도 또는 관례 또는 새로운 기술의 출현 등에 따라 달라 질 수 있다. 또한 특정한 경우는 출원인이 임의로 선정한 용어도 있으며, 이 경우 해당되는 발명의 설명부분에서 그 의미를 기재할 것이다. 따라서 본 명세서에서 사용되는 용어는, 단순한 용어의 명칭이 아닌 그 용어가 가지는 실질적인 의미와 본 명세서의 전반에 걸친 내용을 토대로 해석되어야 함을 밝혀두고자 한다. 예를 들어, 여기에 기재되어 있는 특정 형상, 구조 및 특성은 일실시예에 관련하여 본 발명의 정신 및 범위를 벗어나지 않으면서 다른 실시예로 구현될 수 있다.The term used in the specification of the present invention selects the general term that is widely used in the present invention while considering the function of the present invention, but it may be changed depending on the intention or custom of the technician engaged in the field or appearance of new technology . Also, in certain cases, there may be a term chosen arbitrarily by the applicant, in which case the meaning thereof will be described in the description of the corresponding invention. Therefore, it is intended that the terminology used herein should be interpreted based on the meaning of the term rather than on the name of the term, and on the entire contents of the specification. For example, certain features, structures, and characteristics described herein may be implemented in other embodiments without departing from the spirit and scope of the invention in connection with an embodiment.

나아가, 도면들 중 참조번호 및 동일한 구성요소들에 대해서는 비록 다른 도면상에 표시되더라도 가능한 한 동일한 참조번호들 및 부호들로 나타내고 있음에 유의해야 한다. 하기에서 본 발명을 설명함에 있어, 관련된 공지 기능 또는 구성에 대한 구체적인 설명이 본 발명의 요지를 불필요하게 흐릴 수 있다고 판단되는 경우에는 그 상세한 설명을 생략할 것이다.Further, although the reference numerals and the like of the drawings are denoted by the same reference numerals and signs as possible, even if they are shown in different drawings, the same reference numerals and signs are used. In the following description of the present invention, a detailed description of known functions and configurations incorporated herein will be omitted when it may make the subject matter of the present invention rather unclear.

따라서 후술하는 상세한 설명은 한정적인 의미로서 취하려는 것이 아니며, 본 발명의 범위는, 적절하게 설명된다면, 그 청구항들이 주장하는 것과 균등한 모든 범위와 더불어 첨부된 청구항에 의해서만 한정된다. 도면에서 유사한 참조부호는 여러 측면에 걸쳐서 동일하거나 유사한 기능을 지칭한다.The following detailed description is, therefore, not to be taken in a limiting sense, and the scope of the present invention is to be limited only by the appended claims, along with the full scope of equivalents to which such claims are entitled, if properly explained. In the drawings, like reference numerals refer to the same or similar functions throughout the several views.

이하에서는, 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자가 본 발명을 용이하게 실시할 수 있도록 하기 위하여, 본 발명의 바람직한 실시예들에 대하여 첨부된 도면을 참조하여 상세히 설명하기로 한다.Hereinafter, preferred embodiments of the present invention will be described in detail with reference to the accompanying drawings, so that those skilled in the art can easily carry out the present invention.

도1은 본 발명의 일 실시예에 따른 표적 유전물질 검출 방법을 설명하기 위한 도면이다.1 is a view for explaining a method of detecting a target dielectric material according to an embodiment of the present invention.

먼저, 핵산 성분을 포함하는 표적 유전물질이 포함되어 있는지 여부를 판단하고자 하는 시료를 채취하여 추출한다(S100).First, a sample to be determined whether or not a target dielectric material containing a nucleic acid component is contained is sampled and extracted (S100).

추출한 시료를 미리 정해진 온도 구간에서 증폭하여, 표적 유전 물질 중 일 부분을 증폭시킨다. 이 때, 여기서, 표적 유전물질은 지카 바이러스(Zika Virus)로, 지카 RNA를 증폭하기 위하여 등온증폭(Loop-mediated isothermal amplification, LAMP)방법을 이용한다.The extracted sample is amplified at predetermined temperature intervals to amplify a portion of the target genetic material. Here, the target genetic material is a Zika virus, and uses a loop-mediated isothermal amplification (LAMP) method to amplify zicat RNA.

본 발명에 따른 표적 유전 물질의 등온 증폭은 하기의 과정으로 수행될 수 있다. Isothermal amplification of the target dielectric material according to the present invention can be performed by the following process.

우선, 핵산 성분을 포함하는 표적 유전물질이 포함되어 있는지 판단하고자 하는 시료를 전처리 한다(S200). 본 발명에서, 지카 바이러스의 시료는 안전성을 위하여 실제 지카 바이러스와 동일한 RNA를 지니나 감염성이 없는 Zeptometrix 사의 NATtrol™Zika Virus (strain: MR766 (Uganda))를 사용한다. 시료의 전처리 방법은 바이오니아 사의 Viral RNA Extraction Kit를 이용하여 통상적인 RNA 추출 과정을 진행한다.First, a sample to be judged as to whether a target dielectric material containing a nucleic acid component is contained is pretreated (S200). In the present invention, a sample of Zikavirus uses NATtrol (TM) Zika Virus (strain: MR766 (Uganda)) of Zeptometrix, which has the same RNA as the actual Zikavirus but has no infectivity for safety. As a pre-treatment method of the sample, a conventional RNA extraction process is carried out using a Viral RNA Extraction Kit of Bioneer.

다음으로, 전처리된 시료와 표적 유전물질에 반응하는 시약을 혼합한다(S300). 일 예로, 본 발명에서는 표적 유전 물질에 결합하는 6개의 프라이머와 2.2mM의 dNTP, Bst 3.0 중합효소, 그리고 Isothermal Amplification Buffer II를 시약으로 사용한다.Next, the pretreated sample is mixed with a reagent which reacts with the target dielectric material (S300). For example, in the present invention, 6 primers binding to the target genetic material, 2.2 mM dNTP, Bst 3.0 polymerase, and Isothermal Amplification Buffer II are used as reagents.

다음으로, 시약을 혼합한 전처리된 시료를 미리 정해진 온도 구간에서 유지한다(S400). 예컨대, 시약 혼합한 시료를 72도에서 10분 내지 20분 동안 유지한다.Next, the pretreated sample mixed with the reagents is maintained at a predetermined temperature interval (S400). For example, the reagent mixed sample is maintained at 72 degrees for 10 minutes to 20 minutes.

다음으로, 상기 시료 중 상기 표적 유전물질에 해당하는 일 부분이 증폭한다(S400). 여기서, 표적 유전물질의 해당하는 일 부분이란, 표적 유전물질이 존재하는 구간으로 예컨대, 상기 시료를 상기 시약과 혼합하여 72도에서 15분동안 유지하면, 지카 RNA만 특이적으로 증폭할 수 있다.Next, a portion corresponding to the target dielectric material in the sample is amplified (S400). Here, the corresponding portion of the target dielectric material is a region in which the target dielectric material exists. For example, when the sample is mixed with the reagent and maintained at 72 ° C for 15 minutes, only ziker RNA can be specifically amplified.

상술한 등온증폭법(LAMP)을 이용하여, 표적 유전물질을 증폭시키는 방법을 또 다른 일 실시예에 의하여, 보다 구체적으로 설명한다.A method of amplifying a target dielectric material using the above-described isothermal amplification (LAMP) will be described in more detail with reference to another embodiment.

