KR101888840B1 - The lipoxygenase-2 and lipoxygenase-3 gene isolated from Tricholoma matsutake - Google Patents

Abstract

A lipoxygenase-2 coding gene consisting of the gene sequence of SEQ ID NO: 1 and a lipoxygenase-3 coding gene consisting of the gene sequence of SEQ ID NO: 3.

Description

The lipoxygenase-2 and lipoxygenase-3 gene isolated from Tricholoma matsutake were isolated from pine mushroom.

This disclosure is directed to a gene encoding a novel protein derived from Tricholoma matsutake. More specifically, the present invention relates to a gene encoding Lipoxygenase-2 and Lipoxygenase-3 derived from Pine Mushroom.

Lipoxygenase is a non-heme dioxygenase that adds molecular oxygen to polyunsaturated fatty acids. Cis-1,4-pentadiene structure of unsaturated fatty acids such as linolic acid, linoleic acid and arachodonic acid and recognizes stereoisomers of cis- It catalyzes the reaction to produce hydroperoxide by addition of oxygen and site-specific oxygen. Lipoxygenase is widely distributed in plants, fungi, invertebrates, and mammals.

Plant lipoxygenase is divided into 9- and 13-lipoxygenase depending on the position of the double bonds attacking oxygen on the representative substrate linoleic acid, linoleic acid, and it is divided into plant defense mechanism, aging, seed germination and plant growth and development Into various bioactive agents involved.

In animals, there are 5-, 8-, 12- and 15-lipoxygenases depending on the difference in location of adding oxygen to the representative substrate arachidonic acid. The products leucotriene, hepoxilins and HETEs , Play an important role in maintaining the homeostasis of animal cells and the pathophysiology of inflammation or immunity.

Studies on fungi lipoxygenase have been reported very little. The lipoxygenase of the benthic microbial fungus ( Saprolegnia parasitica ) has the activity of synthesizing epoxyalcohol, and the lipoxygenase activity of the malassezia yeast causes superficial skin fungus on the skin, and the fungus of root infectivity ( Gaeumannomyces graminis ) secrete lipoxygenase into wheat roots and cause root rot. Lipoxygenase activity also plays an important role in the synthesis of characteristic fragrance components of mushrooms. In particular, octenol (1-octen-3-ol), known as matsutakeol, a typical aromatic component of matsutake mushrooms, is synthesized by the oxidation of linoleic acid, the enzyme involved is lipoxygenase. Therefore, it is very likely to be applied to the mass production of octanol and the new food microbial and floriculture industries using the Lipoxygenase Genetic Resource.

Studies on Lipoxygenase-2 and Lipoxygenase-3 have been conducted in various fields such as high production through high expression of these useful genes and methods of maximizing efficiency through genetic engineering suitable for use The possibility of application is very high.

SUMMARY OF THE INVENTION The present disclosure is in accordance with the aforementioned needs, and it is an object of the present disclosure to provide a method of producing Tricholoma mushroom 2 and lipoxygenase-3 of matsutake .

In order to accomplish the above object, the lipoxygenase-2 coding gene according to one embodiment of the present disclosure is composed of the gene sequence of SEQ ID NO: 1.

In this case, the Lipoxygenase -2-coding gene is derived from the Matsutake mushrooms (Tricholoma matsutake).

On the other hand, the lipoxygenase-2 according to one embodiment of the present disclosure consists of the amino acid sequence of SEQ ID NO: 2.

In this case, the above-mentioned lipoxygenase-2 is a mushroom of Tricholoma matsutake .

Meanwhile, the primer set for detecting the lipoxygenase-2 coding gene according to an embodiment of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 5 and SEQ ID NO: 6.

Meanwhile, the lipoxygenase-3 coding gene according to one embodiment of the present disclosure consists of the gene sequence of SEQ ID NO: 3.

In this case, the Lipoxygenase -3-coding gene is derived from the Matsutake mushrooms (Tricholoma matsutake).

On the other hand, the lipoxygenase-3 according to one embodiment of the present disclosure consists of the amino acid sequence of SEQ ID NO: 4.

In this case, the Lipoxygenase-3 was transformed into Tricholoma matsutake ) is derived from.

Meanwhile, the primer set for detecting the lipoxygenase-3 coding gene according to an embodiment of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 7 and SEQ ID NO: 8.

FIG. 1 is a multiple alignment of the previously found amino acid sequences of the lipoxygenase-2 amino acids of lipoproteinase, lipoxygenase-2 and lipoxygenase-3.

Various embodiments of the present disclosure will now be described in detail. In the following description of the present invention, detailed description of known functions and configurations incorporated herein will be omitted when it may make the subject matter of the present disclosure rather unclear. In addition, the following examples can be modified in various ways, and the scope of the technical idea of the present disclosure is not limited to the following examples. Rather, these embodiments are provided so that this disclosure will be more thorough and complete, and will fully convey the scope of the present disclosure to those skilled in the art.

The present disclosure relates to a method for producing Lipoxygenase -2 and Lipoxygenase-3, which are different in nucleotide sequence and amino acid structure from the Lipoxygenase gene of a pine mushroom, which has been previously found from Tricholoma matsutake which is an exogenous mycorrhiza interacting with pine root, Encoding genes that are involved in gene expression.

Specifically, in this disclosure, a gene encoding novel lipoxygenase-2 and lipoxygenase-3 is isolated from the highest quality pine mushroom of domestic wild-type, and the lipoxygenase-2 and lipoxygenase-3 gene are cloned Respectively. When comparing the nucleotide sequences of the lipoxygenase-2 and lipoxygenase-3 gene derived from P. japonicum amplified in the present invention to the lipoxygenase gene of the pine mushroom which has been found in the past, the nucleotide sequence of the lipoxygenase- -2 and the lipoxygenase-3 gene. A food microorganism having a sweetener such as a traditional rice wine fermented yeast, a bread fermented yeast, a Songyi flavored fermented milk, a Songyi incense miso, and a variety of Songyi incense beverages, which are obtained by using the Lipoxygenase-2 and Lipoxygenase- It is possible to develop and develop new products in the field of industry.

The present disclosure relates to a method for producing Tricholoma mushroom matsutake- derived lipoxygenase-2 and lipoxygenase-3 coding gene sequences and amino acid sequences thereof.