우선, 증폭을 수행할 주형이 되는 표적 유전물질, 즉, 표적 DNA, 외부 프라이머 세트 및 DNA-RNA-DNA 혼성 프라이머 세트의 혼합물을 변성시켜 각각의 단일나선 DNA로 만든다. 변성이 끝난 혼합물을 등온 증폭온도로 냉각시키고, 상기 혼합물에 DNA 중합효소와 RNA 분해효소가 포함된 효소반응용액을 혼합시킨다. 이 때, 증폭온도로 냉각된 반응액 내에서 표적 DNA에 상기 외부 프라이머 세트와 상기 DNA-RNA-DNA 혼성 프라이머 세트가 어닐링된다. 상기 외부 프라이머 세트는 혼성 프라이머 세트보다 표적 DNA의 양 말단쪽에 가까운 서열과 상보적인 서열을 포함하고 있는 것이 바람직하고, 혼성 프라이머 세트는 외부 프라이머보다 표적 DNA의 중심에 가까운 서열을 포함하고 있는 것이 바람직하며, 이 경우, 혼성 프라이머는 외부 프라이머 보다 DNA 사슬 신장 방향의 앞쪽에 어닐링 된다. 어닐링된 외부 프라이머와 혼성 프라이머는 사슬치환 능력이 있는 DNA 중합효소에 의하여 신장되며 외부 프라이머가 표적 DNA를 따라 신장됨에 따라 신장 방향의 앞쪽에 위치하고 있는 혼성 프라이머에서 신장된 DNA 사슬이 표적 DNA에서 떨어져 나가면서 사슬치환이 일어나게 되고, 최종적으로, 혼성 프라이머에서 신장된 단일나선의 DNA 증폭산물과 외부 프라이머에서 신장된 이중나선의 DNA 증폭산물이 얻어진다.First, a mixture of the target genetic material to be amplified, that is, the target DNA, the external primer set, and the DNA-RNA-DNA hybrid primer set is denatured into each single strand DNA. The denatured mixture is cooled to an isothermal amplification temperature, and an enzyme reaction solution containing the DNA polymerase and the RNAase is mixed in the mixture. At this time, the external primer set and the DNA-RNA-DNA hybrid primer set are annealed to the target DNA in the reaction solution cooled to the amplification temperature. It is preferable that the external primer set contains a sequence complementary to a sequence close to both ends of the target DNA than the hybrid primer set. It is preferable that the hybrid primer set contains sequences closer to the center of the target DNA than the external primer , In which case the hybrid primer is annealed ahead of the external primer in the direction of DNA chain extension. The annealed external primer and hybrid primer are elongated by the DNA polymerase capable of chain displacement and as the external primer is elongated along the target DNA, the elongated DNA chain is separated from the target DNA in the hybrid primer located in the front of the elongation direction And eventually a double stranded DNA amplification product elongated from the single stranded DNA amplification product elongated from the hybrid primer and elongated from the external primer is obtained.

상기 증폭산물인 단일나선 DNA를 주형으로 외부 프라이머와 혼성 프라이머가 어닐링된다. 어닐링된 외부 프라이머와 혼성 프라이머는 사슬치환 능력이 있는 DNA 중합효소에 의하여 신장되며, 외부 프라이머가 단일나선 DNA에서 떨어져 나가면서 사슬치환이 일어나게 되고, 최종적으로, 혼성 프라이머에서 신장된 새로운 단일나선의 DNA 증폭산물과 외부 프라이머에서 신장된 이중나선의 DNA 증폭산물이 얻어진다. 외부 프라이머가 신장되어 이중나선 DNA가 형성되고, 신장된 DNA-RNA-DNA 혼성 프라이머는 사슬치환에 의해 단일나선 DNA가 분리된다. 상기 증폭된 단일나선 DNA를 주형으로 DNA-RNA-DNA 혼성 프라이머가 어닐링되고 신장되어 RNA를 포함하는 이중나선 DNA 증폭산물이 얻어진다. 이중나선 DNA의 RNA부분은 RNase H에 의해 분해되고, 신장, 사슬치환에 의해 단일나선 DNA가 생성된다. 상기의 단일나선 DNA를 주형으로 프라이머의 어닐링, 신장, 사슬치환 RNA 절단의 과정이 반복되면서 표적 DNA가 증폭된다.The external primer and the hybrid primer are annealed with the single strand DNA as the amplification product as a template. The annealed external primer and the hybrid primer are elongated by the DNA polymerase having the ability of substituting the chain, the external primer is separated from the single helix DNA, and the chain substitution is made. Finally, the DNA of the new single helix elongated from the hybrid primer DNA amplification products of the amplified product and double stranded RNA elongated in the outer primer are obtained. The outer primer is elongated to form double helix DNA, and the elongated DNA-RNA-DNA hybrid primer separates single helix DNA by chain substitution. A DNA-RNA-DNA hybrid primer is annealed and amplified using the amplified single stranded DNA as a template to obtain a double-stranded DNA amplification product containing RNA. The RNA portion of double helix DNA is degraded by RNase H and single stranded DNA is produced by elongation and chain substitution. The target DNA is amplified by repeating the steps of annealing the primer, elongating the strand, and cleaving the strand displacement RNA using the single stranded DNA as a template.

본 발명의 일 실시예에서 사용되는 외부 프라이머 세트는 올리고 DNA, 올리고 DNA 및 혼성 올리고 RNA/DNA로 구성된 군에서 선택되는 어느 하나를 사용할 수 있고, 표적핵산 서열에 상보적(complementary)이다. The external primer set used in one embodiment of the present invention may be any one selected from the group consisting of oligo DNA, oligo DNA and hybrid oligo RNA / DNA, and is complementary to the target nucleic acid sequence.

등온증폭법은 기존의 PCR(Polymerase chain reaction)과 달리 유전자를 증폭하기 위한 온도조절을 필요로 하지 않기 때문에 전문장비 없이 유전자를 증폭할 수 있으며, 단시간 내에 고농도의 유전자 증폭이 가능하다. 이 때, 본 발명에서 이용하는 등온증폭은 프라이머 및 효소를 이용하여, 사용되는 효소의 활성을 실질적으로 억제하지 않는 온도에서 수행되는 것이 바람직하다. 본 발명에서 증폭반응이 수행되는 온도는 바람직하게는 55도~75도가 바람직하고, 더욱 바람직하게는 65도~75도가 바람직하며, 72도인 것이 가장 바람직하다.The isothermal amplification method does not require temperature control to amplify the gene unlike the conventional PCR (polymerase chain reaction), so it can amplify the gene without specialized equipments and can amplify the gene at a high concentration in a short time. At this time, the isothermal amplification used in the present invention is preferably performed at a temperature that does not substantially inhibit the activity of the enzyme used, using a primer and an enzyme. The temperature at which the amplification reaction is carried out in the present invention is preferably 55 to 75 degrees, more preferably 65 to 75 degrees, and most preferably 72 degrees.

다음으로, 시료 중 표적 유전물질의 일 부분이 증폭하고 난, 증폭산물을 생체 시료 농축 장치(1,2)를 이용하여, 상기 증폭된 표적 유전물질을 농축한다(S500).Next, a portion of the target dielectric material in the sample is amplified, and the amplified target genetic material is concentrated using the biological sample concentrator (1, 2) (S500).

표적 유전물질을 보다 단 기간 내에 검출하기 위하여, 상기 시료 중 일부분이 증폭된 표적 유전물질이 포함된 시료를 생체 시료 농축 장치를 이용하여, 증폭된 표적 유전물질을 농축한다. 여기서, 본 발명의 일 실시에에 의한 생체 시료 농축 장치는 도2를 참조하여 구체적으로 설명하도록 한다.In order to detect the target genetic material in a shorter period of time, the sample containing the target genetic material in which a part of the sample is amplified is concentrated using a biological specimen concentrator to amplify the amplified target genetic material. Here, the biological sample concentration apparatus according to one embodiment of the present invention will be described in detail with reference to Fig.

도2는 본 발명의 일 실시예에 따른 생체 시료 농축 장치(1)를 나타낸다.2 shows a biological sample concentration apparatus 1 according to an embodiment of the present invention.

본 실시예의 생체 시료 농축 장치(1)는 생체 시료의 분석을 용이하게 하기 위하여, 성분의 이동성(mobility) 차이에 따른 분리를 이용하여 타겟 물질의 농축과 분리 대상 물질의 분리가 일어나도록 하고, 이 과정에서 전기영동(electrophoresis) 및 전기삼투(electro-osmosis)의 특성을 이용하여, 이온 농도 분극(ion concentration polarization)을 발생시키고, 시료를 농축 및 분리할 수 있다. 이 결과 얻어진 농축된 표적 유전물질은 ICP(Inductively coupled plasma)와 같은 발광 분광 분석법으로 반응을 판별할 수 있으며, 특히 본 발명에서는 수 ng 이하의 전혈 내의 단백질(biomarker)을 수 천 배 이상 농축할 수 있으므로 육안으로도 반응 판별이 용이하고 조기 질병 검출 및 진단이 가능하도록 할 수 있다.In order to facilitate the analysis of a biological sample, the biological sample concentration apparatus 1 of the present embodiment makes it possible to concentrate the target material and to separate the target substance by using the separation according to the mobility difference of the components, The ion concentration polarization can be generated and the sample can be concentrated and separated using the characteristics of electrophoresis and electro-osmosis in the process. The resultant concentrated target dielectric material can be identified by emission spectrometry such as inductively coupled plasma (ICP). In particular, the present invention can concentrate proteins (biomarkers) of several ng or less in whole blood more than several thousand times Therefore, it is easy to judge the reaction even by the naked eye, and early disease detection and diagnosis can be made possible.

도2의 (a)에 도시된 바와 같이, 본 명세서의 일 실시예에 따른 생체 시료 농축 장치(1)는 베이스(100), 코팅층(200), 레저버(300) 및 선택 이온 투과막(400)을 포함한다.2 (a), a biological sample concentration apparatus 1 according to an embodiment of the present invention includes a base 100, a coating layer 200, a reservoir 300, and a selective ion permeable membrane 400 ).

베이스(100)는 미리 정해진 간격으로 접혀질 수 있고, 접혀지는 기본 단위가 되는 복수개의 베이스 유닛들을 포함한다.The base 100 includes a plurality of base units which can be folded at predetermined intervals and to be a basic unit to be folded.

본 실시예에서 베이스(100)는 적어도 일부 섬유 조직을 갖는 재료를 포함하여, 상기 코팅층(200)은 상기 베이스(100)에 부가하여 결합되고, 상기 선택적 이온 투과층이 형성된 공간은 상기 코팅층(200)이 존재하지 않는 공간을 적어도 일부 포함하며, 상기 공간을 통해 상기 시료 또는 표적 물질이 이동하도록 구현될 수 있다.In this embodiment, the base 100 includes a material having at least some fiber texture, the coating layer 200 is additionally bonded to the base 100, and the space in which the selective ion-permeable layer is formed is formed in the coating layer 200 ) Does not exist, and the sample or the target substance may be moved through the space.

본 실시예에서는 종이를 베이스(100)로 이용한 예를 제시하고 있지만, 베이스(100)의 종류는 이에 한정되지 않으며, PET(Polyethylene terephthalate)도 가능하다. 특히 베이스는 소수성 물질과 결합이 잘되거나, 소수성 물질이 침투 가능한 구조를 갖는 재질이 바람직하다.In this embodiment, a paper is used as the base 100. However, the type of the base 100 is not limited to this, and PET (polyethylene terephthalate) is also possible. Particularly, the base is preferably made of a material having a structure capable of bonding with a hydrophobic substance or permeable to a hydrophobic substance.

코팅층(200)은 베이스의 적어도 일부 영역에 위치하여, 처리 대상 시료의 흡착을 방지하고 저장 공간 또는 이동 경로를 구분한다.The coating layer 200 is located in at least a part of the base to prevent adsorption of the sample to be treated and to separate the storage space or the movement path.

본 실시예에서 소수성 물질은 대표적으로 알코올 지방산 에스터로서 왁스(Wax) 등을 사용할 수 있다. 이 경우 베이스(100)에 왁스를 인쇄하거나 가열하여 결합시킬 수 있다. 일반적으로, 재료에서 물질이 소수성을 띄게 되는 경우는 물과 닿는 표면의 구조에 의한 영향과 재료의 표면 자체의 특성에 의한 영향으로 소수성을 가질 수 있다. 특히, 베이스인 종이에 코팅을 하여 마이크로 채널을 형성하는 경우는 후자에 해당하며, 종이에 왁스를 코팅하여 채널을 형성하는 것은 종이라는 친수성 재료에 채널로 사용할 부분을 제외하고 다른 부분을 소수성을 띄게 하기 위함이다. 이러한 소수성의 성질은 베이스를 종이와 비슷한 파이버(fiber) 소재를 이용할 경우에도 유사한 효과를 얻을 수 있으므로, 셀룰로오스 페이퍼 이외에 파이버 계열의 베이스를 사용하는 것도 가능하다.In the present embodiment, the hydrophobic substance is typically a wax or the like as an alcohol fatty acid ester. In this case, wax may be printed on the base 100 or may be bonded by heating. Generally, when a material becomes hydrophobic in a material, it may have hydrophobicity due to the influence of the structure of the surface in contact with water and the characteristics of the surface of the material itself. Particularly, in the case of forming a microchannel by coating on a base paper, the latter corresponds to the latter. In the case of forming a channel by coating wax on paper, a hydrophilic material such as paper is used as a channel, . Such a hydrophobic property can achieve a similar effect even when a fiber material similar to paper is used as the base, so that it is also possible to use a fiber-based base in addition to the cellulose paper.

레저버(300)들은 도면에 예시된 바와 같이 310 내지 340 레저버를 포함하여 예시될 수 있다. 레저버들은 상기 코팅층에 의하여 영역이 정의되고 상기 베이스 유닛에 각각 위치하며, 측정하고자 하는 시료에 포함되어 분리하고자 하는 타겟 물질 또는 상기 시료에서 상기 타겟 물질을 제외한 분리 대상 물질을 적어도 일부 흡착하여 저장하거나 이동 경로를 제공한다.The reservoirs 300 may be exemplified by including 310 to 340 reservoirs as illustrated in the figure. The reservoir is defined by the coating layer and is respectively located in the base unit. The reservoir is contained in the sample to be measured and at least partially adsorbs and stores a target substance to be separated or a substance to be separated excluding the target substance in the sample Provide a travel route.

레저버(300)들은 점습된 시료, 예컨대 분석하고자 하는 단백질 시료 또는 도전성 액체(버퍼)가 저장되거나 이동하는 경로를 제공할 수 있다.The reservoirs 300 may provide a path for storing or moving a wetted sample, e.g., a protein sample to be analyzed or a conductive liquid (buffer).

선택적 이온 투과층(400)은 복수의 레저버들 중 적어도 일부의 레저버와적어도 일부 중첩하여 위치하여 이온을 선택적으로 투과시킨다. 패턴된 선택적 이온 투과막(400)은 양성자(patron)를 선택하여 투과시키는 일종의 나노 필터의 역할을 수행한다.The selective ion-permeable layer (400) overlaps with at least a part of the reservoir of at least a part of the plurality of reservoirs to selectively transmit ions. The patterned selective ion-permeable film 400 plays a role of a kind of nanofilter that selectively transmits a proton.

선택적 이온 투과막(400)은 특정 이온 물질을 선택적으로 투과시키는 막으로서 나노 필터(nano filter)의 기능을 수행하는 나노 채널(nano channel)을 구현하기 위한 구성요소이다. 선택적 이온 투과막(400)이 나피온(nafion)으로 구현되는 경우, 나피온의 화학 구조 중 SO3-로 인해서 H+ 이온이 호핑(hopping) 및 비히클 기전(vehicle mechanism)에 의하여 선택적으로 빠르게 투과되도록 한다. 따라서, 선택적 이온 투과막(400)은 나노 필터의 기능을 수행할 수 있다.The selective ion-permeable membrane 400 is a membrane for selectively transmitting a specific ionic material, and is a component for implementing a nanochannel that functions as a nano filter. When the selective ion-permeable membrane 400 is realized as nafion, H + ions are selectively and rapidly permeated by the hopping and vehicle mechanism due to SO3- in the Nafion's chemical structure . Therefore, the selective ion-permeable film 400 can perform the function of a nanofilter.