The method for identifying the gene sequence and the amino acid sequence includes isolating and purifying total RNA from Tricholoma matsutake; Obtaining cDNA from the RNA; And selectively cloning the lipoxygenase-2 and the lipoxygenase-3 gene in the cDNA.

Mushroom ( Tricholoma matsutake ) belongs to the porcine mushroom, the wrinkle mushroom, the wrinkled mushroom, the matsutake mushroom and the matsutake mushroom. Triticum matsutake ( Tricholoma matsutake ) is an exogenous mycorrhizal fungus attached to the hair of the root of the pine root. It is known as an organism that feeds carbohydrates from pine trees and supplies some of the inorganic nutrients to pine trees. Pine ( Pinus densiflora ) is the most widely grown species in Korea and is distributed in most of the forests. It is known as a special microorganism that occurs only in the pine forest which has a specific environment where clusters can occur. In 2011, the production volume of 210 tons (26.9 billion won) was significantly lower than 729 tons (64.5 billion won) in the previous year. In the main production area, about 65% of total production was produced in Gyeongsangbuk-do, and about 20% (42 tons, 4.9 billion won) of total production was produced in Mungyeong city. From September 2011 to August 2012, about 11 tons ($ 2,890 thousand) was exported to China, and about 408 tons ($ 6,9990 thousand) was imported from China (Korea Forest Service statistics).

(1-octen-3-ol), known as matsutakeol, is a major aromatic component of matsutake mushroom. In the synthesis of 1-octen-3-ol, lipoxygenase and hydraperoxide An enzyme called hydroperoxide lyase is involved. The linoleic acid of pine mushroom was oxidized to (S) -1-hydroperoxy- (8E, 12Z) -8,12-octadecadienoic acid (10-HPODE) ) -1-octen-3-ol and 10-Oxo-trans-8-decenoic acid (ODA) are biosynthesized. Lipoxygenase is an enzyme involved in the production of 10-HPODE mediator by oxidizing linoleic acid. Therefore, it is an enzyme that leads biosynthesis of 1-octen-3-ol, which is the main component of the aroma of Lipoxygenase. Pine mushroom is a very popular edible mushroom in Asia. Therefore, if it is applied to the production of useful substances or the development of new food microorganisms by using lipoxygenase genetic information related to the biosynthesis of 1-octen-3-ol, Many positive effects will be exerted on the microbial industry of

In the present disclosure, cDNAs are obtained from the total RNA of Pine Mushroom, and genes encoding the enzymes are PCR-amplified using specific primers capable of selectively amplifying the genes encoding Lipoxygenase-2 and Lipoxygenase-3 Cloning was used.

According to Example 4 of the present disclosure, cDNA obtained after RT-PCR is inserted into a plasmid vector such as pGEM® Easy Vector. However, it is not limited thereto, and it is also possible to use other kinds of plasmid vectors such as T-Vector pMD20. In addition, YAC, BAC, cosmid or bacteriophage can be used as an insertion vector of cDNA.

Hereinafter, specific methods of the present disclosure will be described in detail by way of examples. However, the scope of the present disclosure is not limited to these embodiments.

[ Example  One]

Total RNA isolation and purification of pine mushroom

Total RNA was isolated from about 1 g of pine mushroom fruiting body collected in the Gangchang area near Daegu. Total RNA was isolated from the pine mushroom fruiting bodies collected in the Gangchang area near Daegu. Fruiting total RNA was isolated using QIAGEN kit (RNeasy Maxi kit: cat # 75162). Approximately 1 g of fruiting body tissue was taken and ground using liquid nitrogen and a mortar. Dissolved in RLT buffer in a 15 mL kit containing beta-mercaptoethanol and milled with a homogenizer. The sample solution was centrifuged at 3,000 g for 10 minutes to separate the supernatant. 15 ml of 70% EtOH was added thereto, followed by thorough mixing at 3,000 g for 5 minutes to adhere the total RNA to the membrane. After two washing steps, 1.2 ml of RNase-free water was added to elute the total RNA.

[ Example  2]

CDNA acquisition from total RNA

MRNA was isolated from the total RNA obtained in Example 1 using an oligotex mRNA purification kit (QIAGEN), and cDNA was amplified using reverse transcriptase using an oligomer containing dT17 as a primer Were synthesized. The synthesized cDNA was amplified by PCR using a XL PCR kit (PerkinElmer) containing a 5 'end oligonucleotide and an oligomer at the 3' end of the synthesized DNA insert. The PCR product thus obtained was treated with an enzyme of SfiI and subjected to agarose gel electrophoresis to isolate cDNA fragments of 1.3 kb or more. The resulting fragment was ligated to a pCNS-D2 vector treated with DraIII enzyme and electroporated E. coli Top10F '(Invitrogen).

[Example 3]

Determination of cDNA sequence and analysis of data

The cDNA prepared above was plated on an LB agar medium containing ampicillin (100 ug / ml), and a plurality of cDNA clones were cultured. In order to analyze the nucleotide sequence of the clones obtained, the plasmid DNA was isolated from the MWG 96-well plasmid preparation system and sequenced by ABI 3700, an automated sequencing machine. Similarity searches of determined DNA data were performed using NCBI blastx.

[ Example  4]

The initiation and termination codon determinations were performed using 5'-Full RACE and 3'-Full RACE

To the total RNA prepared above, 1.5 μl of 10 × RT buffer, 0.5 μl of RNase inhibitor, 1 μl of AMV reverse transcriptase XL and 1 μl of 5 'end-phosphorylated RT-primer were added and incubated at 30 ° C. for 10 minutes, 50 ° C. for 60 minutes, Min to synthesize the first strand cDNA. Hybrid RNA was removed by adding 5x Hybrid RNA Degradation Buffer and RNase H to the above reaction mixture. 5x RNA Ligation Buffer and 40% PEG # 6000 were added and mixed. Then, 1 μl of T4 RNA Ligase was added and reacted at 15 ° C for 18 hours. After the single-stranded cDNA was circularized, the initiation codon of the target gene was determined by performing a polymerase chain reaction (PCR).