본 발명의 일 실시예에서는 시료의 분리 및 농축이 일어나고 전위차에 의한 시료 분리의 효과를 극대화하기 위하여 베이스(100) 말단에 인접한 베이스 유닛에 위치하는 레저버에 선택적 이온 투과층(400)을 결합시켜 실시한다.In one embodiment of the present invention, in order to maximize the effect of sample separation due to the separation and concentration of the sample, a selective ion-permeable layer 400 is bonded to a reservoir located in the base unit adjacent to the end of the base 100 Conduct.

도2의 (b)를 참조하면, 베이스(100)의 일측 말단에 위치한 제1 말단 베이스 유닛(110)에는 소수성 물질을 포함하는 코팅층(200)이 도포되거나 컷팅되어 부착될 수 있으며, 상기 코팅층(200)으로 구분되는 영역인 제1 말단 레저버(310) 및 베이스(100)에 전압을 인가하여 시료의 분리 및 농축이 일어나도록 하기 위한 제1 전극(510)이 위치할 수 있다.Referring to FIG. 2B, a coating layer 200 including a hydrophobic material may be applied or cut to the first end base unit 110 located at one end of the base 100, and the coating layer 200 and a first electrode 510 for applying a voltage to the base 100 to separate and concentrate the sample.

제2 말단 베이스 유닛(120)에는 소수성 물질을 포함하는 코팅층(2000이 도포되거나 컷팅되어 부착될 수 있으며, 상기 코팅층(200)으로 구분되는 영역인 제2 말단 레저버(320) 및 베이스(100)에 전압을 인가하여 시료의 분리 및 농축이 일어나도록 하기 위한 제2전극(520)이 위치할 수 있다.The second end reservoir 320 and the base 100, which are regions separated by the coating layer 200, may be coated or cut with a coating layer 2000 including a hydrophobic material, The second electrode 520 may be positioned so that separation and concentration of the sample may occur.

제3 말단 베이스 유닛(130)은 제1 말단 베이스 유닛(110)과 인접한 유닛은 아니며, 제4 말단 베이스 유닛(140)은 제2 말단 베이스 유닛(120)과 인접한 베이스 유닛이다.The third end base unit 130 is not a unit adjacent to the first end base unit 110 and the fourth end base unit 140 is a base unit adjacent to the second end base unit 120.

제3 말단 레저버(330)는 제3 말단 베이스 유닛(130)에 위치하며, 상기 제1 말단 레저버(310)와 연결된다. 제4 말단 레저버(340)는 4 말단 베이스 유닛(140)에 위치하며, 상기 제2 말단 레저버(320)와 연결된다. 제3 및 4 말단 레저버(330,340)는 선택적 이온 투과막(400)과 연결되어 이온의 선택적 투과가 일어나도록 한다.The third end reservoir 330 is located in the third end base unit 130 and is connected to the first end reservoir 310. The fourth end reservoir 340 is located in the four-end base unit 140 and is connected to the second end reservoir 320. The third and fourth terminal reservoirs 330 and 340 are connected to the selective ion-permeable membrane 400 to allow selective transmission of ions.

본 발명의 일 실시예로서, 제1 말단 레저버(310) 및 제2 말단 레저버(320) 사이에 전위차가 발생되도록 각각 양의 전극, 음의 전극 또는 접지(ground)가 연결될 수 있도록 하고 제1 말단 레저버(310)와 연결된 제3 말단 레저버(330) 및 제2 말단 레저버(320)와 연결된 제4 말단 레저버(340)에 위치한 선택적 이온 투과막 양단으로 전위차가 발생함에 따라 이온 농도 분극(ICP, ion concentration polarization)에 의해 시료가 분리 및 농축되도록 할 수 있다.As an embodiment of the present invention, a positive electrode, a negative electrode, or a ground may be connected to generate a potential difference between the first end reservoir 310 and the second end reservoir 320, As the potential difference is generated across the selective ion permeable membrane located at the third terminal reservoir 330 connected to the first reservoir 310 and the fourth terminal reservoir 340 connected to the second reservoir 320, The sample can be separated and concentrated by ion concentration polarization (ICP).

도3과 도4는 본 발명의 또 다른 일 실시예에 의한 생체 시료 농축 장치(2)로서, 도3는 생체 시료 농축 장치의 측면도를 나타내고, 도3은 도4의 생체 시료 농축 장치(2)를 설명하기 위한 분해 사시도와 상면도를 나타낸다.3 and 4 are side views of a biological sample concentrating apparatus 2 according to another embodiment of the present invention. Fig. 3 is a sectional view of the biological sample concentration apparatus 2 of Fig. And a top view thereof.

도3 및 도4를 참조하면, 본 발명의 생체 시료 농축 장치(2)는 기판(10), 기판상에 부착되는 양면테이프 등의 접착층(20), 접착층상의 일직선상에 서로 이격되어 형성/부착되는 2개의 패턴된 선택적 이온 투과 멤브레인들(ion perm-selective membrane)(30) 및 2개의 패턴된 선택적 이온 투과 멤브레인들(30) 사이와 양끝에 하나씩 패턴되어 형성/부착된 셀룰로오스페이퍼들(cellulose paper)(40)를 포함하되, 패턴된 셀룰로오스 패턴된 셀룰로오스 페이퍼(40)들은 선택적 이온투과 멤브레인들(30)과 접히는 쪽에서 각각의 단부가 선택적 이온 투과 멤브레인(30) 위로 일부 오버랩(over lap)되도록 형성/부착된다. 셀룰로오스 페이퍼들(40) 중 양 끝의 부착된 페이퍼는 버퍼레저버(reservoir)(41,42), 셀룰로오스 페이퍼들(40) 중 중앙에 형성/부착된 페이퍼는 반응 멤브레인(45)으로서 동작한다.3 and 4, the biological sample concentration apparatus 2 of the present invention comprises a substrate 10, an adhesive layer 20 such as a double-sided tape adhered on the substrate, And two patterned selective iontophoretic membranes 30 and one or more patterned cellulose papers 30 formed on one or both of the two patterned selective iontophoretic membranes 30, The patterned cellulose-patterned cellulose paper 40 is formed such that the ends of the patterned cellulose paper 40 are partially overlapped on the selective iontransfer membrane 30 on the side folded with the selective iontransfer membranes 30 Lt; / RTI > Paper attached to both ends of the cellulose papers 40 is buffered reservoirs 41 and 42 and paper formed / attached at the center among the cellulose papers 40 acts as a reaction membrane 45.

선택적 이온 투과 멤브레인(30)은 마이크로 플로우패터닝(microflow patterning)이나 피펫팅(pipetting) 기법을 이용하여, 접착층(20)에 직접 기 지정된 패턴에 따라 소정의 두께와 길이를 갖는 나피온(Nafion) 멤브레인으로 형성될 수 있다. 다만, 본 발명은 저 비용으로 용이하게 제조가 가능한 생체 분자 농축 장치를 제공하는 것을 특징으로 하고 있으므로, 미리 형성된 나피온 멤브레인을컷팅(cutting)하여 패턴을 형성하고 접착층(20)에 부착하는 것이 바람직하다.The selective ion permeable membrane 30 is formed on the Nafion membrane having a predetermined thickness and length according to a predetermined pattern directly on the adhesive layer 20 by using microflow patterning or pipetting. As shown in FIG. However, the present invention is characterized by providing a biomolecule concentration apparatus that can be easily manufactured at low cost. Therefore, it is preferable to cut a previously formed Nafion membrane to form a pattern and adhere to the adhesive layer 20 Do.