To the prepared total RNA, add 2 μl of 10x RNA PCR buffer, 4 μl of magnesium chloride, 2 μl of dNTP mixture, 1 μl of AMV reverse transcriptase XL, 0.5 μl of RNase inhibitor and 1 μl of oligo dT-3sites adapter primer, , 50 캜 for 30 minutes, 95 캜 for 5 minutes, and 5 캜 for 5 minutes to synthesize a first strand cDNA. The termination codon of the target gene was determined by polymerase chain reaction (PCR) using the above reaction mixture as a template.

[ Example  5]

Cloning and sequencing of the lipoxygenase-2 and lipoxygenase-3 coding genes

PCR was performed using the following primers to clone each gene. The PCR conditions were as follows: 98 ° C for 10 seconds, 60 ° C for 5 seconds, 72 ° C for 4 minutes and 30 cycles.

Lipoxygenase-2

Forward primer: 5 'GGTACCAACACAATGTTGACGCGGTTATTTAAG 3'

Reverse primer: 5 'GCGGCCGCATCGAACTGCACAACGAGGG 3'

Lipoxygenase-3

Forward primer: 5 'AAGCTTAACACAATGTCGATTGATTCTGTTCCA 3'

Reverse primer: 5 'GGTACCGGCACAGTACTCCCGTTGCCA 3'

Next, a fragment of the lipoxygenase-2 and lipoxygenase-3 coding gene obtained through the PCR was inserted into a pGEM® Easy Vector (Promega) and transformed into Escherichia coli DH5α. The transformed E. coli was cultured in LB medium (1.0% Bcto-tryptone, 0.5% Bacto-yeast extract, 1.0% NaCl) at 37 ° C. Ampicillin (50 μg / ml), 0.1 mM IPTG, and X-Gal (50 μg / ml) were added to the LB medium to screen E. coli with the inserted vector.

[ Example  6]

Previously discovered pine mushroom Lipoxygenase Lipoxygenase -2 and Lipoxygenase -3 < / RTI >

The amino acid sequence of lipoxygenase-2 (SEQ ID NO: 2) and the amino acid sequence of lipoxygenase-3 (SEQ ID NO: 4) were confirmed through the gene base sequence obtained in Example 5 above. The lipoxygenase amino acid sequence of the pine mushroom and the lipoxygenase - 2 and lipoxygenase - 3 amino acid sequence of pine mushroom were multiple aligned using the Clustal X program. Multiple alignment results are shown in FIG.

While the present invention has been particularly shown and described with reference to preferred embodiments thereof, it is to be understood that the present invention is not limited to the specific embodiments thereof, It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the present disclosure.