선택적 이온 투과 멤브레인(30)은 특정 이온 물질을 선택적으로 투과시키는 막으로서 나노필터의 기능을 수행하는 나노채널(nano channel)을 구현하기 위한 구성요소이다.The selective ion-permeable membrane 30 is a membrane for selectively transmitting a specific ionic material, and is a component for implementing a nanochannel that functions as a nanofilter.

선택적 이온 투과막(ipsm)은 일 예로 양성자(proton)를 선택하여 투과시키는 나노필터로서 기능할 수 있다. 선택적 이온 투과 멤브레인(30)이 나피온(nafion)으로 구현되는 경우, 나피온의 화학 구조 중 SO3-로 인해서, H+ 이온이 호핑(hopping) 및 비히클기전(vehicle mechanism)에 의하여 선택적으로 빠르게 투과되도록 한다. 따라서, 선택적 이온 투과 멤브레인은 나노필터의 기능을 수행할 수 있다.The selective ion permeable membrane (ipsm) can function as a nanofilter that selectively transmits a proton, for example. When the selective ion-permeable membrane 30 is implemented as a naphion, the SO 3 - in the Nafion's chemical structure allows the H + ion to be selectively and rapidly permeated by hopping and vehicle mechanisms do. Thus, the selective ion-permeable membrane can perform the function of a nanofilter.

다공성 멤브레인으로서의 셀룰로오스 페이퍼(40) 중 양단에 부착되는 버퍼레저버(41,42)는 전극을 통해 외부 전압을 인가 받아 선택적 이온 투과 멤브레인들(30)과 셀룰로오스 페이퍼(40)들에 전위차를 발생한다. 버퍼레저버(41,42)에는 도4의 (b)에 도시된 바와 같이, 와이어를 통해 외부로부터 각각 서로 다른 전압레벨을 갖는 제1 전압(V1, 예를 들어 접지전압) 및 제2 전압(V2)이 인가되도록 구성될 수도 있으나, 외부 전원과 연결될 수 있도록 박막 전극이 미리 구비되어 있을 수도 있다.The buffer reservoirs 41 and 42 attached to both ends of the cellulose paper 40 as the porous membrane receive an external voltage through the electrodes and generate a potential difference between the selective ion permeable membranes 30 and the cellulose paper 40 . As shown in FIG. 4B, the buffer reservoirs 41 and 42 are connected to a first voltage V1 (for example, a ground voltage) and a second voltage V2 may be applied, but a thin film electrode may be provided in advance to be connected to an external power source.

한편, 선택적 이온 투과 멤브레인(30)들 사이에 부착되는 반응 멤브레인(45)은 양단의 선택적 이온 투과 멤브레인(30)과 접하는 쪽에서 일부가 가위로 오버랩되어 중첩되도록 부착된다.On the other hand, the reaction membrane 45 attached between the selective ion-permeable membranes 30 is attached such that a part of the reactive membrane 45 overlaps with the selective ion-permeable membrane 30 at both ends and overlaps with scissors.

반응 멤브레인(45)에 전혈, 혈청 등 샘플 시료가 투여될 수 있고, 샘플 시료에 포함된 다양한 물질들 중 표적 물질을 제외한 물질들은 버퍼레저버(41,42)로 빠져나가면서 표적물질이 반응 멤브레인(45)에 농축되도록 동작한다.A sample sample such as whole blood or serum can be administered to the reaction membrane 45. Of the various substances contained in the sample sample, the substances other than the target substance are discharged into the buffer reservoirs 41 and 42, (45).

예를 들어, 반응 멤브레인(45)에 혈액 샘플이 투여되면, 반응 멤브레인(45)과 선택적 이온 투과 멤브레인(30)이 중첩된 영역에서, 선택적 이온 투과 멤브레인(30)의 표면에 혈액 유체가 접촉되면서 둘 사이에 서로 다른 성질의 유도 전하가 발생한다.For example, when the blood sample is administered to the reaction membrane 45, in the region where the reaction membrane 45 and the selective ion permeable membrane 30 overlap, the blood fluid contacts the surface of the selective ion permeable membrane 30 Induced charges of different nature occur between the two.

이와 같이 유체내에 발생한 유도 전하들이 존재하는 특정한 측을 전기 이중층(EDL: Electric Double Layer)이라고 한다. 이 때, 양단에 배치된 버퍼 레저버(41, 42)에 외부전원이 인가되어 전압차가 발생하면, 전압차에 따른 전기장에 의해 유체내에 존재하는 이온들이 각 이온의 전기적 성질과 반대인 전극쪽으로 이끌리게 된다. 이와 같이 이온들이 전기적 성질에 따라서 반응 멤브레인(45) 내에서 움직이면서 점성력에 의해 유체 입자들을 같이 이끌고 가게 된다. 따라서, 전체적인 유체의 유동이 발생하게 되며, 이와 같은 유체의 이동현상을 전기삼투(EOF: electro-osmosis flow)라고 하고, 이온의 움직음을 전기영동(EP: electrophoresis)이라 한다. The specific side in which induced charges generated in the fluid exist is called an electric double layer (EDL). At this time, when an external power source is applied to the buffer reservoirs 41 and 42 disposed at both ends to generate a voltage difference, the ions in the fluid due to the electric field corresponding to the voltage difference are led to the electrode opposite to the electrical property of each ion . In this way, the ions move in the reaction membrane 45 according to their electrical properties, and lead the fluid particles together by the viscous force. Therefore, the entire fluid flow occurs. The movement of the fluid is referred to as electro-osmosis flow (EOF), and the movement of ions is referred to as electrophoresis (EP).

이러한, 전기영동(Capillary electrophoresis) 및 전기삼투(electro-osmosis)의 특성은 선택적 이온 투과막(ipsm)으로 구현된 나노채널 근청서 그 특성이 달라져, 이온 농도 분극(ion concentration polarization)이 발생한다. 따라서, 나노 채널로서 기능하는 선택적 이온 투과 멤브레인(30)과 중첩 배치된 반응 멤브레인(45)의 반응영역에서 음극쪽에는 이온농축(enrichment)이 발생하고, 양극쪽에서는 이온결핍(depletion)이 발생하게 된다. 이때, 결핍된 낮은 이온농도와 그에 따른 높은 전기장에 의해 결핍영역(depletion zone)이 전하(charge)를 띈 단백질에 대해 일종의 전기적 장벽(electric barrier)으로 작용을 하게 된다. 그 결과 단백질은 결핍 영역을 통과하지 못하고 그 앞에 농축된다. 즉, 표적물질인 단백질이 반응 멤브레인(45) 내의 결핍영역 앞에 매우 빠른 시간에 농축된다.These characteristics of capillary electrophoresis and electro-osmosis vary depending on the characteristics of the nanochannel structure implemented by the selective ion-permeable membrane (ipsm), and ion concentration polarization occurs. Therefore, ion enrichment occurs at the cathode side and ion depletion occurs at the anode side in the reaction region of the selective ion-permeable membrane 30 functioning as a nano channel and the reaction membrane 45 arranged in a superposed manner do. At this time, the depletion zone acts as an electric barrier to charged proteins due to the deficient low ion concentration and thus the high electric field. As a result, the protein does not pass through the deficiency area and is concentrated before it. That is, the protein, which is the target substance, is concentrated in a very short time in front of the deficiency region in the reaction membrane 45.

다음으로, 농축된 표적 유전물질을 검출한다(S600).Next, the concentrated target dielectric material is detected (S600).

여기서, 본 발명의 일 실시예에 따른 표적 유전물질의 검출 방법은, 형광을 띄는 물질을 검출하는 형광검출법을 이용하여, 시료의 화학물질이 녹아 있는 이동상을 펌프를 이용하여, 고압의 일정한 유속으로 밀어서 충진제가 충진되어 있는 고정상인 컬럼을 통과하도록 하며, 이때 시료의 화학물질이 이동상과 고정상에 대한 친화도에 따라 다른 시간대별로 컬럼을 통과하는 원리를 이용하며, 이러한 화학물질을 검출기를 이용하여 시간대별 반응의 크기를 측정함으로써 특정 화학물질을 정량하는 고성능 액체 크로마토그래피(HPLC, High Performance Liquid Chromatography)를 이용하여, 검출할 수 있다.Here, the method of detecting a target dielectric material according to an embodiment of the present invention is a method of detecting a fluorescent material by using a fluorescence detection method to detect a fluorescent material by using a pump in which a mobile substance in which a chemical substance of a sample is dissolved, And push the column through a fixed-bed column filled with a filler. At this time, the principle that the chemical substance of the sample passes through the column at different times according to the affinity for the mobile phase and the stationary phase is used. And can be detected using high performance liquid chromatography (HPLC), which quantifies a specific chemical substance by measuring the magnitude of the reaction by the mass.

크로마토그래피를 이용한 액체시료의 검출방법은 이미 개발되어 있는 공지기술로 자세한 원리 및 설명은 여기서는 생략한다.The method of detecting a liquid sample using chromatography is a well-known technique that has been already developed, and detailed principles and explanations thereof are omitted here.

이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for illustrating the present invention and that the scope of the present invention is not construed as being limited by these embodiments.

[실시예][Example]

1. 표적 유전물질 수집 1. Collecting Target Genetic Materials

지카바이러스(Zika virus)를 검출하기 위하여, 실제 지카바이러스와 동일한 RNA를 지니고 있으나, 감염성이 없는 Zeptometrix 사의 NATtrol™Zika Virus (strain: MR766 (Uganda))를 인간 혈액에 주입시켜 이를 시료로 하여, 추출한 지카바이러스 RNA를 106copy 부터 1copy까지 희석하여 등온증폭 반응의 주형으로 사용하였다.In order to detect Zika virus, NATtrol (TM) Zika Virus (strain: MR766 (Uganda)) of Zeptometrix, which has the same RNA as the actual Zikac virus but has no infectivity, is injected into human blood, Chikavirus RNA was diluted from 10 6 copies to 1 copy and used as a template for isothermal amplification reaction.

2. 프라이머 작성 2. Creating a primer

표적 유전물질을 등온증폭법(loop-mediated isothermal amplification, LAMP)을 통하여 검출하기 위하여, 프라이머(primer)를 지카바이러스 RNA의 전체 염기서열(Genbank: AY632535, strain: MR766 (Uganda))를 이용하여 작성하였다. 등온증폭법을 이용하기 위해서는 4개의 프라이머(FIP, BIP, F3 및 B3)가 하나의 세트가 되어 표적 유전물질의 증폭을 야기하며, 증폭의 속도를 가속화 하기 위해 2개의 루프 프라이머(LF, LB)를 추가로 설계하여 프라이머 세트를 제작하였다.In order to detect the target genetic material through loop-mediated isothermal amplification (LAMP), a primer was prepared using the entire nucleotide sequence of zikavirus RNA (Genbank: AY632535, strain: MR766 (Uganda)) Respectively. In order to use the isothermal amplification method, four primers (FIP, BIP, F3 and B3) are set as one set to cause amplification of the target dielectric material, and two loop primers (LF and LB) To prepare a primer set.

3. 등온증폭법의 시행 3. Isothermal amplification

표적 유전물질 지카바이러스 RNA 추출은 바이오니아 사의 Viral RNA Extraction Kit방법을 따른다. 먼저 1.5ml 튜브에 200의 지카바이러스가 주입된 인간혈액을 넣는다. 400의 바인딩 버퍼(Binding buffer)를 넣고 5초간 볼택싱(vortexing)을 하여 10분간 상온에서 반응시킨 뒤, 100의 이소프로페놀을 넣고 5초간 볼택싱(vortexing) 한다. 바인딩 컬럼(Binding column)에 희석시킨 모든 용액(700)을 옮긴 뒤에 뚜껑을 닫고 약 8000rpm에서 1분간 원심 분리한다. 바인딩 컬럼을 튜브에서 빼내어 새로운 컬렉션 튜브(Collection tube)에 끼운 뒤 500의 W1 버퍼를 넣고 약 8000rpm에서 1분간 원심 분리한다. 바인딩 컬럼을 빼내어 컬렉션 튜브에 담긴 폐액을 버리고 다시 끼운 뒤 약 8000rpm 에서 1분간, 13000rpm에서 1분간 원심 분리한다. 바인딩 컬럼을 1.5ml 튜브에 옮기고 50의 일루션 버퍼(Elution buffer)를 넣고 1분간 반응시킨 뒤 1분간 약 8000rpm에서 원심 분리하여 5.5ng/(4.7108copy)의 정제된 지카 바이러스 RNA시료를 얻는다. 이 것을 10배씩 희석(106copy 부터 1copy 까지)하여 등온증폭 반응의 주형으로 사용하였다.Target genetic material Zicavirus RNA extraction follows the Viral RNA Extraction Kit method of Bioneer. First, 200 ml of Zikavirus-infused human blood is put into a 1.5 ml tube. 400 binding buffer, vortexing for 5 seconds, reacting at room temperature for 10 minutes, adding 100 isopropanol, and vortexing for 5 seconds. After transferring all the diluted solution (700) to the binding column, close the lid and centrifuge at about 8000 rpm for 1 minute. Remove the binding column from the tube, insert it in a new collection tube, add 500 W1 buffer, and centrifuge at approximately 8000 rpm for 1 minute. Remove the binding column, discard the waste solution in the collection tube, reinsert it, and centrifuge at 8000 rpm for 1 minute and 13000 rpm for 1 minute. The binding column is transferred to a 1.5 ml tube, reacted with 50 μl of Elution buffer for 1 min, and centrifuged at approximately 8000 rpm for 1 min to obtain a purified chicavirus RNA sample of 5.5 ng / (4.710 8 copies). This was diluted 10-fold (from 10 6 copies to 1- copy) and used as a template for isothermal amplification reaction.

6개의 프라이머(FIP, BIP, F3, B3 및 추가적인 LF, LB)는 지카 바이러스 RNA의 전체 염기서열(Genbank: AY632535, strain: MR766 (Uganda))에 상보적인 서열을 포함되도록 설계하였으며, 각각의 서열 정보는 다음과 같다.Six primers (FIP, BIP, F3, B3 and additional LF, LB) were designed to contain a sequence complementary to the entire nucleotide sequence of zikavirus RNA (Genbank: AY632535, strain: MR766 (Uganda) The information is as follows.

FIP: 5'- GGCGTGGGCATCCTTGAATTCTGCAGACACCGGAACTCCA -3'FIP: 5'-GGCGTGGGCATCCTTGAATTCTGCAGACACCGGAACTCCA -3 '

BIP: 5'- GGCAAACCGTCGTCGTTCTGGCTCAGCCTCTAGAGCTCCA -3'BIP: 5'- GGCAAACCGTCGTCGTTCTGGCTCAGCCTCTAGAGCTCCA -3 '

F3: 5'- TGACATCCCATTGCCTTGG -3'F3: 5'- TGACATCCCATTGCCTTGG -3 '

B3: 5'- CTTCCCTTTGCACCATCCAT -3'B3: 5'-CTTCCCTTTGCACCATCCAT -3 '

LF: 5'- TGCCTCTTTGTTGTTCCAGTG -3'LF: 5'- TGCCTCTTTGTTGTTCCAGTG -3 '

LB: 5'- AGCCGTTCACACGGCTC -3'LB: 5'-AGCCGTTCACACGGCTC -3 '

도5는 본 발명의 일 실시예에 따른 지카 RNA의 검출결과를 나타내는 도면이다. 도5를 참고하면, 검출에 사용한 유전자에 따라 지카 RNA를 106copy 부터 1copy까지 희석한 것을 샘플로 하여 등온증폭반응을 이용하여 검출한 결과로써, 등온증폭반응으로 지카 바이라스의 검출 유무 및 검출 한계를 확인할 수 있다.5 is a diagram showing the detection results of Zicat RNA according to an embodiment of the present invention. Referring to FIG. 5, as a result of isothermal amplification reaction of samples obtained by diluting 10 6 copies to 1 copy of chica RNA according to the gene used for detection, samples were subjected to isothermal amplification reaction to detect whether or not chikaviras was detected You can see the limit.