<110> KYUNGPOOK NATIONAL UNIVERSITY INDUSTRY-ACADEMIC COOPERATION FOUNDATION <120> The lipoxygenase-2 and lipoxygenase-3 gene isolated from          Tricholoma matsutake <130> OIA10621KR <160> 8 <170> KoPatentin 3.0 <210> 1 <211> 3333 <212> DNA <213> Tricholoma matsutake <400> 1 atgttgacgc ggttatttaa gaaactcttt atttccccac tccttcatat catcctcttc 60 ttttctaccc cactctttag gttcatatct gtaatgaaca tccttaatca ctttacccag 120 gcagtcgact tcgttacaga atcacacgca ccattggaca ccgacgctgc gtgtcctgaa 180 tcagatgaat cattcaagaa agtttcagag acgcttgaat tatggtctca tcccgctgtc 240 aaaatctccg atctccctgc attttgggat gcggtgaagc acgggaatac cattggtctc 300 gatgatcgca agctgttgct ggagaaggtc ctcgtcctga tggcccgata taagaactct 360 gatcgctcca tgcaaattca gcgttatgtg atagatcttc tgtacaaaga cttgcctcat 420 cccccccgca gttatctgtg tccccccaca ggcggctctg cagtggtaac taattcactc 480 ggcaacataa aatacgcgtt tcgtaccgcc gacgggtcca attacaatcc cttattcccc 540 tctcttggca aagctgggtc tccatatgca cgctcagtcc ctggactccg tttcgtacca 600 aaacacgtac ttccagatcc tggtctcgtg ttcgacacgc tacttagacg agaggaattt 660 gttcctcatc ctggtgggat ctccagccta ttcttcgcat tcgcggactt ggtcatccat 720 agtattttca acacaaatca cacggattgg acaaagaacg atactagtag ctatctagat 780 ttaagtatcc tctacggaaa ctctgaaagt caggtgaatc aagtcagacg caaggacggg 840 acgggcaggc tttgggagga cgtattcgct gacagcagac tacttttcat gcctcctgct 900 agttgtgcac tattggtatt gttgagtcga aaccataatt acatcgctca gaagcttttg 960 aacatcaatg agaatggtac attcgttttt cctgttccgc aagacgaaca agcgcggctc 1020 gcccaagatg atgagatctt caatcgcgca cgaatggtta attgcggatt tttcctccag 1080 atcatcttag gagattatgt gggtgcaatt ttgggcctta ttcgtgacag gtccgattgg 1140 cgtctcgacc ctctcatgtc tatgcgagag tcagaccacg aggtttctcc gcaaggcaag 1200 ggaaacgtag tatctgtgga attcaatctt ctttaccggt ggcattctac attatcagcg 1260 caagatgctg aatggacaac aaacacgttc tcgaagctgt ttgagggcag agactcgagc 1320 cagatcaccg tccaagattt caagctggct gctcataagt acctgattcc gcacacggac 1380 gttaggacat gggagttcaa cggtctgaaa cgagaacctg atggacgctt caaagatgat 1440 gacttggcga gaactatcca agacgccact gaacatcgcg ctggagcctt taaagctaga 1500 ggaacacccg aagctcttcg tatcattgag atacttggaa ttgagcaagg cagagcctgg 1560 gggacatgtt cgctcaacga atttagaaaa tttttaggac tcaagcccta taaaacgttc 1620 aaggagtgga accccgacga aaagatacat actgctgcag cagctctata taaagatatc 1680 gagaatcttg aattacatgt cggccttcag gcagaagaaa caaaagtccc gggacctgga 1740 gcaggcttat gcccgggtta cactatctct agggccatct tggcagatgc tgtctctctg 1800 actcgggggg atccattctt taccactgaa tttactccgt tcaatttgac ctcgtggggg 1860 tacgaagact gtcaatacga tactaaggac ggttcctatg gtggaatcct cactaagcta 1920 ctcttccgaa cgttgcctga tcattacccg gctggatctg catatgctca cttccccttc 1980 cttgatccag tgtacatgag ggaaattctc accaaagatg tgaacctcgt caacaaatac 2040 acatggaccc gaccgcaact cccctctgtt accggcgtaa tcaacagttt taatggtgtc 2100 aagcaagtcc tgtccgaccc ttctttcgtg tctgcctaca acgaccgcat attcgacatc 2160 attacaactc ccccaacggc cgacaaggaa gaccataaat tgactatctt gcacaaaact 2220 cgcagcgact tcgttaaagg tcgcaaaaat gtcgagagcc tgcttccata ttcagagcct 2280 cctcatgaaa cttgggcagg atattttacg aaggaagtca aagctctgat tacagagaaa 2340 gcagtccacc atgttggaga taattcaaaa tacgttgaca tagttggaga cgtgatcaat 2400 ctggtgccag ttcgttgggt ttccgagaag attcttggac ttccgctcaa aactatctcc 2460 aacccctccg gtacttttta cgaacaagaa atgtataaga tgttcgcgaa tacggctcga 2520 tatgtcttct tgaacatcga tcccgcccat gattggcatt tacgggagag ctctgttgaa 2580 gcgtttagaa agatcttgaa cgtcacggag gctcatttag gctgggtgac accgacggaa 2640 attctcgacc atatagccat caaaaactat gatagtcacc ggtttttgaa gcgagtccgc 2700 gaggctggaa cagattatac caccaaagag ttggccgcac aagtattttc cgccgtggtt 2760 cctactgccg ccctcttctc acaagtcatt gcgcatgtgg tcgatttcta ccttgacgac 2820 gacaagcgaa atgaacgaga ggagattgtc aagttggttt ccgcgtgtca tgacaaagaa 2880 acggtcgcga aaattatggt ttatgttcaa gaagctctac gccttaatcc aactgtctcg 2940 ggtgtatacc gcacggcggg caaagatgtt tccatcgaac attctagag tcaagctggt 3000 cagagaatct ttgccagcat tgtcaatgcc aatgttgata cttacagatt tggagcaact 3060 cctaccacag caacctacga caagcctgat aatgcggctg gaatctttgg gtttggagag 3120 tatggacttc tctctgctca gtttttcgaa tccaccgctc cgactattct aggaacagtg 3180 cttggactga aaaatctcaa acgtgcccca ggacagtctg gaaaatttgc taggttcacg 3240 gaagaattgc atggtagccc gcagcagtgg tacatcaata tgcaagggaa gactacccct 3300 ttcccggatt ccctcgttgt gcagttcgat taa 3333 <210> 2 <211> 1110 <212> PRT <213> Tricholoma matsutake <400> 2 Met Leu Thr Arg Leu Phe Lys Lys Leu Phe Ile Ser Pro Leu Leu His   1 5 10 15 Ile Ile Leu Phe Phe Ser Thr Pro Leu Phe Arg Phe Ile Ser Val Met              20 25 30 Asn Ile Leu Asn His Phe Thr Gln Ala Val Asp Phe Val Thr Glu Ser          35 40 45 His Ala Pro Leu Asp Thr Asp Ala Ala Cys Pro Glu Ser Asp Glu Ser      50 55 60 Phe Lys Lys Val Ser Glu Thr Leu Glu Leu Trp Ser His Ala Val  65 70 75 80 Lys Ile Ser Asp Leu Pro Ala Phe Trp Asp Ala Val Lys His Gly Asn                  85 90 95 Thr Ile Gly Leu Asp Asp Arg Lys Leu Leu Leu Glu Lys Val Leu Val             100 105 110 Leu Met Ala Arg Tyr Lys Asn Ser Asp Arg Ser Met Gln Ile Gln Arg         115 120 125 Tyr Val Ile Asp Leu Leu Tyr Lys Asp Leu Pro His Pro Pro Arg Ser     130 135 140 Tyr Leu Cys Pro Pro Thr Gly Gly Ser Ala Val Val Thr Asn Ser Leu 145 150 155 160 Gly Asn Ile Lys Tyr Ala Phe Arg Thr Ala Asp Gly Ser Asn Tyr Asn                 165 170 175 Pro Leu Phe Pro Ser Leu Gly Lys Ala Gly Ser Pro Tyr Ala Arg Ser             180 185 190 Val Pro Gly Leu Arg Phe Val Pro Lys His Val Leu Pro Asp Pro Gly         195 200 205 Leu Val Phe Asp Thr Leu Leu Arg Arg Glu Glu Phe Val Pro His Pro     210 215 220 Gly Gly Ile Ser Ser Leu Phe Phe Ala Phe Ala Asp Leu Val Ile His 225 230 235 240 Ser Ile Phe Asn Thr Asn His Thr Asp Trp Thr Lys Asn Asp Thr Ser                 245 250 255 Ser Tyr Leu Asp Leu Ser Ile Leu Tyr Gly Asn Ser Ser Ser Ser Gln Val             260 265 270 Asn Gln Val Arg Arg Lys Asp Gly Thr Gly Arg Leu Trp Glu Asp Val         275 280 285 Phe Ala Asp Ser Arg Leu Leu Phe Met Pro Ala Ser Cys Ala Leu     290 295 300 Leu Val Leu Leu Ser Arg Asn His Asn Tyr Ile Ala Gln Lys Leu Leu 305 310 315 320 Asn Ile Asn Glu Asn Gly Thr Phe Val Phe Pro Val Gln Asp Glu                 325 330 335 Gln Ala Arg Leu Ala Gln Asp Asp Glu Ile Phe Asn Arg Ala Arg Met             340 345 350 Val Asn Cys Gly Phe Phe Leu Gln Ile Ile Leu Gly Asp Tyr Val Gly         355 360 365 Ala Ile Leu Gly Leu Ile Arg Asp Arg Ser Asp Trp Arg Leu Asp Pro     370 375 380 Leu Met Ser Met Arg Glu Ser Asp His Glu Val Ser Pro Gln Gly Lys 385 390 395 400 Gly Asn Val Val Ser Val Glu Phe Asn Leu Leu Tyr Arg Trp His Ser                 405 410 415 Thr Leu Ser Ala Gln Asp Ala Glu Trp Thr Thr Asn Thr Phe Ser Lys             420 425 430 Leu Phe Glu Gly Arg Asp Ser Ser Gln Ile Thr Val Gln Asp Phe Lys         435 440 445 Leu Ala Ala His Lys Tyr Leu Ile Pro His Thr Asp Val Arg Thr Trp     450 455 460 Glu Phe Asn Gly Leu Lys Arg Glu Pro Asp Gly Arg Phe Lys Asp Asp 465 470 475 480 Asp Leu Ala Arg Thr Ile Gln Asp Ala Thr Glu His Arg Ala Gly Ala                 485 490 495 Phe Lys Ala Arg Gly Thr Pro Glu Ala Leu Arg Ile Ile Glu Ile Leu             500 505 510 Gly Ile Glu Gln Gly Arg Ala Trp Gly Thr Cys Ser Leu Asn Glu Phe         515 520 525 Arg Lys Phe Leu Gly Leu Lys Pro Tyr Lys Thr Phe Lys Glu Trp Asn     530 535 540 Pro Asp Glu Lys Ile His Thr Ala Ala Ala Ala Leu Tyr Lys Asp Ile 545 550 555 560 Glu Asn Leu Glu Leu His Val Gly Leu Gln Ala Glu Glu Thr Lys Val                 565 570 575 Pro Gly Pro Gly Ala Gly Leu Cys Pro Gly Tyr Thr Ile Ser Arg Ala             580 585 590 Ile Leu Ala Asp Ala Val Ser Leu Thr Arg Gly Asp Pro Phe Phe Thr         595 600 605 Thr Glu Phe Thr Pro Phe Asn Leu Thr Ser Trp Gly Tyr Glu Asp Cys     610 615 620 Gln Tyr Asp Thr Lys Asp Gly Ser Tyr Gly Gly Ile Leu Thr Lys Leu 625 630 635 640 Leu Phe Arg Thr Leu Pro Asp His Tyr Pro Ala Gly Ser Ala Tyr Ala                 645 650 655 His Phe Pro Phe Leu Asp Pro Val Tyr Met Arg Glu Ile Leu Thr Lys             660 665 670 Asp Val Asn Leu Val Asn Lys Tyr Thr Trp Thr Arg Pro Gln Leu Pro         675 680 685 Ser Val Thr Gly Val Ile Asn Ser Phe Asn Gly Val Lys Gln Val Leu     690 695 700 Ser Asp Pro Ser Phe Val Ser Ala Tyr Asn Asp Arg Ile Phe Asp Ile 705 710 715 720 Ile Thr Pro Pro Thr Ala Asp Lys Glu Asp His Lys Leu Thr Ile                 725 730 735 Leu His Lys Thr Arg Ser Asp Phe Val Lys Gly Arg Lys Asn Val Glu             740 745 750 Ser Leu Leu Pro Tyr Ser Glu Pro Pro His Glu Thr Trp Ala Gly Tyr         755 760 765 Phe Thr Lys Glu Val Lys Ala Leu Ile Thr Glu Lys Ala Val His His     770 775 780 Val Gly Asp Asn Ser Lys Tyr Val Asp Ile Val Gly Asp Val Ile Asn 785 790 795 800 Leu Val Pro Val Arg Trp Val Ser Glu Lys Ile Leu Gly Leu Pro Leu                 805 810 815 Lys Thr Ile Ser Asn Pro Ser Gly Thr Phe Tyr Glu Gln Glu Met Tyr             820 825 830 Lys Met Phe Ala Asn Thr Ala Arg Tyr Val Phe Leu Asn Ile Asp Pro         835 840 845 Ala His Asp Trp His Leu Arg Glu Ser Ser Val Glu Ala Phe Arg Lys     850 855 860 Ile Leu Asn Val Thr Glu Ala His Leu Gly Trp Val Thr Pro Thr Glu 865 870 875 880 Ile Leu Asp His Ile Ala Ile Lys Asn Tyr Asp Ser His His Phe Leu                 885 890 895 Lys Arg Val Val Glu Ala Gly Thr Asp Tyr Thr Thr Lys Glu Leu Ala             900 905 910 Ala Gln Val Phe Ser Ala Val Val Pro Thr Ala Ala Leu Phe Ser Gln         915 920 925 Val Ile Ala His Val Val Asp Phe Tyr Leu Asp Asp Asp Lys Arg Asn     930 935 940 Glu Arg Glu Glu Ile Val Lys Leu Val Ser Ala Cys His Asp Lys Glu 945 950 955 960 Thr Val Ala Lys Ile Met Val Tyr Val Glu Glu Ala Leu Arg Leu Asn                 965 970 975 Pro Thr Val Ser Gly Val Tyr Arg Thr Ala Gly Lys Asp Val Ser Ile             980 985 990 Glu His Ser Arg Val Gln Ala Gly Gln Arg Ile Phe Ala Ser Ile Val         995 1000 1005 Asn Ala Asn Val Asp Thr Tyr Arg Phe Gly Ala Thr Pro Thr Thr Ala    1010 1015 1020 Thr Tyr Asp Lys Pro Asp Asn Ala Gly Ile Phe Gly Phe Gly Glu 1025 1030 1035 1040 Tyr Gly Leu Leu Ser Ala Gln Phe Phe Glu Ser Thr Ala Pro Thr Ile                1045 1050 1055 Leu Gly Thr Val Leu Gly Leu Lys Asn Leu Lys Arg Ala Pro Gly Gln            1060 1065 1070 Ser Gly Lys Phe Ala Arg Phe Thr Glu Glu Leu His Gly Ser Pro Gln        1075 1080 1085 Gln Trp Tyr Ile Asn Met Gln Gly Lys Thr Thr Pro Phe Pro Asp Ser    1090 1095 1100 Leu Val Val Gln Phe Asp 1105 1110 <210> 3 <211> 3855 <212> DNA <213> Tricholoma matsutake <400> 3 atgtcgattg attctgttcc agatattgcc tatgacggtg aagcgaaggt ggaaactgat 60 cctgatgttg ctgttcttac gacttccccg gcgtctcagt ctctatactc tcccgcaata 120 ctggcattcg ttcccaacca tgataaatct ttgctgcaac gattgtggtt gaatggagat 180 ggcatcaaat caacgtcaac tagagctctt gattacaaag tggccaaaaa ggttgctatg 240 accttgttgc acaatgacaa gcaacgttct ccattagtcg atcttcataa ccctgctgct 300 caattatcgt ccacacagta tcccttcaca cgaaaggtcg aaacaccact cgcctccacg 360 caaacaccag accctcaact tgtattccag cgtttgatgc aggagaacca tgtcgtcgag 420 catccgaatg gaatttcggg tctagctttt gttctcgcta ctgttatttc gctttctctc 480 atccgtatca acgaaaagaa accagaatgc aacgaaacgt ctccttatct tgatctatct 540 cccctctatg gtgtgaatga tgcagagacg gatatggttc gtgctaagga cgggcgcgga 600 atgctctctc cggattgttt ctacgaggac cgtgtcatgt tactcccacc cgcagtgtcc 660 gcatttttga ttctttggaa cagaaatcac aatttcatcg cacgacttct tttgctgaat 720 aacgaaggaa acaaatgggt caaaccctct gacgatgcct tctcacctga tggtaacctc 780 gccgcgaacc tccaagcaca agacgacgag atcttcacca ttgcacgtct gataaactgt 840 gttcagttca agaacgttgt tgcagtggac ttcctaaaag tattgatggg gcttccacac 900 gacggaaaga gcgcagattt ggacatctca attgatcatg aacaattgga gaggggtaga 960 ggtcatgact ctagcatgga atctgctctt ctttataact ggacgtcaat gatagctaca 1020 gaagatgtca ggaaaatcga agaaacggtt gacgacgaat ttcacactac actcgatcag 1080 ctgtctgctg acgacgtgca gaacatgatg atgaatggta caaggaatcc ggatagacga 1140 taccgagaca gcgcaggcct caaacgcggg agagatggtc gcttccagga taatgatctt 1200 gctcgtgtcc tgcaagatgc gacaggatat catgcaggcg cgcccggcgc tcgtcgcatc 1260 ccctcatgct tccgcacctc tgaaatcatg attattgaac gagcgagacg gtggggcgta 1320 tgctctttca acgacttcag gaaattttta ggtctcaaag ttctaaagag cttccaagag 1380 tggaactcga accctgatgt tttcagggca gccgaggagc tctatggaag cattgacaac 1440 ttggaacttt atcctggcct ccaagctgag gacacatctg ggtccggtct tgggtttggt 1500 tgcacgatga cgtacggcct ctttgccgat attgtggcta taatgcgcag tgaccaccgt 1560 tttacgaccg aatttaccgc tggtaaatta actcaatggg gttacaatga ctgtactcgc 1620 cgtttgaata atggtgcctt cacctccacg ttgcctagat tattgcagcg aaattttcct 1680 cggaactatc catacgacaa cacctacagt ctgttcccct tgacctgtcc tgccacgacg 1740 aagacagcct tagccgattc gcgcaatcaa tacgatttcg agaggcccga agttcacaat 1800 gtcaaagtca tagagacgaa gagagcaata agttatgtct tcaacaaacc ctctgtatac 1860 caaacaatct atggcaagaa tctcgagaaa ttgacggacg gttatggcta tttcctgggt 1920 ttcgataacg aattgcttca tgatcgagat caaatgatga cactgtttgc actaattccg 1980 gacaaagggt ctttgtctcg acacgcatcc tatttcagta ctactgcggc tgcccttata 2040 agagacaaat cgatccaaaa caatgggcac aggtccgttg atatcgtacg agatgttatc 2100 aacacgacat gcactcgttg ggtatgcgag acactctgtg gacgctctct gtcagacggt 2160 gaggcgacaa aaaagcatga agaattcgca gctatttatg catatatttt tcgaactatc 2220 gatcccgaga ctgggtgggc ggtccgtgaa gctgccatgg atgccagttc aagactcgga 2280 aaagatatcg aacgtcatct gcccatcccc tccgacatcg gaggcacaaa ctggatcaac 2340 gatttcagaa gctgtctcat agatctatat tcatggttca ctcgaatctg tcaagagatg 2400 ggacccggga aggaattaac acaccgcgtg gccttgacct ttcttgacag gatggtcaag 2460 tcgaacagac agttccgcct tggcgagctc accaaccacg gccatctccg agacatcatt 2520 gatgattcca atgtccagag ccgagaagaa gcacttgaga agcgtcggat agtggcgaac 2580 gtttgggat tggctgtcgt tacggctgtc aactacgcac aaacatgtac acatgctgtt 2640 gatttttatc tcggcgatga acacgaagaa gaaaggaaag aaattgtacg actatcaatg 2700 ttgtcgccaa gagattcgcg gagccaaggc gcgaacaaga agatcatggg ttatattcgg 2760 gaagcacaaa gacttagcca gccattagga ctttggcgtg acgtcgtcga gaaggacttc 2820 atcccacaag gaaacggtgt agaagtccgc aaaggggatc gtatctttgc tgacttcaat 2880 aaggctcata aaaatgccat ggacttctgt catcctaaca agatagaccc agatcggaaa 2940 actccttcca tacagggtat gggacttcac aaatgtcctg gtataggctt tgtagacgag 3000 actatgccag agctctttaa atctatcttt cgcttgaaga atcttcgacg tgacagtggc 3060 aaggccggcc gcttggagat gtttgtttgc caccctgcgc ctgcccagtc agatccaaag 3120 gtatatttag atcccactgg cgagatctct catttccctc gatctctttc tttgttgtat 3180 gacgatgatg gctctgcgga ggggtccccc tcaaagctga aaaagcggaa atggagagtc 3240 cttcctggga agaagactga gaaattacgg cgtaacatgg atcaagccat tgcgagcttg 3300 gtagtggcga tctccctgct attcatcctg ctccaaatgt ttcatgttta ttcccaccat 3360 atgccctcat tccgatttcc tttctcttcg acacctaaac gccgagaccc accgccatcg 3420 atgggtgata tcaaagtaga tgtcgtagaa tgtccgacgc caacggaagt cttccaacca 3480 tatgagatcc atacgatgct cccaggttcc gacgggcatc cgattccact tgaatacacc 3540 atagaccacc ctaagccgca caagctgagt gtggtagaca tcgatgagcg ggacatgcag 3600 atggctgttt atgtagatga tgacctgaga ggactcacgc gggatttcga actgaaccaa 3660 acgatgaact gcggggagga tgtggcaaca tgtttgacga gtggattcag cgctggtgtt 3720 gttgtcgtac gacctggtaa acatacggtt aggatccagt gggtggggaa agactatata 3780 cctggtactc acgacatcga ctggggtaag gagcgaagcc ggcgtctgaa gtggcaacgg 3840 gagtactgtg cctga 3855 <210> 4 <211> 1284 <212> PRT <213> Tricholoma matsutake <400> 4 Met Ser Ile Asp Ser Val Pro Asp Ile Ala Tyr Asp Gly Glu Ala Lys   1 5 10 15 Val Glu Thr Asp Pro Asp Val Ala Val Leu Thr Thr Ser Pro Ala Ser              20 25 30 Gln Ser Leu Tyr Ser Pro Ala Ile Leu Ala Phe Val Pro Asn His Asp          35 40 45 Lys Ser Leu Leu Gln Arg Leu Trp Leu Asn Gly Asp Gly Ile Lys Ser      50 55 60 Thr Ser Thr Arg Ala Leu Asp Tyr Lys Val Ala Lys Lys Val Ala Met  65 70 75 80 Thr Leu Leu His Asn Asp Lys Gln Arg Ser Ser Leu Val Asp Leu His                  85 90 95 Asn Pro Ala Ala Gln Leu Ser Ser Thr Gln Tyr Pro Phe Thr Arg Lys             100 105 110 Val Glu Thr Pro Leu Ala Ser Thr Gln Thr Pro Asp Pro Gln Leu Val         115 120 125 Phe Gln Arg Leu Met Gln Glu Asn His Val Val Glu His Pro Asn Gly     130 135 140 Ile Ser Gly Leu Ala Phe Val Leu Ala Thr Val Ile Ser Leu Ser Leu 145 150 155 160 Ile Arg Ile Asn Glu Lys Lys Pro Glu Cys Asn Glu Thr Ser Pro Tyr                 165 170 175 Leu Asp Leu Ser Pro Leu Tyr Gly Val Asn Asp Ala Glu Thr Asp Met             180 185 190 Val Arg Ala Lys Asp Gly Arg Gly Met Leu Ser Pro Asp Cys Phe Tyr         195 200 205 Glu Asp Arg Val Met Leu Leu Pro Pro Ala Val Ser Ala Phe Leu Ile     210 215 220 Leu Trp Asn Arg Asn His Asn Phe Ile Ala Arg Leu Leu Leu Leu Asn 225 230 235 240 Asn Glu Gly Asn Lys Trp Val Lys Pro Ser Asp Asp Ala Phe Ser Pro                 245 250 255 Asp Gly Asn Leu Ala Ala Asn Leu Gln Ala Gln Asp Asp Glu Ile Phe             260 265 270 Thr Ile Ala Arg Leu Ile Asn Cys Val Gln Phe Lys Asn Val Val Ala         275 280 285 Val Asp Phe Leu Lys Val Leu Met Gly Leu Pro His Asp Gly Lys Ser     290 295 300 Ala Asp Leu Asp Ile Ser Ile Asp His Glu Gln Leu Glu Arg Gly Arg 305 310 315 320 Gly His Asp Ser Ser Met Glu Ser Ala Leu Leu Tyr Asn Trp Thr Ser                 325 330 335 Met Ile Ala Thr Glu Asp Val Arg Lys Ile Glu Glu Thr Val Asp Asp             340 345 350 Glu Phe His Thr Thr Leu Asp Gln Leu Ser Ala Asp Asp Val Gln Asn         355 360 365 Met Met Met Asn Gly Thr Arg Asn Pro Asp Arg Arg Tyr Arg Asp Ser     370 375 380 Ala Gly Leu Lys Arg Gly Arg Asp Gly Arg Phe Gln Asp Asn Asp Leu 385 390 395 400 Ala Arg Val Leu Gln Asp Ala Thr Gly Tyr His Ala Gly Ala Pro Gly                 405 410 415 Ala Arg Arg Ile Pro Ser Cys Phe Arg Thr Ser Glu Ile Met Ile Ile             420 425 430 Glu Arg Ala Arg Arg Trp Gly Val Cys Ser Phe Asn Asp Phe Arg Lys         435 440 445 Phe Leu Gly Leu Lys Val Leu Lys Ser Phe Gln Glu Trp Asn Ser Asn     450 455 460 Pro Asp Val Phe Arg Ala Ala Glu Glu Leu Tyr Gly Ser Ile Asp Asn 465 470 475 480 Leu Glu Leu Tyr Pro Gly Leu Gln Ala Glu Asp Thr Ser Gly Ser Gly                 485 490 495 Leu Gly Phe Gly Cys Thr Met Thr Tyr Gly Leu Phe Ala Asp Ile Val             500 505 510 Ala Ile Met Arg Ser Asp His Arg Phe Thr Thr Glu Phe Thr Ala Gly         515 520 525 Lys Leu Thr Gln Trp Gly Tyr Asn Asp Cys Thr Arg Arg Leu Asn Asn     530 535 540 Gly Ala Phe Thr Ser Thr Leu Pro Arg Leu Leu Gln Arg Asn Phe Pro 545 550 555 560 Arg Asn Tyr Pro Tyr Asp Asn Thr Tyr Ser Leu Phe Pro Leu Thr Cys                 565 570 575 Pro Ala Thr Thr Lys Thr Ala Leu Ala Asp Ser Arg Asn Gln Tyr Asp             580 585 590 Phe Glu Arg Pro Glu Val His Asn Val Lys Val Ile Glu Thr Lys Arg         595 600 605 Ala Ile Ser Tyr Val Phe Asn Lys Pro Ser Val Tyr Gln Thr Ile Tyr     610 615 620 Gly Lys Asn Leu Glu Lys Leu Thr Asp Gly Tyr Gly Tyr Phe Leu Gly 625 630 635 640 Phe Asp Asn Glu Leu Leu His Asp Arg Asp Gln Met Met Thr Leu Phe                 645 650 655 Ala Leu Ile Pro Asp Lys Gly Ser Leu Ser Arg His Ala Ser Tyr Phe             660 665 670 Ser Thr Thr Ala Ala Leu Ile Arg Asp Lys Ser Ile Gln Asn Asn         675 680 685 Gly His Arg Ser Val Asp Ile Val Arg Asp Val Ile Asn Thr Thr Cys     690 695 700 Thr Arg Trp Val Cys Glu Thr Leu Cys Gly Arg Ser Leu Ser Asp Gly 705 710 715 720 Glu Ala Thr Lys Lys His Glu Glu Phe Ala Ala Ile Tyr Ala Tyr Ile                 725 730 735 Phe Arg Thr Ile Asp Pro Glu Thr Gly Trp Ala Val Arg Glu Ala Ala             740 745 750 Met Asp Ala Ser Ser Leu Gly Lys Asp Ile Glu Arg His Leu Pro         755 760 765 Ile Pro Ser Asp Ile Gly Gly Thr Asn Trp Ile Asn Asp Phe Arg Ser     770 775 780 Cys Leu Ile Asp Leu Tyr Ser Trp Phe Thr Arg Ile Cys Gln Glu Met 785 790 795 800 Gly Pro Gly Lys Glu Leu Thr His Arg Val Ala Leu Thr Phe Leu Asp                 805 810 815 Arg Met Val Lys Ser Asn Arg Gln Phe Arg Leu Gly Glu Leu Thr Asn             820 825 830 His Gly His Leu Arg Asp Ile Ile Asp Asp Ser Asn Val Gln Ser Arg         835 840 845 Glu Glu Ala Leu Glu Lys Arg Arg Ile Val Ala Asn Val Leu Gly Leu     850 855 860 Ala Val Val Thr Ala Val Asn Tyr Ala Gln Thr Cys Thr His Ala Val 865 870 875 880 Asp Phe Tyr Leu Gly Asp Glu His Glu Glu Glu Arg Lys Glu Ile Val                 885 890 895 Arg Leu Ser Met Leu Ser Pro Arg Asp Ser Arg Ser Gln Gly Ala Asn             900 905 910 Lys Lys Ile Met Gly Tyr Ile Arg Glu Ala Gln Arg Leu Ser Gln Pro         915 920 925 Leu Gly Leu Trp Arg Asp Val Val Glu Lys Asp Phe Ile Pro Gln Gly     930 935 940 Asn Gly Val Glu Val Arg Lys Gly Asp Arg Ile Phe Ala Asp Phe Asn 945 950 955 960 Lys Ala His Lys Asn Ala Met Asp Phe Cys His Pro Asn Lys Ile Asp                 965 970 975 Pro Asp Arg Lys Thr Pro Ser Ile Gln Gly Met Gly Leu His Lys Cys             980 985 990 Pro Gly Ile Gly Phe Val Asp Glu Thr Met Pro Glu Leu Phe Lys Ser         995 1000 1005 Ile Phe Arg Leu Lys Asn Leu Arg Arg Asp Ser Gly Lys Ala Gly Arg    1010 1015 1020 Leu Glu Met Phe Val Cys His Pro Ala Pro Ala Gln Ser Asp Pro Lys 1025 1030 1035 1040 Val Tyr Leu Asp Pro Thr Gly Glu Ile Ser His Phe Pro Arg Ser Leu                1045 1050 1055 Ser Leu Leu Tyr Asp Asp Asp Gly Ser Ala Glu Gly Ser Ser Ser            1060 1065 1070 Leu Lys Lys Arg Lys Trp Arg Val Leu Pro Gly Lys Lys Thr Glu Lys        1075 1080 1085 Leu Arg Arg Asn Met Asp Gln Ala Ile Ala Ser Leu Val Val Ala Ile    1090 1095 1100 Ser Leu Leu Phe Ile Leu Leu Gln Met Phe His Val Tyr Ser His His 1105 1110 1115 1120 Met Pro Ser Phe Arg Phe Pro Phe Ser Ser Thr Pro Lys Arg Arg Asp                1125 1130 1135 Pro Pro Pro Ser Met Gly Asp Ile Lys Val Asp Val Val Glu Cys Pro            1140 1145 1150 Thr Pro Thr Glu Val Phe Gln Pro Tyr Glu Ile His Thr Met Leu Pro        1155 1160 1165 Gly Ser Asp Gly His Pro Ile Pro Leu Glu Tyr Thr Ile Asp His Pro    1170 1175 1180 Lys Pro His Lys Leu Ser Val Val Asp Ile Asp Glu Arg Asp Met Gln 1185 1190 1195 1200 Met Ala Val Tyr Val Asp Asp Asp Leu Arg Gly Leu Thr Arg Asp Phe                1205 1210 1215 Glu Leu Asn Gln Thr Met Asn Cys Gly Glu Asp Val Ala Thr Cys Leu            1220 1225 1230 Thr Ser Gly Phe Ser Ala Gly Val Val Val Val Arg Pro Gly Lys His        1235 1240 1245 Thr Val Arg Ile Gln Trp Val Gly Lys Asp Tyr Ile Pro Gly Thr His    1250 1255 1260 Asp Ile Asp Trp Gly Lys Glu Arg Ser Ser Arg Arg Leu Lys Trp Gln Arg 1265 1270 1275 1280 Glu Tyr Cys Ala                 <210> 5 <211> 33 <212> DNA <213> Tricholoma matsutake <400> 5 ggtaccaaca caatgttgac gcggttattt aag 33 <210> 6 <211> 28 <212> DNA <213> Tricholoma matsutake <400> 6 gcggccgcat cgaactgcac aacgaggg 28 <210> 7 <211> 33 <212> DNA <213> Tricholoma matsutake <400> 7 aagcttaaca caatgtcgat tgattctgtt cca 33 <210> 8 <211> 27 <212> DNA <213> Tricholoma matsutake <400> 8 ggtaccggca cagtactccc gttgcca 27

Claims (10)

And a gene sequence of SEQ ID NO: 1 detected by a primer set consisting of the nucleotide sequence of SEQ ID NO: 5 and SEQ ID NO: 6. The method of claim 1, wherein
The above-mentioned lipoxygenase-2-encoding gene was introduced into Tricholoma matsutake ). &lt; / RTI &gt; delete delete delete 3 and a gene sequence of SEQ ID NO: 3 detected by a primer set consisting of the nucleotide sequence of SEQ ID NO: 7 and SEQ ID NO: 8. The method of claim 6, wherein
Wherein the Lipoxygenase -3 coding gene is derived from Tricholoma matsutake.

delete delete delete

Images