도6은 본 발명의 일 실시예에 따른 또 다른 지카 RNA의 검출결과를 나타내는 도면이다. 보다 상세하게는, Mg2+의 농도에 따라 지카 RNA의 검출 여부를 확인한 결과 도면이다. 도6의 (a)를 참고하면, 4mM의 Mg2+를 사용하여, 지카 RNA의 유무를 명확하게 구별할 수 있다는 결과를 나타내는 도면이고, (b)는 30분 이상 반응하여, 지카 RNA를 검출할 수 있음을 나타내는 도면이다.FIG. 6 is a diagram showing the detection result of another zuca RNA according to an embodiment of the present invention. More specifically, it is a result of checking whether or not Zicat RNA is detected according to the concentration of Mg2 +. 6 (a) is a graph showing the result that the presence or absence of zicat RNA can be clearly distinguished by using 4 mM Mg2 +, and Fig. 6 (b) Fig.

도7은 본 발명의 일 실시예에 따른 램프 반응을 위한 최적 dNTP 농도를 나타내는 도면이다. 도7에 도시된 바와 같이, dNTP의 농도가 0.6mM ~ 1.8mM 까지는 지카 바이러스가 샘플에 존재하지 않는 Negative control에서 위양성이 발생했으나, 2.2mM에서는 이러한 위양성 결과가 발생하지 않았으므로, 최적 dNTP의 농도가 2.2mM임을 확인할 수 있다.Figure 7 is a plot of optimal dNTP concentration for lamp response in accordance with one embodiment of the present invention. As shown in FIG. 7, when the concentration of dNTP was 0.6 mM to 1.8 mM, false positive was observed in the negative control in which no zykova virus was present in the sample. However, since the false positive result was not generated at 2.2 mM, the optimum dNTP concentration Is 2.2mM.

1, 2: 생체 시료 농축 장치
100: 베이스
110, 120, 130, 140: 말단 베이스 유닛
200: 코팅층
300: 레저버
310, 320, 330, 340: 말단 레저버
400: 선택적 이온 투과층
510, 520: 전극
10: 기판
20: 접착층
30: 선택적 이온 투과 멤브레인
40: 셀룰로오스페이퍼
45: 반응 멤브레인1, 2: Biological sample concentrator
100: Base
110, 120, 130, 140: end base unit
200: Coating layer
300: Leisure
310, 320, 330, 340: End Levers
400: selective ion-permeable layer
510, 520: electrode
10: substrate
20: Adhesive layer
30: Selective ion permeable membrane
40: cellulose paper
45: Reaction membrane

Claims (13)

a)핵산 성분을 포함하는 표적 유전물질이 포함되어 있는지 여부를 판단하고자 하는 시료를 미리 정해진 온도 구간에서 시약과 반응시켜, 상기 시료 중 상기 표적 유전물질에 해당하는 일 부분이 증폭하는 단계;
b)상기 적어도 일부분이 증폭된 표적 유전물질이 포함된 시료를 생체 시료 농축 장치를 이용하여 상기 증폭된 표적 유전물질을 농축하는 단계; 및
c)상기 농축된 표적 유전물질을 검출하는 단계;를 포함하되,
상기 생체 시료 농축 장치는, 미리 정해진 간격으로 접혀질 수 있고, 접혀지는 기본 단위가 되는 복수개의 베이스 유닛들을 포함하는 베이스, 상기 베이스의 적어도 일부 영역에 위치하여 처리 대상 시료의 흡착을 방지하고 저장 공간 또는 이동 경로를 구분하는 코팅층, 상기 코팅층에 의하여 영역이 정의되고 상기 베이스 유닛에 각각 위치하며, 상기 핵산 성분을 포함하는 표적 유전물질이 포함되어 있는지 여부를 판단하고자 하는 시료에 포함되어 분리하고자 하는 상기 표적 유전물질 또는 상기 시료에서 상기 표적 유전물질을 제외한 분리 대상 물질을 적어도 일부 흡착하여 저장하거나 이동 경로를 제공하는 복수개의 레저버들 및 상기 레저버들 중 적어도 일부의 레저버와 적어도 일부 중첩하여 위치하며 이온을 선택적으로 투과시키는 선택적 이온 투과층을 더 포함하는 것을 특징으로 하는 표적 유전물질 검출 방법.a) amplifying a portion of the sample corresponding to the target genetic material by reacting the sample with a reagent at a predetermined temperature interval to determine whether or not a target genetic material containing a nucleic acid component is contained;
b) concentrating the amplified target genetic material using a biological specimen concentrator with a sample containing the at least a portion of the amplified target genetic material; And
c) detecting the enriched target dielectric material,
The biological sample concentration apparatus includes a base including a plurality of base units which can be folded at predetermined intervals and to be a basic unit to be folded, a base disposed at least in a partial region of the base to prevent adsorption of a sample to be treated, And a coating layer for separating the moving path, a region defined by the coating layer, each located in the base unit, and a target substance to be included in a sample to be determined whether or not a target dielectric material containing the nucleic acid component is contained, A plurality of reservoirs for at least partially adsorbing and storing a target dielectric material or a separation target material excluding the target dielectric material in the sample to provide a movement path and at least a part of the reservoir for overlapping at least a part of the reservoir, Selective < / RTI > Target genetic material detecting method according to claim 1, further comprising a permeable layer. 제1항에 있어서, a) 단계는,
a1)상기 핵산 성분을 포함하는 표적 유전물질이 포함되어 있는지 판단하고자 하는 시료를 전처리하는 단계;
a2)상기 전처리된 시료와 상기 표적 유전물질에 반응하는 시약을 혼합하는 단계;
a3)상기 혼합된 시료와 상기 시약을 상기 미리 정해진 온도 구간에서 유지하는 단계; 및
a4)상기 미리 정해진 온도 구간에서 상기 표적 유전물질의 적어도 일부분이 증폭하는 단계;
를 더 포함하는 표적 유전물질 검출 방법.The method of claim 1, wherein step a)
a1) pre-treating a sample to determine whether a target dielectric material containing the nucleic acid component is contained;
a2) mixing the pretreated sample with a reagent that reacts with the target dielectric material;
a3) maintaining the mixed sample and the reagent at the predetermined temperature interval; And
a4) amplifying at least a portion of the target dielectric material at the predetermined temperature interval;
≪ / RTI > 제2항에 있어서, 상기 시약은
상기 표적 유전물질에 반응하는 프라이머 및 효소를 포함하는 것을 특징으로 하는 표적 유전물질 검출 방법.The method of claim 2, wherein the reagent comprises
A primer and an enzyme responsive to the target genetic material. 제1항에 있어서, 상기 시료를 미리 정해진 온도 구간에서 증폭하는 것은,
램프(LAMP) 반응을 이용하여 증폭하는 것을 특징으로 하는 표적 유전물질 검출 방법.The method of claim 1, wherein amplifying the sample at a predetermined temperature interval comprises:
Characterized in that the amplification is carried out using a lamp (LAMP) reaction. 제1항에 있어서, 상기 표적 유전물질은 지카 바이러스(Zika Virus)인 것을 특징으로 하는 표적 유전물질 검출 방법.2. The method of claim 1, wherein the target genetic material is Zika Virus. 제1항에 있어서,
상기a)단계에서 상기 미리 정해진 온도는 72도인 것을 특징으로 하는 표적 유전물질 검출 방법.The method according to claim 1,
Wherein the predetermined temperature in step a) is 72 degrees. 제2항에 있어서,
상기 a3)단계는, 10분 내지 20분 동안 수행되는 것을 특징으로 하는 표적 유전물질 검출 방법.3. The method of claim 2,
Wherein the step a3) is performed for 10 minutes to 20 minutes. 제1항에 있어서, c)단계에서 상기 표적 유전물질을 검출하는 것은,
상기 농축된 시료를 크로마토그래피를 이용하여 검출하는 것을 특징으로 하는 표적 유전물질 검출 방법.The method of claim 1, wherein detecting the target dielectric material in step c)
Wherein the concentrated sample is detected using chromatography. 삭제delete 제1항에 있어서,
상기 베이스유닛은 선택적으로 적어도 하나를 절취하여 상기 시료의 타겟 물질 또는 분리 대상 물질을 선택적으로 채득할 수 있고,
상기 복수개의 레저버들은 처리 대상이 되는 시료 또는 도전성 액체로 점습되고,
상기 코팅층은 알코올 지방산 에스터로서 왁스(Wax, 蠟)를 포함하는 것을 특징으로 하는 표적 유전물질 검출 방법.The method according to claim 1,
The base unit may selectively extract at least one target material or a separation target material from the sample,
Wherein the plurality of reservoirs are wetted with a sample to be treated or a conductive liquid,
Wherein the coating layer comprises wax (Wax) as an alcohol fatty acid ester. 제1항에 있어서, 상기 생체 시료 농축 장치는
접착층;
상기 접착층 상의 일직선상에 서로 이격되어 형성된 2개의 패턴된 선택적 이온투과 멤브레인들; 및
상기 선택적 이온투과 멤브레인들 사이와 양끝에 하나씩 패턴되어 형성된 다공성 멤브레인을 포함하고,
상기 선택적 이온투과 멤브레인들의 양끝에 형성된 상기 다공성 멤브레인은 버퍼레저버이고,
상기 선택적 이온투과 멤브레인들 사이에 형성된 상기 다공성 멤브레인은반응 멤브레인인 것을 특징으로 하는 표적 유전물질 검출 방법.The apparatus according to claim 1, wherein the biological sample concentration apparatus
Adhesive layer;
Two patterned selective iontophoretic membranes spaced apart on a straight line on the adhesive layer; And
And a porous membrane formed between the selective ion-permeable membranes and patterned at both ends,
The porous membrane formed at both ends of the selective ion-permeable membranes is a buffer reservoir,
Wherein the porous membrane formed between the selective iontophoretic membranes is a reactive membrane. 제11항에 있어서,
양끝의 각 상기 버퍼레저버에 전원을 인가하고 상기 반응 멤브레인에 상기 표적 유전물질이 포함되어 있는지 판단하고자 하는 시료를 투여하여 상기 반응 멤브레인에 생체분자를 농축하기 위한 것을 특징으로 하는 표적 유전물질 검출 방법.12. The method of claim 11,
A method for detecting a target genetic material comprising the steps of: applying power to each of the buffer reservoirs at both ends, and concentrating the biomolecules on the reaction membrane by administering a sample to the reaction membrane to determine whether the target membrane material is contained; . 제11항에 있어서, 상기 버퍼레저버 및 상기 반응 멤브레인은 셀룰로오스 페이퍼로 이루어진 것을 특징으로 하는 표적 유전물질 검출 방법.12. The method of claim 11, wherein the buffer reservoir and the reaction membrane are made of cellulose paper.
KR1020160099585A 2016-08-04 2016-08-04 Method for detecting Zika virus using Loop-mediated isothermal amplification reaction and Biosample preconcentration device KR101892140B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020160099585A KR101892140B1 (en) 2016-08-04 2016-08-04 Method for detecting Zika virus using Loop-mediated isothermal amplification reaction and Biosample preconcentration device

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020160099585A KR101892140B1 (en) 2016-08-04 2016-08-04 Method for detecting Zika virus using Loop-mediated isothermal amplification reaction and Biosample preconcentration device

Publications (2)

Publication Number Publication Date
KR20180015945A KR20180015945A (en) 2018-02-14
KR101892140B1 true KR101892140B1 (en) 2018-08-27

Family

ID=61229718

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020160099585A KR101892140B1 (en) 2016-08-04 2016-08-04 Method for detecting Zika virus using Loop-mediated isothermal amplification reaction and Biosample preconcentration device

Country Status (1)

Country Link
KR (1) KR101892140B1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20200120832A (en) * 2019-04-12 2020-10-22 가천대학교 산학협력단 Foldable typed isothermal amplification microdevice for detection of pathogens and method the same

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102125414B1 (en) * 2018-10-25 2020-06-22 주식회사 켈스 Large Capacity Biosample Concentration Device and Fabrication Method Thereof
US20220283149A1 (en) 2019-08-06 2022-09-08 Gmd Biotech, Inc All-in-one molecular diagnostics device
CN110894553A (en) * 2019-11-08 2020-03-20 珠海国际旅行卫生保健中心(拱北海关口岸门诊部) Primer, probe, kit and RT-iPCR method for detecting Zika virus

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2002335962A (en) * 2001-05-23 2002-11-26 Tum-Gene Inc Device and method for concentrating gene

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101282924B1 (en) 2011-11-15 2013-07-05 전북대학교산학협력단 PCR primer for detecting Salmonella

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2002335962A (en) * 2001-05-23 2002-11-26 Tum-Gene Inc Device and method for concentrating gene

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20200120832A (en) * 2019-04-12 2020-10-22 가천대학교 산학협력단 Foldable typed isothermal amplification microdevice for detection of pathogens and method the same
KR102221289B1 (en) 2019-04-12 2021-03-02 가천대학교 산학협력단 Foldable typed isothermal amplification microdevice for detection of pathogens and method the same

Also Published As

Publication number Publication date
KR20180015945A (en) 2018-02-14

Similar Documents

Publication Publication Date Title
US11717822B2 (en) System for portable and easy-to-use detection of analytes with mobile computing device
US10871482B2 (en) Target detection with nanopore and a polymer scaffold complex
KR101892140B1 (en) Method for detecting Zika virus using Loop-mediated isothermal amplification reaction and Biosample preconcentration device
US20200384470A1 (en) Devices and methods for sample analysis
US20210325334A1 (en) Devices and Methods for Sample Analysis
US20200348293A1 (en) Target Detection with Nanopore
Lion et al. Why the move to microfluidics for protein analysis?
JP7277050B2 (en) Isotachophoresis for purification of nucleic acids
US11016079B2 (en) Integrated membrane sensor for rapid molecular detection
AU2016219358B2 (en) Device and method for analysis of biofluids by ion generation using wetted porous material
US5876918A (en) Aligned fiber diagnostic chromatography with positive and negative controls
US20190009276A1 (en) Amplification and detection of nucleic acids
GB2306643A (en) MALDI-TOF mass spectroscopic analysis of nucleic acid
US20210080457A1 (en) Method and system of microfluidic immunoassay using magnetic beads
WO2010040214A1 (en) Digital microfluidic method for protein extraction by precipitation from heterogeneous mixtures
Ríos et al. Sample preparation for micro total analytical systems (μ-TASs)
KR101968319B1 (en) Sample Separation Device Based on Origami Using Filtering Layer
WO2011112068A1 (en) Lateral flow device and method of detection of nucleic acid sequence
CN107429209B (en) Target analysis chip and target analysis method
WO2006062149A1 (en) Plate for biological sample analysis
KR101718951B1 (en) Biomolecular preconcentration device and fabrication method thereof
JP2006226752A (en) Plate for bio-sample discrimination device
JP2006242612A (en) Plate for discriminating biological sample
US20240219345A1 (en) Sample transfer method and system
EP4382204A1 (en) Device for integrated processing of biological samples

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant