KR101886898B1 - Ligands that bind tgf-beta receptor ii - Google Patents

Abstract

This disclosure provides an anti-TGF beta RII immunoglobulin single variable domain. Suitably, the anti-TGF beta RII immunoglobulin single variable domain according to the present disclosure is selected from the group consisting of SEQ ID NOS: 1-38, 204, 206, 208, 214, 234, 236, 238, 240, 263, 265, 267, 269, Deletion or addition having an amino acid sequence as shown in any one of SEQ ID NOs: 271, 273, 275, 277, 279, 281, 283, 285, 287, 289 or 291 and no more than 5 amino acid substitutions. The present disclosure relates to diseases associated with TGF beta signaling and, preferably, pulmonary fibrosis including tissue fibrosis such as idiopathic pulmonary fibrosis; Liver fibrosis including liver cirrhosis and chronic hepatitis; Rheumatoid arthritis; Ocular disorders; Fibrosis of the skin including keloid of the skin; Dufuq Trang construction; Renal fibrosis, such as nephritis and neuropathy; Wound healing; Scar formation; And a polypeptide and pharmaceutical composition for the treatment of diseases selected from the group of angiopathies, such as restenosis.

Description

LIGANDS THAT BIND TGF-BETA RECEPTOR II < RTI ID = 0.0 >

Transforming growth factor-beta (TGF beta) is a signaling molecule that mediates signaling into the cell via binding to the TGF beta receptor (TGF beta R; TGF beta R (TGF-beta R)). TGF beta signaling activity modulates cell differentiation and growth, the nature of its effect, i. E., As an inducer of cell growth-promoter, growth-suppressor or other cellular function, depending on the cell type See, for example, Roberts, et al., The transforming growth factor-betas, Peptide Growth Factors and Their Receptors, Part I, ed. By Sporn, MB & Roberts, AB, Springer-Verlag, Berlin, 1990, p.419-472 ).

TGF beta is produced by a wide variety of cell types and its cognate receptors are expressed in a wide variety of organs and cells (Shi and Massague, Cell, Volume 113, Issue 6, 13 June 2003, Pages 685-700 Dekker, et al., P. 272, 1996) and [Pulmonary Fibrosis, Vol. 80 of Lung Biology in Health and Disease Series, ed. New York, 1995). TGF beta receptors have been identified to be divided into three classes: TGF beta RI (TGF beta type I receptor (Franzen et al., Cell, Vol. 75, No. 4, (GenBank accession no. L11695); TGF beta RII (TGF beta RII) (TGF beta type II receptor (Herbert et al., Cell, Vol. 68, No. 4, p. Bank Accession No. M85079) and TGF beta RIII (TGF beta type III receptor (Lopez-Casillas, Cell, Vol. 67, No. 4, p 785, 1991; RI and TGF beta RII were shown to be essential for TGF-beta signaling (Laiho et al., J. Biol. Chem., Vol. 265, p. 18518, 1990 and Laiho et al., J Biol. Chem., Vol. 266, p. 9108, 1991), TGF beta RIII is not considered essential.

TGF beta signaling is mediated through its binding to both TGF beta RI and RII. When the ligand binds to the extracellular ligand binding domain, the two receptors associate together, allowing RII to phosphorylate RI and initiate signal transduction cascades through phosphorylation of the Smad protein (see Shi and Massague, supra) .

Three isoforms of TGF beta, TGF beta 1, TGF beta 2, and TGF beta 3, have been identified in mammals. Each isoform is multifunctional and functions in a self-regulating feedback mechanism that controls bioavailability and maintains tissue homeostasis during development (see, for example, Ten Dijke and Arthur, Nature Reviews, Molecular Cell Biology, Vol. 2007, p. 857-869). The level of TFG beta is regulated by modulation through TGF beta expression and through binding to proteoglycans, the extracellular matrix (ECM).

Dysregulated TGF beta signaling, such as excessive TGF beta signaling and high levels of bioavailable TGF beta, may be useful in the treatment of various tissue fibrosis such as pulmonary fibrosis and cirrhosis, chronic hepatitis, rheumatoid arthritis, , Keloid of the skin, and the onset of neuropathic pain.

Thus, there is a need to provide compounds that block or disrupt TGF beta signaling in a specific manner, e.g., via binding to TGF beta receptor II. Such compounds may be used in therapeutic agents.

summary

This disclosure is directed to the anti-TGF beta RII immunoglobulin single variable domain. Suitably, the anti-TGF beta RII immunoglobulin single variable domain according to the present disclosure has an equilibrium dissociation constant (KD) between 10 pM and 50 nM, optionally between 10 pM and 10 nM, optionally between 100 pM and 10 nM, RII. ≪ / RTI > In one embodiment, the anti-TGF beta RII immunoglobulin single variable domain binds to TGF beta RII with high affinity (high potency) and has an equilibrium dissociation constant between 10 pM and 500 pM. In one embodiment, the anti-TGF beta RII immunoglobulin single variable domain binds to TGF beta RII with an affinity (KD) of approximately 100 pM. In one embodiment, the anti-TGF beta RII immunoglobulin single variable domain binds to TGF beta RII with an affinity (KD) of less than 100 pM. In another embodiment, the anti-TGF beta RII immunoglobulin single variable domain binds to TGF beta RII with moderate affinity (low potency) and has an equilibrium dissociation constant of 500 pM to 50 nM, preferably 500 pM to 10 nM . In another aspect, the disclosure provides an isolated polypeptide comprising an anti-TGF beta RII immunoglobulin single variable domain. Suitably, the isolated polypeptide binds to human TGF beta RII. In another embodiment, the isolated polypeptide also binds to TGF beta RII derived from a different species, such as a mouse, dog or monkey, such as a cynomolgus monkey (cyno). Suitably, the isolated polypeptide binds to both the mouse and human TGF beta RII. Such cross-reactivity between TGF beta RII from humans and other species allows the same antibody construct to be used in animal disease models, and in humans.

In one aspect of the disclosure, a nucleic acid molecule comprising a sequence selected from the group consisting of SEQ ID NOS: 1-38, 204, 206, 208, 214, 234, 236, 238, 240, 263, 265, 267, 269, 271, 273, 275, 277, 279, 281, 283 , 285 and 287, wherein an amino acid substitution, deletion or addition of an amino acid sequence as set forth in any one of < RTI ID = 0.0 > I. E., Any combination of up to five amino acid substitutions, deletions or additions. In certain embodiments, the amino acid substitution is a conservative substitution.

In one embodiment, the anti-TGF beta RII immunoglobulin single variable domain has the amino acid sequence set forth in SEQ ID NO: 234 or 279 and has no more than 5 amino acid alterations, wherein each amino acid alteration is amino acid substitution, deletion or addition. In certain embodiments, the amino acid alteration (s) are not in the CDR3, more specifically in the CDR3 and CDR1, or in the CDR3 and CDR2, and more particularly in any CDR. In one embodiment, the anti-TGF beta RII immunoglobulin single variable domain comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-38, 204, 206, 208, 214, 234, 236, 238, 240, 263, 265, 267, 269, 271, 273, 275, 277, 279, 281, 283, 285, and 287, respectively. In one embodiment, the anti-TGF beta RII immunoglobulin single variable domain consists of the amino acid sequence of SEQ ID NO: 234 or 236.

It is not intended that any specific anti-TGF beta RII immunoglobulin single variable domain sequence disclosed in WO 2011012609 be included. To eliminate any doubt, each and every sequence disclosed in WO 2011012609 may be waived from the present invention. In particular, DOM23h-271 (SEQ ID NO: 4) and DOM-23h-439 (SEQ ID NO: 10) disclosed in WO 2011012609 can be waived. The anti-TGF beta RII immunoglobulin single variable domain comprising the amino acid sequence set forth in SEQ ID NO: 199 or 201 herein may be disclaimed.

An anti-TGF beta RII immunoglobulin single variable domain according to the present invention may comprise one or more (for example 1, 2, 3, 4, or 5) C-terminal alanine residues. Alternatively, the anti-TGF beta RII immunoglobulin single variable domain may comprise a C-terminal peptide that is less than 5 amino acids in length. In one embodiment, the C-terminal peptide comprises 1, 2, 3, 4, or 5 amino acids.

Those skilled in the art will appreciate that the presented single variable domain sequences, e. G., SEQ ID NOS: 1-38, 204, 206, 208, 214, 234, 236, 238, 240, 263, 265, 267, 269, 271, 273, 275, 277, 279, (1987), [Chothia (1989)], AbM or a contact method, or a combination of these methods, as having a sequence presented in any one of SEQ ID NOS: 281, 283, 285 and 287 , It is possible to estimate using the various methods outlined in the present application whether the defined CDR sequence is included therein. Suitably, the CDR sequences are determined using the Kabat method described herein. In one embodiment, the CDR sequences of each sequence are those set forth in Tables 1, 2, 9, and 13.

In one aspect of the invention, the anti-TGF beta RII immunoglobulin single variable domain of the present disclosure has 90% or greater than 90% sequence identity to the amino acid sequence selected from the group consisting of SEQ ID NOS: 1-28.

In one aspect of the invention, the anti-TGF beta RII immunoglobulin single variable domain of the present disclosure has an amino acid sequence selected from the group consisting of SEQ ID NOS: 1-28, with a change of less than 25 amino acids. In certain embodiments, the anti-TGF beta RII immunoglobulin single variable domain of the present disclosure has 20 or fewer, 15 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, And has an amino acid sequence selected from the group consisting of SEQ ID NOS: 1-28, having an amino acid change of 5 or less.

In one aspect of the disclosure, the anti-TGF beta RII immunoglobulin single variable domains of the present disclosure, particularly those of SEQ ID NOS: 1-38, 204, 206, 208, 214, 234, 236, 238, 240, 263, 265, TGF beta RII immunoglobulin single variable domain in the amino acid sequence selected from the group consisting of SEQ ID NOS: 267, 269, 271, 273, 275, 277, 279, 281, 283, Lt; / RTI > polypeptide is provided.

In one aspect of the disclosure there is provided an isolated polypeptide encoded by at least 80% identical nucleotide sequence and binding to TGF beta RII in at least one nucleic acid sequence selected from the group of SEQ ID NOS: 39-66.

An anti-TGF beta RII immunoglobulin single variable domain or polypeptide according to any aspect of the present disclosure may comprise an immunoglobulin single variable domain R at position 39, I at position 48, D at position 53, N, An amino acid of any one of R in position 61, K in position 61, R in position 64, F in position 64, D in position 64, E in position 64, Y in position 64, H in position 102, And the location is in accordance with the Kabat numbering convention. In one embodiment, the immunoglobulin single variable domain or polypeptide comprises a combination of these amino acids. In another embodiment, the immunoglobulin single variable domain or polypeptide comprises an amino acid N at 61 and an R at 64. In another embodiment, the immunoglobulin single variable domain or polypeptide comprises the amino acid R or K at position 61. In one embodiment, the anti-TGF beta RII immunoglobulin single variable domain comprises I at position 48 in addition to any one of the above-mentioned residues at positions 61 and / or 64. In this embodiment, the amino acid numbering may be, for example, from amino acids 1-38, 204, 206, 208, 214, 234, 236, 238, 240, 263, 265, 267, 269, 271, 273, 275, 277, 279, 281, 283, 285, and 287, respectively, of the immunoglobulin single variable domain.

An anti-TGF beta RII immunoglobulin single variable domain or polypeptide according to any of the aspects of the present disclosure may comprise one of the amino acid combinations selected from the following group: N and O of position 61 of the immunoglobulin single variable domain Position 64 of R; R at position 61 and E at position 64; R in position 61 and M in position 64; R at position 61 and F at position 64; R at position 61 and Y at position 64; And D. In one embodiment of position 61, R and position 64, the anti-TGF beta RII immunoglobulin single variable domain is in addition to any one of the above-mentioned combinations of residues at positions 61 and 64 at positions 48 and I .

In yet another aspect, a ligand that inhibits binding of an anti-TGF beta RII immunoglobulin single variable domain to TGF beta RII, comprising an amino acid sequence selected from the group of SEQ ID NOS: 1-28, with binding specificity for TGF beta RII Or bonding moieties are provided.

In a further aspect of the disclosure there is provided a fusion protein comprising an immunoglobulin single variable domain, polypeptide or ligand according to any of the aspects of the present disclosure.

In one embodiment, an immunoglobulin single variable domain, polypeptide, ligand or fusion protein according to the present disclosure is to neutralize TGF beta activity. Suitably, the immunoglobulin single variable domain or polypeptide according to the present disclosure inhibits the binding of TGF beta to TGF beta RII. In another embodiment, an immunoglobulin single variable domain or polypeptide according to the disclosure inhibits TGF beta signaling activity via TGF beta RII. In another embodiment, the immunoglobulin single variable domain or polypeptide according to this disclosure inhibits TGF beta activity, particularly TGF beta cell growth activity and / or fibrogenic activity. Suitably, the TGF beta RII is human TGF beta RII.

In one embodiment, the immunoglobulin single variable domain, polypeptide, ligand or fusion protein according to the present disclosure does not have TGF beta RII agonist activity at 15 micromolar ([mu] M).

In yet another aspect, an immunoglobulin single variable domain, polypeptide, ligand or fusion protein is provided according to any aspect of the present disclosure, further comprising a half-life extension moiety. Suitably, the half-life extension moiety is an antibody or antibody fragment comprising a polyethylene glycol moiety, serum albumin or fragment thereof, a transferrin receptor or a transferrin-binding moiety thereof, or a binding site for a polypeptide that enhances half-life in vivo . In one embodiment, the half-life extension moiety is an antibody or antibody fragment comprising a binding site for a serum albumin or neonatal Fc receptor. In another embodiment, the half-life extending moiety is a dAb, an antibody, or an antibody fragment.

In another aspect, the present disclosure provides isolated or recombinant nucleic acid encoding a polypeptide comprising an anti-TGF beta RII immunoglobulin single variable domain, polypeptide, ligand or fusion protein according to any aspect of the disclosure. to provide.

In one embodiment, the isolated nucleic acid molecule or recombinant nucleic acid molecule is a nucleic acid molecule comprising a nucleotide sequence of SEQ ID NO: 39-76, 203, 205, 207, 212, 233, 235, 237, 239, 262, 264, 266, 268, 270, 272, 274, 276 , 278, 280, 282, 284, 286. The term " nucleic acid molecule "

In one aspect, the disclosure provides an immunoglobulin single variable domain comprising at least 80% identical nucleotide sequence to the nucleotide sequence of any nucleic acid molecule having the sequence set forth in SEQ ID NOS: 39-66 and specifically binding to TGF beta RII Lt; RTI ID = 0.0 > and / or < / RTI > the recombinant nucleic acid.

In yet another aspect, a vector comprising a nucleic acid according to the disclosure is provided.

In a further aspect, there is provided a host cell comprising a nucleic acid or vector according to the present disclosure. In another aspect of the disclosure there is provided a method of producing a polypeptide comprising an anti-TGF beta RII immunoglobulin single variable domain or a polypeptide or ligand or a fusion protein according to the disclosure, To produce a polypeptide comprising an immunoglobulin single variable domain, a polypeptide or ligand or a fusion protein, by maintaining the host cell according to the disclosure under conditions suitable for expression of the immunoglobulin single variable domain. Optionally, the method isolates the polypeptide and, optionally, has improved affinity (Kd) over the isolated polypeptide; Or producing a variant, e. G., A mutated variant, having an EC50 for TGF beta neutralization in standard assays. Suitable assays for TGF beta activity, such as cell sensor assays, are described herein, for example, in the Examples section.

In one aspect of the disclosure, the anti-TGF beta RII immunoglobulin single variable domain, polypeptide or ligand or fusion protein according to the present disclosure is for use as a medicament. Accordingly, there is provided a composition for use as a medicament, comprising an anti-TGF beta RII immunoglobulin single variable domain, a polypeptide or ligand or a fusion protein according to the present disclosure.

In one aspect of the disclosure there is provided an anti-TGF beta RII immunoglobulin single variable domain, polypeptide or ligand, or a fragment thereof, for use in the treatment of diseases associated with TGF beta signaling, The use of fusion proteins is provided.

Suitably, an anti-TGF beta RII immunoglobulin single variable domain, polypeptide or ligand or fusion protein or composition according to the present disclosure is for the treatment of a disease associated with TGF beta signaling. Suitably, the disease is pulmonary fibrosis including tissue fibrosis such as idiopathic pulmonary fibrosis; Liver fibrosis including liver cirrhosis and chronic hepatitis; Rheumatoid arthritis; Ocular disorders; Or fibrosis of the skin including keloid of the skin; Dupuytren's Contracture; And renal fibrosis, such as nephritis and neuropathies; Or vascular conditions such as restenosis. Other diseases associated with TGF beta signaling include vascular diseases such as hypertension, preeclampsia, hereditary hemorrhagic capillary dilation type I (HHT1), HHT2, pulmonary arterial hypertension, aortic aneurysm, Marfan syndrome, familial aneurysm disorder, - Loeys-Dietz syndrome, Arterial Torsion Syndrome (ATS). Other diseases associated with TGF beta signaling include musculoskeletal diseases such as Duchenne muscular dystrophy and muscle fibrosis. Additional diseases associated with TGF beta signaling include cancer, such as cancer of the colon, stomach, and pancreas, and glioma and NSCLC. This disclosure also provides a method of targeting cancer by modulating TGF beta signaling in tumor angiogenesis. Other diseases or conditions include those involving tissue scarring. Other diseases include lung diseases such as COPD (chronic obstructive pulmonary disease). An anti-TGF beta RII immunoglobulin single variable domain, polypeptide or ligand or fusion protein or composition according to the present disclosure may be used for wound healing and / or may be used to inhibit or ameliorate scar formation. In one aspect, the disclosure provides an anti-TGF beta RII single variable domain, ligand or antagonist, composition or fusion protein for intradermal delivery. In one aspect, the disclosure provides an anti-TGF beta RII single variable domain, ligand or antagonist or fusion protein for delivery to a patient's skin. In one aspect, the disclosure provides for the use of an anti-TGF beta RII single variable domain, a ligand or antagonist or fusion protein in the manufacture of a medicament for intradermal delivery. In one aspect, the disclosure provides for the use of an anti-TGF beta RII single variable domain or antagonist or fusion protein according to the present disclosure in the manufacture of a medicament for delivery to a patient's skin.

In one embodiment, the variable domain is substantially a monomer. In certain embodiments, the variable domain is 65% -98% monomer in solution as measured by SEC-MALS. In another embodiment, the variable domains are selected from the group consisting of 65% -100%, 70% -100%, 75% -100%, 80% -100%, 85% -100%, 90% -100%, 95% -100% monomer.

In another embodiment, the variable domains, ligands, fusion proteins or polypeptides disclosed herein do not include any one, or any combination, or all of the following post-translational modifications when present in a pharmaceutical composition: deamidation, oxidation Or glycosylation. In certain embodiments, a variable domain, ligand, fusion protein or polypeptide according to the disclosure is not deamidated.

Suitably, the composition is for the treatment or prevention of a TGF beta-mediated condition in a human.

Thus, in one embodiment, an anti-TGF beta RII dAb is provided for the treatment of skin fibrosis, particularly keloid disease or Dukyutry's buildup. Suitably, the anti-TGF beta RII dAb is preferably provided as a substantially monomeric dAb for intradermal delivery lacking any tag, such as myc or another tablet tag (i.e., untagged) .

In one aspect, the composition is a pharmaceutical composition and further comprises a pharmaceutically acceptable carrier, excipient or diluent.

In another aspect, there is provided a method of treating and / or preventing a TGF beta-mediated condition in a human patient comprising administering to the human patient an anti-TGF beta RII immunoglobulin single variable domain, polypeptide or ligand according to the disclosure Comprising administering the composition to a patient.

In a further aspect, the disclosure provides an intradermal device comprising a composition according to the disclosure. Suitably, the device is a microneedle or a collection of microneedles.

In a further aspect, there is provided a kit comprising an anti-TGF beta RII single variable domain or polypeptide disclosed herein and an apparatus for applying the single variable domain or polypeptide to the skin, such as intravascular delivery device.

details

In this disclosure, the present disclosure has been described with reference to embodiments in a manner that enables the production of clear and precise instructions. It is contemplated and understood that embodiments may be variously combined or separated without departing from the present disclosure.

Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art (e. G., Cell culture, molecular genetics, nucleic acid chemistry, hybridization techniques and biochemistry) . Standard techniques are used for molecular, genetic and biochemical methods (generally referred to herein as Sambrook, et al., Molecular Cloning: A Laboratory Manual, 2d ed. (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, and Ausubel, et al., Short Protocols in Molecular Biology (1999) 4th Ed, John Wiley & Sons, Inc.) and chemical methods.

Immunoglobulin: As used herein, "immunoglobulin" refers to a group of polypeptides that possess immunoglobulin fold characteristics of two beta sheets, and antibody molecules containing a generally conserved disulfide bond it means.

Domain: As used herein, "domain" refers to a folded protein structure that retains its tertiary structure independent of the remainder of the protein. In general, a domain is responsible for the distinct functional properties of the protein and, in many cases, can be added or removed without loss of function of the remainder of the protein and / or domain, or delivered to another protein. A single antibody variable domain or immunoglobulin single variable domain means a folded polypeptide domain comprising the sequence characteristic of an antibody variable domain. Thus, it is contemplated that this would include a complete antibody variable domain, and, for example, a modified variable domain in which one or more loops have been replaced by a sequence not unique to the antibody variable domain, or an antibody variable domain that has been truncated or comprises N- or C- , And a folded fragment of a variable domain that at least partially retains the binding activity and specificity of the full-length domain.

Immunoglobulin Single Variable Domain: The phrase "immunoglobulin single variable domain" refers to an antibody variable domain (V _H , V _HH , or V _H) that specifically binds to an antigen or epitope independent of a different or other V region or domain, V _L ) or a binding domain. Immunoglobulin single variable domains are used when the other domain or domain is not required for antigen binding by a single immunoglobulin variable domain (i.e., when the immunoglobulin single variable domain binds to the antigen independently of the additional variable domain (E. G., Homologous - or heterozygous) with other variable domains or variable domains. "Domain antibody" or "dAb ", as used herein, is an " immunoglobulin single variable domain "."Single antibody variable domain" or "antibody single variable domain" is the same as "immunoglobulin single variable domain" The immunoglobulin single variable domain is, in one embodiment, a human antibody variable domain, but a single antibody variable domain from another species, such as rodents (e.g., as disclosed in WO 00/29004, the contents of which are incorporated herein by reference in their entirety) ), Beard sharks and camel-like VHH dAbs. Camelus VHH is an immunoglobulin single variable domain polypeptide derived from a species comprising camel, llama, alpaca, dromedary and guanaco, which naturally produces heavy chain antibodies lacking light chains. VHH can be humanized.

In all aspects of this disclosure, the immunoglobulin single variable domain is independently selected from antibody heavy and light chain single variable domains, such as V _H , V _L, and V _HH .

As used herein, an "antibody" is derived from any species that naturally produces antibodies, or is produced by recombinant DNA technology; IgG, IgM, IgD or IgE or fragments (e.g., Fab, F (ab ') ₂ , Fv, Fc, Disulfide-linked Fv, scFv, closed stereospecific multispecific antibody, disulfide-linked scFv, diabody).

Antibody format: In one embodiment, an immunoglobulin single variable domain, polypeptide or ligand according to the disclosure may be provided in any antibody format. As used herein, "antibody format" means any suitable polypeptide structure into which one or more antibody variable domains have been introduced to confer binding specificity for the antigen on its structure. A variety of suitable antibody formats, such as chimeric antibodies, humanized antibodies, human antibodies, single chain antibodies, bispecific antibodies, antibody heavy chains, antibody light chains, antibody heavy and / or light chain homodimers and heterodimers, Fv fragments (e.g., single chain Fv (scFv), disulfide conjugated Fv), Fab fragments, Fab 'fragments, F (ab') ₂ fragments) , by a single antibody variable domain (e.g., dAb, V _H, V _HH, V _L), and of any of the modified version (e. g., polyethylene glycol or other suitable polymer, or covalent attachment of a humanized VHH of which Is known. In one embodiment, another antibody format is one in which the CDRs of any molecule according to the disclosure are in the form of a suitable protein scaffold or framework, such as an affibody, an SpA scaffold, an LDL receptor class A domain, an avimer ( See, for example, US Patent Application Publication 2005/0053973, 2005/0089932, 2005/0164301) or other scaffolds that can be grafted onto the EGF domain. The ligand may also be a divalent (heterobifunctional) or polyvalent (heteropolivalent), as described herein. In another embodiment, a " universal framework "can be used, wherein the" universal framework "is defined as that defined by " Sequences of Proteins of Immunological Interest ", US Department of Health and Human Services Corresponding to the region of the antibody conserved in the same sequence or by the method of Chothia and Lesk, (1987) J. Mol. Biol. 196: 910-917. ≪ / RTI > The term " germline immunoglobulin repertoire " The present disclosure provides a single framework, or set of frameworks, that has been found to allow the derivation of substantially any binding specificity only through mutations in the hypervariable region.

In an embodiment of the disclosure set forth throughout this disclosure, instead of using an anti-TGF beta RII "dAb" in peptides or ligands of the present disclosure, one of ordinary skill in the art will appreciate that one or more of all of the CDRs of the dAb (e.g., a suitable protein scaffold or framework, such as an epitope, an SpA scaffold, an LDL receptor class A domain, or a CDR grafted onto the EGF domain) It is contemplated that polypeptides or domains may be used. Accordingly, the present disclosure should be considered as a whole in order to provide the disclosure of polyclonal antibodies using the domains instead of dAbs. In this regard, reference is made to WO2008096158, the disclosure of which is incorporated by reference.

In one embodiment, the anti-TGF beta RII immunoglobulin single variable domain is any suitable immunoglobulin variable domain and optionally comprises a human variable domain or human framework region (e.g., the DP47 or DPK9 framework region) Or a variable domain derived therefrom.

Antigen: As described herein, an "antigen" is a molecule bound by a binding domain according to the disclosure. Generally, the antigen is bound by an antibody ligand and is capable of inducing an antibody response in vivo. This can be, for example, a polypeptide, protein, nucleic acid or other molecule.

Epitope: An "epitope" is a structural unit that is typically bound by an immunoglobulin V _H / V _L pair. The epitope defines the minimal binding site for the antibody and thus represents a target for the specificity of the antibody. In the case of a single domain antibody, the epitope represents a structural unit that is bound by a variable domain at the time of isolation.

Combinations: Typically, the specific binding is expressed as a dissociation constant (Kd) of 50 nanomolar or less, optionally 250 picomolar or less. Specific binding of an antigen-binding protein to an antigen or epitope may be determined, for example, by Scatchard analysis and / or competitive binding assays such as radioimmunoassays (RIA), enzyme immunoassays such as ELISA and sandwich competition assays, ≪ RTI ID = 0.0 > and / or < / RTI >

Binding affinity: Binding affinity is determined using BIAcore ™ (Karlsson et al., 1991), optionally using surface plasmon resonance (SPR) and the BIACORE ™ system (Uppsala, Sweden). Biacore ™ systems use surface plasmon resonance to monitor biomolecular interactions in real time (SPR, Welford K. 1991, Opt. Quant. Elect. 23: 1); [Morton and Myszka, 1998, Methods in Enzymology 295: 268) employ surface plasmon resonance that can detect changes in the resonance angle of light at the surface of a thin gold film on a glass support as a result of a change in the refractive index of the surface to 300 nm. Biacore ™ analysis conveniently provides association rate constants, dissociation rate constants, equilibrium dissociation constants, and affinity constants. Binding affinities are obtained by assessing association and dissociation rate constants using a Biacore (TM) surface plasmon resonance system (Biacore (TM), Inc.). The biosensor chip is activated for shared coupling of the target according to the instructions of the manufacturer (Biacore (TM)). The target is then diluted and injected onto the chip to obtain a signal in the reaction unit of the immobilized material. Since the signal of the resonant unit (RU) is proportional to the mass of the immobilized material, the signal represents the range of immobilized target densities on the matrix. The dissociation data is fitted to the one-site model to obtain k _off +/- sd (standard deviation of the measurements). Similar to the first speed (pseudo first-order rate) constant (Kd) is plotted as a function of protein concentration to obtain (standard error of the feet (fit)) calculated, and k _on +/- se for each association curve . The equilibrium dissociation constant Kd for the bond is calculated from the SPR measurements as k _off / k _on .

Another aspect of the disclosure provides an anti-TGF beta RII immunoglobulin single variable domain that specifically binds human TGF beta RII. In one embodiment, the variable domain is at least about 50 nM, 40 nM, 30 nM, 20 nM, 10 nM or less, optionally about 9,8, 7,6 or 5 nM or less, optionally about 4 nM or less, Binds to human TGF beta RII with an equilibrium dissociation constant (KD) of about 2 nM or less, or about 1 nM or less, optionally about 500 pM or less. Suitably, when the equilibrium dissociation constant of the variable domain is from about 50 nM to 500 pM, topical administration to a tissue of interest, such as the lung, is particularly suitable. In this embodiment, a high concentration of the "moderate affinity" binding agent may be provided as an effective therapeutic agent. In another embodiment, the variable domain comprises a variable domain of about 500 pM or less, optionally about 450 pM, 400 pM, 350 pM, 300 pM, 250 pM, 200 pM, 150 pM, 100 pM, pM, 20 pM, equilibrium dissociation constant (KD) of 10 pM or less. Suitably, when the dissociation constant of the variable domain is about 500 pM to 10 pM, systemic administration is particularly suitable so that the amount in any one tissue of interest is sufficient to provide effective therapy. In this embodiment, a low concentration of the "high affinity" binding agent may be provided as an effective therapeutic agent.

In one embodiment, the single variable domain of the present disclosure shows cross reactivity between human TGF beta RII and TGF beta RII from another species, such as mouse TGF beta RII. In this embodiment, the variable domain specifically binds to human and mouse TGF beta RII. This is particularly useful because drug development generally requires testing of leading drug candidates in the mouse system before the drug is tested in humans. Providing a drug capable of binding to human and mouse species can test the results in the system and perform simultaneous comparisons of data using the same drug. This avoids the complex processes required to discover drugs acting on mouse TGF beta RII and distinct drugs acting on human TGF beta RII, and the need to compare results in humans and mice using the same drug Can be avoided. Cross reactivity between other species used in disease models, such as dogs or monkeys, such as cynomolgus monkeys, is also contemplated.

Optionally, the binding affinity of the immunoglobulin single variable domain for at least mouse TGF beta RII and the binding affinity for human TGF beta RII is different by a factor of 10, 50 or 100 or less.

CDRs: The immunoglobulin single variable domains (dAbs) described herein contain complementarity determining regions (CDR1, CDR2 and CDR3). The location and framework (FR) region and numbering system of CDRs have been defined by Kabat et al. (Kabat, EA et al., Sequences of Proteins of Immunological Interest, Fifth Edition, US Department of Health and Human Services, US Government Printing Office (1991)]). The amino acid sequences of CDRs (CDR1, CDR2, CDR3) of V _H (CDRH1 etc.) and V _L (CDRL1 etc.) (V kappa) dAb disclosed herein can be determined by those skilled in the art based on the definition of known Kabat amino acid numbering system and CDR It will be readily apparent. According to the Kabat numbering system, which is the most commonly used method based on sequence variability, the heavy chain CDR-H3 has various lengths and the insert is numbered between letters H100 and H101 with letters up to K (i.e., H100, H100A ... H100K, H101). CDRs can alternatively be generated using the system of Chothia (based on the location of the structural loop region) (Chothia et al., (1989) Conformations of immunoglobulin hypervariable regions; Nature 342, p 877-883) , AbM (compromise between carbat and cocia) or by the following contact method (prediction of the crystal structure and residues in contact with the antigen): See http://www.bioinf.org.uk/abs/ for information on how to determine suitable CDRs.

After each residue has been numbered, the following CDR definition can be applied:

Kabat:

CDR H1: 31-35 / 35A / 35B

CDR H2: 50-65

CDR H3: 95-102

CDR L1: 24-34

CDR L2: 50-56

CDR L3: 89-97

Kotia:

CDR H1: 26-32

CDR H2: 52-56

CDR H3: 95-102

CDR L1: 24-34

CDR L2: 50-56

CDR L3: 89-97

AbM:

(Using Kabat numbering): (using COATA numbering):

CDR H1: 26-35 / 35A / 35B 26-35

CDR H2: 50-58 -

CDR H3: 95-102 -

CDR L1: 24-34 -

CDR L2: 50-56 -

CDR L3: 89-97 -

contact:

(Using Kabat numbering): (using COATA numbering):

CDR H1: 30-35 / 35A / 35B 30-35

CDR H2: 47-58 -

CDR H3: 93-101 -

CDR L1: 30-36 -

CDR L2: 46-55 -

CDR L3: 89-96 -

("-" means the same numbering as Kabat)

Thus, those skilled in the art will appreciate that the presented single variable domain sequences, such as SEQ ID NOS: 1-38, 204, 206, 208, 214, 234, 236, 238, 240, 263, 265, 267, 269, 271, 273, 275, 277, 279, 281, 283, 285, and 287, it can be estimated using various methods outlined in this document as to which CDR sequence is included in the sequence. For example, for a given single variable domain sequence, e. G., SEQ ID NO: 1, one of skill in the art can determine the CDR1, CDR2, and CDR3 sequences included therein using any one or combination of the above-described CDR defining methods. When using the Kabat CDR definition, one skilled in the art can determine that the CDR1, CDR2 and CDR3 sequences are those shown in SEQ ID NOS: 77, 113 and 149, respectively. Suitably, the CDR sequences are determined using the Kabat's method described herein. In one embodiment, the CDR sequences of each sequence are those set forth in Tables 1, 2, 9 and 13. In one embodiment, the CDR1 sequence is a CDR1 sequence selected from SEQ ID NOs: 77-112, 241, 244, 247, In one embodiment, the CDR2 sequence is a CDR2 sequence selected from SEQ ID NOS: 113-148, 242, 245, 248, In one embodiment, the CDR3 sequence is a CDR3 sequence selected from SEQ ID NOS: 149-184, 243, 246, 249,

CDR variant or variant binding unit comprises an amino acid sequence modified by at least one amino acid, wherein said modification may be a chemical or partial modification of the amino acid sequence (e.g., by up to 10 amino acids) The modifications allow the variant to retain the biological characteristics of the unmodified sequence. For example, a variant is a functional variant that specifically binds to TGF beta RII. A partial modification of the CDR amino acid sequence may be by deletion or substitution of one to several amino acids, or addition or insertion of one to several amino acids, or combinations thereof (e.g., with up to 10 amino acids) have. CDR variants or binding unit variants may contain in any combination 1, 2, 3, 4, 5 or 6 amino acid substitutions, additions or deletions within the amino acid sequence. A CDR variant or a binding unit variant may contain one, two or three amino acid substitutions, insertions or deletions in any combination within the amino acid sequence. The substitution within the amino acid residue may be conservative substitution, for example, substitution of one hydrophobic amino acid with another hydrophobic amino acid. For example, leucine may be substituted with valine or isoleucine.

TGF beta RII: As used herein, "TGF beta RII" (Transforming Growth Factor Beta Type II Receptor; TGFβRII) refers to a naturally occurring or endogenous mammalian TGF beta RII protein and a naturally occurring or endogenous corresponding mammalian TGF beta Means a protein having the same amino acid sequence as the RII protein (for example, a recombinant protein, a synthetic protein (i.e., produced using a method of synthetic organic chemistry)). Thus, as defined herein, the term includes mature TGF beta RII proteins, polymorphic or allelic variants, and other isoforms of TGF beta RII and their modified or unmodified forms (e. G., Lipidation , Glycosylation). Naturally occurring or endogenous TGF beta RII is a naturally occurring wild-type protein such as mature TGF beta RII, polymorphic or allelic variants and other isoform and mutant forms in mammals (e. G., Human, non-human primates) . Such a protein may be recovered or isolated from a source that naturally expresses, for example, TGF beta RII. These proteins and proteins having the same amino acid sequence as the naturally occurring or endogenous corresponding TGF beta RII are referred to according to the corresponding mammalian name. For example, if the corresponding mammal is a human, the protein is designated as human TGF beta RII. Human TGF beta RII is described, for example, in Lin, et al., Cell 1992, Vol. 68 (4), p. 775-785, and Genbank Deposit No. M85079.

Human TGF beta RII is a transmembrane receptor consisting of an extracellular domain of approximately 159 amino acids, a transmembrane domain, and a 567 amino acid having a cytoplasmic domain comprising a protein kinase domain for signaling.

As used herein, "TGF beta RII" also includes a portion or fragment of TGF beta RII. In one embodiment, the portion or fragment comprises the extracellular domain of TGF beta RII or a portion thereof.

"Anti-TGF beta RII" in the context of immunoglobulin single variable domains, polypeptides, ligands, fusion proteins and the like means a moiety that recognizes and binds TGF beta RII. In one embodiment, "anti-TGF beta RII" specifically recognizes and / or specifically binds to protein TGF beta RII and is suitably human TGF beta RII. In another embodiment, the anti-TGF beta RII immunoglobulin single variable domain according to the present disclosure is also a mouse TGF beta RII (Gene Bank accession NM_029575; see, for example, Massague et al., Cell 69 (7) , 1067-1070 (1992)).

"TGF beta" includes isoforms such as TGF beta 1, TGF beta 2 and TGF beta 3.

TGF beta binds to TGF beta RII and initiates a signaling pathway in the complex with TGF beta RI. Thus, inhibition or neutralization of TGF beta activity and TGF beta activity can be determined through any assay that measures the output of TGF beta signaling. TGF beta signaling is described, for example, in Itoh, et al., Eur. J. Biochem 2000, Vol. 267, p. 6954]; [Dennler, et al., Journal of Leucocyte Biol. 2002, 71 (5), p. 731-40. Thus, TGF beta activity can be tested in many different assays well known to those skilled in the art. "Inhibition" or "neutralization" means that the biological activity of TGF beta is completely or partially reduced in the presence of the immunoglobulin single variable domain compared to the activity of TGF beta in the absence of the immunoglobulin single variable domain of the present disclosure do.

In one embodiment, inhibition or neutralization of TGF beta activity is tested in an IL-11 release assay. In this embodiment, the ability of the immunoglobulin single variable domain according to the present disclosure to inhibit human TGF beta 1 (TGF beta 1; TGF-? 1) stimulated IL-11 release from cells such as A549 cells Lt; / RTI > TGF-beta1 binds directly to TGF-beta RII (TGF-beta RII) and induces association of the TGF beta RI / RII (TGF-beta RII / II) complex. TGF beta RI (TGF-β RI) is phosphorylated and can signal through several pathways including the Smad4 pathway. Activation of the Smad4 pathway results in the release of IL-11. IL-11 is secreted into the cellular supernatant and is therefore measured by colorimetric ELISA. A suitable IL-11 release assay, such as the human IL-11 Quantikine ELISA assay kit (ref. D1100) supplied by R & D systems is described herein.

In another embodiment, the TGF beta activity is determined by the ability of the immunoglobulin single variable domain according to the present disclosure to inhibit TGF beta-induced expression of CAGA-luciferase in MC3T3-E1 cells by MC3T3-E1 luciferase assay It is tested in the test. Three copies of the TGF beta-reactive sequence motif, termed CAGA box, are present in the human PAI-I promoter and specifically bind to Smad3 and 4 proteins. Cloning of multiple copies of the CAGA box into a Luciferase reporter construct will confer TGF beta reactivity to the transfected cells with a reporter system. One suitable assay is described herein and uses MC3T3-E1 cells (mouse osteoblasts) stably transfected with [CAGA] ₁₂ -luciferase reporter constructs (Dennler, et al., (1998) EMBO J 17, 3091-3100).

Other suitable assays include human SBE beta-lactamase cell assays (INVITROGEN®, cell sensor assay). Examples of suitable assays are described herein.

Suitably, the immunoglobulin single variable domain, polypeptide, ligand or fusion protein according to the present disclosure does not itself activate TGF beta RII receptor signaling. Thus, in one embodiment, the immunoglobulin single variable domain, polypeptide, ligand or fusion protein according to the present disclosure does not have TGF beta RII agonist activity at 10 [mu] M. Agonist activity can be determined by testing compounds of interest with the TGF beta RII assay described herein in the absence of TGF beta. In the absence of TGF beta, the agonist activity of the compound of interest will be detected by detecting TGF beta RII signaling.

Homology: Sequences that are similar or homologous (e.g., at least about 70% sequence identity) to the sequences disclosed herein are also part of this disclosure. In some embodiments, the sequence identity at the amino acid level is about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% Or more. At the nucleic acid level, the sequence identity is about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95% 98%, 99% or more. Alternatively, substantial identity exists when the nucleic acid hybridizes to the complement of the strand under selective hybridization conditions (e. G., Very high stringency hybridization conditions). The nucleic acid may be present in whole cells, in cell lysates, or in partially purified or substantially pure form.

As used herein, the terms "low stringency," "medium stringency," "high stringency," or "very high stringency" conditions describe conditions for nucleic acid hybridization and washing. Guidance for the performance of the hybridization reaction can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. et al., Incorporated herein by reference in its entirety. (1989), 6.3.1-6.3.6]. Aqueous and non-aqueous processes are described in the above references, and any one of them may be used. Specific hybridization conditions referred to herein are as follows: (1) Low stringency hybridization conditions: 6X sodium chloride / sodium citrate (SSC) at about 45 ° C followed by 0.2X SSC at 50 ° C, 2 Washing (the temperature of the washing solution can be increased to 55 ° C for low stringency conditions); (2) Medium stringency hybridization conditions: one more wash in 6X SSC at about 45 ° C followed by 0.2X SSC in 0.1% SDS at 60 ° C; (3) High stringency hybridization conditions: at least one wash in 6X SSC at about 45 ° C followed by 0.2X SSC at 0.1% SDS at 65 ° C; And optionally (4) very stringent hybridization conditions are one or more washes of 0.5 M sodium phosphate, 7% SDS at 65 占 폚 followed by 0.2 占 SSC at 1 占 폚, 1% SDS at 65 占 폚. A very high stringency condition (4) is a desirable condition and is a condition that should be used unless otherwise specified.

The calculation of "homology" or "sequence identity" or "similarity" between two sequences (these terms are used interchangeably herein) is performed as follows. (For example, a gap may be introduced in one or both of the first and second amino acid or nucleic acid sequences for optimal alignment, and the non-homologous sequence may be introduced for comparison purposes Can be ignored). In one embodiment, the length of the reference sequence aligned for comparison is at least about 30%, optionally at least about 40%, optionally at least about 50%, optionally at least about 60%, and optionally at least about 70% %, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%. The amino acid residue or nucleotide at the corresponding amino acid position or nucleotide position is then compared. If the position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, the molecule is the same at that position (as used herein, the amino acid or nucleic acid "homology" Equality "). The percent identity between two sequences is a function of the number of identical positions shared by the sequences taking into account the number of gaps that need to be introduced for optimal alignment of the two sequences and the length of each gap.

Amino acid and nucleotide sequence alignment and homology, similarity, or identity as defined herein can be determined using an algorithm (e. G., Tatusova, TA et al .., FEMS Microbiol Lett, 174: 187-188 It is optionally prepared and determined by BLAST 2 Sequences. Alternatively, the BLAST algorithm (version 2.0) is used for sequence alignment, where the parameters are set to default values. BLAST (Basic Local Alignment Search Tool) is a heuristic search algorithm used by programs blastp, blastn, blastx, tblastn, and tblastx; These programs are described in Karlin and Altschul, 1990, Proc. Natl. Acad. Sci. USA 87 (6): 2264-8).

Ligand: As used herein, the term "ligand" means a compound comprising at least one peptide, polypeptide or protein moiety having a binding site with binding specificity for TGF beta RII. The ligand can also be referred to as a "binding moiety ".

Ligands or binding moieties according to this disclosure optionally contain immunoglobulin variable domains with different binding specificities and do not contain a variable domain pair that together form a binding site for the target compound (i. E., TGF beta RII Lt; RTI ID = 0.0 > immunoglobulin < / RTI > heavy chain variable domain and the immunoglobulin light chain variable domain). Optionally, each domain with a binding site with binding specificity for the target can be an immunoglobulin single variable domain (e. G., An immunoglobulin single domain having binding specificity for the desired target (e. G., TGF beta RII) a heavy chain variable domain (e.g., V _H, V _HH), an immunoglobulin light chain single variable domain (e.g., V _L)).

Thus, a "ligand" comprises a polypeptide comprising two or more immunoglobulin single variable domains, each binding to a different target. The ligand may also comprise a CDR sequence of at least two immunoglobulin single variable domains or single variable domains that bind to different targets in a suitable format such as an antibody format (e.g., an IgG-like format, scFv, Fab, Fab ', F ab ') ₂ ) or a polypeptide comprising a suitable protein scaffold or backbone such as an Apiva, SpA scaffold, LDL receptor class A domain, EGF domain, avimer and double- and multi-specific ligands described herein .

A polypeptide domain having a binding site with a binding specificity for a target (e. G., TGF beta RII) may also be a protein domain comprising a binding site for a desired target, e. G., A protein domain, A SpA domain, an LDL receptor class A domain, an avimer (see, for example, US Patent Application Publication 2005/0053973, 2005/0089932, 2005/0164301). If desired, the "ligand" may each independently include one or more additional moieties that may be peptides, polypeptides or protein moieties or non-peptidic moieties (eg, polyalkylene glycols, lipids, carbohydrates) As shown in FIG. For example, the ligand can be a half-life extending moiety as described herein (e. G., A moiety containing a polyalkylene glycol moiety, an albumin, an albumin fragment or an albumin variant, a transferrin, a transferrin fragment, A moiety that binds to the albin, a moiety that binds to the neonatal Fc receptor).

Competition: As mentioned herein, the term "compete" refers to the binding of a first target (e. G., TGF beta RII) to its cognate target binding domain (e. G., An immunoglobulin single variable domain) Is inhibited in the presence of a second binding domain (e. G., An immunoglobulin single variable domain) specific for the cognate target. For example, the binding can be sterically inhibited by, for example, physical interception of the binding domain or by altering the structure or environment of the binding domain so that its affinity or binding ability to the target is reduced. Details of how to perform competitive ELISA and competitive BiacoreTM experiments to determine competition between the first and second binding domains are set forth in detail in order to provide a clear disclosure for use in this disclosure See WO2006038027, which is incorporated herein by reference. The present disclosure includes antigen binding proteins, particularly single variable domains, polypeptides, ligands and fusion proteins, that compete with any one of the single variable domains of SEQ ID NOS: 1-38. In certain embodiments, a TGF beta RII binding protein competes with any one of the single variable domains of SEQ ID NOS: 1-38 and has a KD of 50 nM or less for TGF beta RII. In certain embodiments, the KD is between 10 pM and 50 nM. In certain embodiments, the KD is between 10 pM and 10 nM. In certain embodiments, the KD is between 100 pM and 10 nM. In certain embodiments, KD is approximately 100 pM.

TGF beta signaling: Suitably, a single variable domain, polypeptide or ligand of the disclosure may neutralize TGF beta signaling through TGF beta RII. "Neutralizing" means that the normal signaling effects of TGF beta are blocked such that the presence of TGF beta has a neutralizing effect on TGF beta RII signaling. Methods suitable for neutralization effect measurement include assays for TGF beta signaling as described herein. In one embodiment, neutralization is observed as a% inhibition of TFG beta activity in TGF beta signaling assays. In one embodiment, a single variable domain or polypeptide binds to the extracellular domain of TGF beta RII to inhibit / block binding of TGF beta to the extracellular domain of TGF beta RII. Suitably, the single variable domains or polypeptides are characterized by the presence of an excess of bioavailable TGF beta and the signaling activity of the bioactive TGF beta through a single variable domain or polypeptide inhibiting the binding of TGF beta to its kin analogue receptor TGF beta RII It is useful when it acts to inhibit.

The term "antagonist of TGF beta RII" or "anti-TGF beta RII antagonist ", as used herein, refers to an agent that binds to TGF beta RII and is capable of inhibiting the function of TGF beta RII For example, molecules, compounds). For example, antagonists of TGF beta RII may inhibit binding of TGF beta to TGF beta RII and / or inhibit signaling mediated through TGF beta RII. Thus, TGF beta-mediated processes and cellular responses can be inhibited by antagonists of TGF-beta RII.

In one embodiment, a ligand (e. G., An immunoglobulin single variable domain) that binds to TGF beta RII is present at a concentration of about 10 μM, ≤ about 1 μM, ≤ about 100 nM, ≤ about 50 nM, Inhibits the binding of TGF beta to the TGF beta RII receptor with an inhibitory concentration 50 (IC50) of about 5 nM, about 1 nM, about 500 pM, about 300 pM, about 100 pM, or about 10 pM do. In certain embodiments, the IC50 of the anti-TGF beta RII immunoglobulin single variable domain of the present disclosure is 15 μM or less. The IC50 is optionally determined using an in vitro TGF beta receptor binding assay, or a cell assay, such as the assays described herein

In addition, the ligand (e. G., An immunoglobulin single variable domain) can be at least about 10 [mu] M, at least about 1 [mu] M, at least about 100 nM, at least about 50 nM, at least about 10 nM, at least about 5 nM, , Neutralizing capacity 50 (?) Of about 500 pM,? About 300 pM,? About 100 pM,? About 10 pM,? About 1 pM, about 500 fM, about 300 fM, about 100 fM, RTI ID = 0.0 > TGF < / RTI > In certain embodiments, the anti-TGF beta RII immunoglobulin single variable domain of this disclosure achieves greater than 40% neutralization of TGF-ss.

In one embodiment, an immunoglobulin single variable domain, polypeptide or ligand according to the present disclosure has a first antigen or epitope binding site (e. G., A first immunoglobulin single variable domain) Specific ligand "meaning a ligand comprising a second antigen or epitope binding site (e. G., A second immunoglobulin single variable domain), wherein the binding site or variable domain comprises two (E. G., Different antigens or two copies of the same antigen) or two epitopes on the same antigen that are not normally bound by a single specific immunoglobulin. For example, the two epitopes may be on the same antigen but are not the same epitope or sufficiently contiguous to bind by a single specific ligand. In one embodiment, the dual-specific ligand according to the present disclosure consists of a variable domain pair (i. E., A V _H / V _L pair) consisting of a binding site or variable domain with different specificity and having mutual complementarity with the same specificity (I. E., Do not form a single binding site).

In one embodiment, "dual-specific ligand" can bind to TGF beta RII and another target molecule. For example, a dual-specific ligand of the disclosure may be designed such that the other anti-TGF beta RII polypeptide or immunoglobulin single variable domain according to the present disclosure is targeted to the tissue of interest, May be tissue-specific target molecules. The tissue includes lung, liver and the like.

Multispecific dAb multimers are also provided. This includes a large amount of dAb comprising an anti-TGF beta RII immunoglobulin single variable domain according to any aspect of the present disclosure and one or more single variable domains each binding to a different target (e.g., a target other than TGF beta RII) Lt; / RTI > In one embodiment, a bispecific dAb multimer, e. G., One or more anti-TGF beta RII immunoglobulin single variable domains according to any aspect of the disclosure and one or more dabs that bind to a second different target The included dab multimers are provided. In one embodiment, a triple specific dAb multimer is provided.

The ligands (e. G., Polypeptides, dAbs, and antagonists) of the present disclosure may have a format of a fusion protein containing a first immunoglobulin single variable domain fused directly to a second immunoglobulin single variable domain. If desired, the format may further comprise a half-life extension moiety. For example, the ligand may comprise a first immunoglobulin single variable domain directly fused to a second immunoglobulin single variable domain fused directly to an immunoglobulin single variable domain that binds to serum albumin.

In general, the orientation of the polypeptide domain with the binding site with binding specificity to the target, and whether the ligand contains a linker, is a matter of design choice. However, some orientations with or without linkers may provide better binding properties than other orientations. All orientations included by this disclosure (e.g., dAb1-linker-dab2; dAb2-linker-dab1) are ligands with orientation that provide the required binding properties that can be readily ascertained by screening.

Polypeptides according to this disclosure and dAbs including dAb monomers, dimers and trimers can be linked to an antibody Fc region comprising one or both of the C _H 2 and C _H 3 domains, and optionally a hinge region. For example, a vector encoding a ligand linked as a single nucleotide sequence in the Fc region may be used for the production of the polypeptide. In one embodiment, a dAb-Fc fusion is provided.

The present disclosure also provides dimers, trimers and polymers of the above-mentioned dAb monomers.

Target: As used herein, the phrase "target" refers to a biological molecule (eg, a peptide, polypeptide, protein, lipid, carbohydrate) to which a polypeptide domain having a binding site can bind. The target may be, for example, an intracellular target (e. G., An intracellular protein target), a soluble target (e.g., secreted), or a cell surface target (e. G., A membrane protein, a receptor protein). In one embodiment, the target is TGF beta RII. In another embodiment, the target is a TGF beta RII extracellular domain.

Complementarity: As used herein, "complementarity" refers to belonging to or belonging to a family of structures in which two immunoglobulin domains form a cognate pair or group, and possesses such characteristics. For example, the V _H and V _L domains of the antibody are complementary; The two V _H domains are not complementary and the two V _L domains are not complementary. Complementarity domains can be found in other members of the immunoglobulin superfamily, such as the V? And V? (Or? And?) Domains of T-cell receptors. An artificial domain, e. G., A domain based on a protein scaffold that does not bind unless manipulated to bind to the epitope is non-complementary. Likewise, the two domains based on (for example) the immunoglobulin domain and the fibronectin domain are not complementary.

"Affinity" and "binding force" are technical terms describing the strength of the binding interaction. For the ligands of this disclosure, the binding force refers to the total bond strength between a ligand and a target (e.g., a first target and a second target) on a cell. The binding force is greater than the sum of individual affinities for individual targets.

Nucleic Acid Molecules, Vectors and Host Cells: The present disclosure also provides isolated and / or recombinant nucleic acid molecules (e. G., Nucleic acid molecules, vectors, and multispecific ligands) that encode the ligands (single variable domains, fusion proteins, polypeptides, Lt; / RTI >

A nucleic acid referred to herein as "isolated" is a nucleic acid isolated from the genomic DNA of its source or the nucleic acid of the cellular RNA (for example, because the nucleic acid is present in the cell or in a mixture of nucleic acids, Nucleic acids obtained by the methods described herein or other suitable methods, including pure nucleic acids, nucleic acids produced by chemical synthesis, combinations of biological and chemical methods, and isolated recombinant nucleic acids (see, for example, (See Lewis, AP and JS Crowe, Gene, 101: 297-302 (1991)), for example, Daugherty, BL et al., Nucleic Acids Res., 19 (9): 2471 2476 (1991).

Nucleic acids referred to herein as "recombinant" are produced by recombinant DNA methods, including nucleic acids produced by artificial recombination methods such as polymerase chain reaction (PCR) and / or procedures that rely on cloning into vectors using restriction enzymes Lt; / RTI >

In certain embodiments, the isolated and / or recombinant nucleic acid comprises a nucleotide sequence encoding an immunoglobulin single variable domain, polypeptide or ligand, as described herein, and wherein the ligand binds to the TGF beta RII disclosed herein at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 80%, at least about 90% , At least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% amino acid sequence identity. Nucleotide sequence identity can be determined over the entire length of the nucleotide sequence encoding the selected anti-TGF beta RII dAb. In one embodiment, the nucleic acid sequence comprises or consists of a nucleic acid sequence at least 80% identical to any one of SEQ ID NOS: 39-66. In one embodiment, the nucleic acid sequence comprises or consists of any one of the nucleic acid sequences of SEQ ID NOS: 39-76.

Embodiments of the disclosure also provide codon optimized nucleotide sequences that encode polypeptides and variable domains disclosed herein that are optimized for expression in, for example, bacteria, mammalian or yeast cells.

The present disclosure also provides a vector comprising the recombinant nucleic acid molecule of the present disclosure. In certain embodiments, the vector is an expression vector comprising one or more expression control elements or sequences operably linked to the recombinant nucleic acid of the present disclosure. The disclosure also provides a recombinant host cell comprising the recombinant nucleic acid molecule or vector of the present disclosure. Suitable vectors (e.g., plasmids, phagemids), expression control elements, host cells and methods suitable for producing recombinant host cells of the present disclosure are known in the art, and examples are further described herein.

Suitable expression vectors include, but are not limited to, a number of components such as a replication origin, a selectable marker gene, one or more expression control elements such as transcription control elements (e.g., promoters, enhancers, terminators) Or leader sequences, and the like. If present, the expression control element and signal sequence may be provided by a vector or other source. For example, transcriptional and / or translational control sequences of the cloned nucleic acid encoding the antibody chain may be used to induce expression.

Promoters may be provided for expression in the host cells of interest. The promoter may be constitutive or inducible. For example, the promoter may be operably linked to a nucleic acid encoding an antibody, antibody chain, or portion thereof, to direct transcription of the nucleic acid. ( E. G., The lac, tac, T3, T7 promoter for E. coli ) and the eukaryotic host (e. G., The monkey virus 40 early or late promoter, the Rous sarcoma virus long terminal Repetitive promoters, cytomegalovirus promoters, late adenovirus promoters) can be used.

In addition, the expression vector generally includes a selectable marker for selection of a host cell harboring the vector, and a replication origin in the case of a replicable expression vector. The gene encoding the antibiotic or drug-tolerant product is a conventional selectable marker and may be a prokaryotic (e. G., A lactamase gene (ampicillin resistance), a Tet gene for tetracycline resistance) Methionine (G418 or geneticin), gpt (mycophenolic acid), ampicillin, or hygromycin resistance gene. The dihydrofolate reductase marker gene allows selection using methotrexate in a variety of hosts. The gene encoding the gene product (e. G., LEU2, URA3, HIS3) of the host auxotrophic marker is often used as a selectable marker in yeast. Vectors (e. G., Baculovirus) or phage vectors, and vectors capable of integrating into the genome of a host cell, such as a retroviral vector, are also contemplated. Mammalian cells and prokaryotic cells (E. coli), insect cells ( Drosophila Suitable expression vectors for expression in Schnieder S2 cells, Sf9) and yeast ( P. methanolica , P. pastoris , S. cerevisiae ) Are known in the art.

Suitable host cells include prokaryotes, e. G. Bacterial cells, e. Col. Rain. Inhibitors and / or other suitable bacteria; Eukaryotic cells such as fungi or yeast cells (e. G., Pichia < RTI ID = 0.0 > pastoris), Aspergillus (Aspergillus) species, Saccharomyces access to my Celebi jiae (Saccharomyces S. cerevisiae , Schizosaccharomyces < RTI ID = 0.0 > pombe , Neurospora crassa)), or other lower eukaryotic cells, and cells of higher eukaryotes, such as insect cells (e.g., draw small pillars syuni more S2 cells, Sf9 insect cells (WO 94/26087 (O'Connor)), mammals (Eg ATCC Accession No. CRL-1650) and COS-7 (ATCC Accession No. CRL-1651), CHO (for example ATCC Accession No. CRL-9096, CHO DG44 293 (ATCC Accession No. CRL-1573), HeLa (ATCC, USA), and the like) (ATCC Accession No. CCL-70), WOP (Dailey, L, et al., J. Virol., 54: 739-749 (1985)), 3T3, 293T NS2 cells, SP2 / 0, HuT 78 cells, etc., or plants (for example, tobacco plants, such as tobacco plants, (See, for example, Ausubel, FM et al., Eds. Current Protocols in Molecular Biology, Greene Publishing Associates and John Wiley & In certain embodiments, the host cell is an isolated host cell and is not part of a multicellular organism (e. G., A plant or animal). In certain embodiments, the host cell is a non- human host cell. (E. G., A double-specific ligand, e. G., A < / RTI > ligand) of the present disclosure, including maintaining the recombinant host cell containing the recombinant nucleic acid of interest under conditions suitable for expression of the recombinant nucleic acid, A multispecific ligand). In some embodiments, the method further comprises the isolation of a ligand.

See page 161, line 24 to page 189, line 10 of WO200708515 for a detailed description of the disclosure that may be applied to embodiments of the present disclosure. The disclosure is incorporated herein by reference in its entirety for all purposes to provide explicit support for the present disclosure as it is expressly set forth in the disclosure of this disclosure and as related to the embodiments of this disclosure, . This includes the preparation of immunoglobulin-based ligands, library vector systems, library construction, combination single variable domains, ligand properties, ligand structure, Quot ;, " scaffold for use in ligand construction ", "diversity of regular sequences ", and" therapeutic and diagnostic compositions and uses ", and "operably linked "," naive ", & , Page 161, line 24 to page 189, line 10, which provides details on the definition of " treatment ", "treatment "," allergic disease ", " Includes the proposed disclosure.

The phrase "half-life" means the time taken for the serum concentration of an immunoglobulin single variable domain, polypeptide or ligand to decrease by 50% in vivo, for example by degradation of the ligand and / or loss or elimination of the ligand by its natural mechanism do. The ligands of the present disclosure can be stabilized in vivo by binding to molecules that are resistant to degradation and / or loss or elimination, and their half-life can be increased. Generally, the molecule is a naturally occurring protein that has a long half-life in vivo in itself. The half-life of the ligand is increased if its functional activity in vivo continues for longer periods of time than a similar ligand that is not specific for the half-life enhancing molecule. Hence, ligands specific for HSA and target molecules are compared to the same ligand that does not bind HSA but binds to another molecule, without the specificity for HSA. Generally, half-life increases to 10%, 20%, 30%, 40%, 50% or more. A half life of 2x, 3x, 4x, 5x, 10x, 20x, 30x, 40x, 50x or more is possible. Alternatively, or additionally, it is possible to increase the half-life to 30x, 40x, 50x, 60x, 70x, 80x, 90x, 100x, 150x.

Format: The increased half-life may be useful for in vivo application of immunoglobulins, particularly antibodies, most particularly antibody fragments of small size. The fragments (Fv, disulfide-linked Fv, Fab, scFv, dAb) are generally rapidly lost from the body. A dAb, polypeptide or ligand according to this disclosure can be tailored to provide a longer duration in the body of increased in vivo half-life and thus functional activity of the ligand.

Those skilled in the art will be familiar with methods for pharmacokinetic analysis and determination of the ligand half-life. Details can be found in Kenneth, A et al .: Chemical Stability of Pharmaceuticals: A Handbook for Pharmacists and Peters et al., Pharmacokinetic analysis: A Practical Approach (1996). In addition, pharmacokinetic parameters such as t Pharmacokinetics, M Gibaldi & D Perron, published by Marcel Dekker, 2nd Rev. 2002, which describes t alpha and t beta half-life and sub-curve area (AUC). ex edition (1982)].

The half-life (t1 / 2 alpha and t1 / 2 beta) and AUC can be determined from the curve of the serum concentration of the ligand with time. For example, a WINNONLIN ™ analysis package (Pharsight Corp., CA 94040 Mountain View, USA) can be used to model curves. In the first phase (alpha phase), the ligand is mostly distributed to the patient and partly removed. The second phase (beta phase) is the termination phase in which the serum concentration is reduced because the ligand is dispensed and the ligand is lost from the patient. The t alpha half life is the half life of the first phase and the t beta half life is the half life of the second phase. Thus, in one embodiment, the present disclosure provides a ligand or composition comprising the ligand according to the disclosure in which the t alpha half-life is in the range of 15 minutes or more. In one embodiment, the lower limit of the range is 30 minutes, 45 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 10 hours, 11 hours or 12 hours. Additionally, or alternatively, the t? Half-life of the ligand or composition according to this disclosure is 12 hours or less. In one embodiment, the upper limit of the range is 11, 10, 9, 8, 7, 6 or 5 hours. Examples of suitable ranges are 1 to 6 hours, 2 to 5 hours or 3 to 4 hours.

In one embodiment, the disclosure provides a ligand (polypeptide, dAb or antagonist) or a composition comprising same, according to the disclosure, wherein the t beta half-life is in the range of about 2.5 hours or more. In one embodiment, the lower limit of the range is about 3 hours, about 4 hours, about 5 hours, about 6 hours, about 7 hours, about 10 hours, about 11 hours, or about 12 hours. Additionally, or alternatively, the t? Half-life of the ligand or composition according to this disclosure is 21 days or less. In one embodiment, the upper limit of the range is about 12 hours, about 24 hours, about 2 days, about 3 days, about 5 days, about 10 days, about 15 days, or about 20 days. In one embodiment, the t beta half-life of the ligand or composition according to the present disclosure will be from about 12 to about 60 hours. In a further embodiment, this half-life will be from about 12 to about 48 hours. In a further embodiment, this half-life will be from about 12 to about 26 hours.

In addition to, or alternatively to, the present disclosure, the disclosure provides a ligand according to this disclosure, or a composition comprising the same, wherein the AUC value (area under the curve) is in the range of about 1 mg · min / ml or more. In one embodiment, the lower limit of the range is about 5, about 10, about 15, about 20, about 30, about 100, about 200 or about 300 mg · min / ml. Additionally, or alternatively, the AUC range of a ligand or composition according to the present disclosure is less than or equal to about 600 mg · min / ml. In one embodiment, the upper limit of the range is about 500, about 400, about 300, about 200, about 150, about 100, about 75, or about 50 mg · min / ml. In one embodiment, the range of AUCs of a ligand according to the present disclosure will be selected from the group consisting of: about 15 to about 150 mg · min / ml, about 15 to about 100 mg · min / ml, about 15 About 75 mg · min / ml, and about 15 to about 50 mg · min / ml.

Polypeptides and dAbs of this disclosure and antagonists comprising it can be conjugated to the antibody domain by, for example, attachment of a PEG group, serum albumin, transferrin, a transferrin receptor or at least its transferrin-binding moiety, antibody Fc region, Can be formatted to have a larger hydrodynamic size. For example, a polypeptide dAb and antagonists larger antigens of the antibody-is formatted as a binding fragment or antibody (e.g., Fab, Fab ', F ( ab) 2, F (ab') 2, IgG, as scFv Formatted).

As used herein, "hydrodynamic size" means the apparent size of a molecule (eg, a protein molecule, ligand) based on the diffusion of a molecule through an aqueous solution. Diffusion or movement of the protein through the solution can be processed to induce the apparent size of the protein, and the size is presented as the "Stokes radius" or "hydrodynamic radius" of the protein particle. The "hydrodynamic size" of a protein depends on both its mass and its morphology (stereomorphic) so that the two proteins with the same molecular mass can have different hydrodynamic sizes based on the overall stereomorphic form of the protein.

The hydrodynamic size of the ligands of the present disclosure (e. G., DAb monomers and multimers) can be determined using methods known in the art. For example, gel filtration chromatography can be used to determine the hydrodynamic size of the ligand. Suitable gel filtration matrices, such as crosslinked agarose matrices, for determining the hydrodynamic size of the ligand are known and readily available.

The size of the ligand format (e.g., the size of the PEG moiety attached to the dAb monomer) may vary depending upon the application desired. For example, if the ligand is intended to be introduced into peripheral tissues away from the circulatory system, it is desirable to keep the hydrodynamic size of the ligand small to facilitate efflux from the bloodstream. Alternatively, if the ligand is required to remain in the systemic circulation for a longer period of time, the size of the ligand can be increased by formatting, for example, as an Ig-like protein.

The half-life extension by targeting of an antigen or epitope that increases half-life in vivo: the hydrodynamic size of the ligand and its serum half-life can also be determined by multiplying the TGF beta RII binding polypeptide, dAb or ligand of the disclosure by half- (E. G., An antibody or antibody fragment) that binds to an antigen or epitope that increases in vivo. For example, a TGF beta RII binding agent (e. G., A polypeptide) may be conjugated to an anti-serum albumin or anti-neonatal Fc receptor antibody or antibody fragment such as an anti-SA or anti-neonatal Fc receptor dAb, Fab, scFv, or to an anti-SA or anti-neonatal Fc receptor ApiBody or anti-SA Abimer, or an anti-SA binding domain (CTLA-4, Lipocalin, SpA, Apibody, Abbimer, GroEI and Fibronectin (For the disclosure of the binding domain, see WO2008096158, where the domain and its sequence are incorporated herein by reference and form part of the disclosure herein) Or connected. The conjugate refers to a composition comprising a polypeptide, dAb or antagonist of the present disclosure conjugated (shared or non-covalent) to a binding domain, such as a binding domain that binds to serum albumin.

Generally, polypeptides that enhance serum half-life in vivo are polypeptides that are resistant to degradation or elimination by endogenous mechanisms that are naturally occurring in vivo and that remove unwanted substances from an organism (e. G., Human). For example, a polypeptide that enhances serum half-life in vivo may be used as a protein from an extracellular matrix, a protein found in blood, a protein found in blood brain barrier or neural tissue, a kidney, liver, lung, heart, skin or bone A protein involved, a stress protein, a disease-specific protein, or a protein involved in Fc transport. Suitable polypeptides are described, for example, in WO2008 / 096158.

The method may also be used for targeted delivery of a single variable domain, polypeptide or ligand according to the present disclosure to a tissue of interest. In one embodiment, targeted delivery of high affinity single variable domains according to the present disclosure is provided.

DAbs that bind to serum albumin: In one embodiment, the disclosure provides a method of treating a subject with a polypeptide or an antagonist (e.g., an anti-TGF beta RII dAb (first dAb) that binds to TGF beta RII and an agent that binds to serum albumin 2 < / RTI > dAb (SA binding second dAb). Details of bispecific ligands can be found in WO03002609, WO04003019, WO2008096158 and WO04058821.

In certain embodiments of the ligand and antagonist, the dAb is any dAb sequence as disclosed in WO2004003019 for binding to human serum albumin and for binding to albumin (this sequence and its nucleic acid counterpart are incorporated herein by reference, Any of the dAb sequences disclosed in WO2007080392 (this sequence and its nucleic acid counterpart are included herein by reference and form part of the disclosure herein), any of the dAb sequences disclosed in WO2008096158 (including this sequence and its nucleic acid counterpart Quot; is incorporated herein by reference and forms part of the specification).

In certain embodiments, the dAb binds to human serum albumin and is at least about 80%, or at least about 85%, or at least about 90%, or at least about 95%, or at least about 80%, or at least about 95% At least about 96%, or at least about 97%, or at least about 98%, or at least about 99% amino acid sequence identity. For example, a dAb that binds to human serum albumin is at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 98% And may comprise an amino acid sequence having at least about 99% amino acid sequence identity. In certain embodiments, the dAb binds to human serum albumin and comprises at least about 80%, or at least about 85%, or at least about 90%, or at least about 95%, or at least about 96%, of the amino acid sequence of any of the above dAbs. , Or at least about 97%, or at least about 98%, or at least about 99% amino acid sequence identity.

In a more particular embodiment, the dAb is a V kappa dAb that binds to human serum albumin. In a more particular embodiment, the dAb is a V _H dAb that binds to human serum albumin.

Suitable camel types V _HH that bind to serum albumin include those disclosed in WO2004041862 (Ablynx N.V.) and WO2007080392. (The V _HH sequence and its nucleic acid counterpart are incorporated herein by reference and are part of the disclosure herein Lt; / RTI > In certain embodiments, the camelid V _HH binds to human serum albumin and has at least about 80% homology with any one of the sequences disclosed in WO2007080392 or SEQ ID NOs: 518-534 (SEQ ID NOs: corresponding to those mentioned in WO2007080392 or WO2004041862) , Or at least about 85%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99% amino acid sequence identity .

In another embodiment, the antagonist or ligand comprises a binding moiety specific to TGF beta RII (e. G., Human TGF beta RII), wherein the moiety comprises a non-immunoglobulin sequence as described in WO2008096158, The disclosure of such binding moieties, their production and selection methods (e.g., from various libraries) and sequences thereof are incorporated herein by reference as part of the disclosure of this specification.

(E.g., albumin, transferrin, and fragments and analogs thereof) may be conjugated to a TGF beta RII of the present disclosure (e. G., Albumin) - binding polypeptide, dAb or antagonist. Examples of suitable albumin, albumin fragments or albumin variants for use in the TGF beta RII-binding format are described in WO2005077042, the disclosure of which is incorporated herein by reference and forms part of the disclosure herein.

Additional examples of suitable albumin, fragments and analogs thereof for use in the TGF beta RII-binding format are described in WO 03076567, the disclosure of which is incorporated herein by reference and forms part of the disclosure herein.

(E. G., Albumin, transferrin and fragments and analogs thereof) are used to format the TGF beta RII-binding polypeptides, dAbs and antagonists of the present disclosure, the moiety may be any Can be conjugated by direct fusion to a TGF beta RII-binding moiety (e. G., An anti-TGF beta RII dAb) using, for example, a single nucleotide construct encoding a fusion protein, The fusion protein is encoded as a single polypeptide chain having a half-life extending moiety located at the N- or C-terminus of the TGF beta RII binding moiety. Alternatively, the conjugation can be accomplished using a peptide linker between the moieties, such as the peptide linker described in WO03076567 or WO2004003019 (the linker disclosure content is hereby incorporated by reference in its entirety for the purposes of this disclosure Which is incorporated herein by reference).

Bonding to PEG: In another embodiment, the half-life extending moiety is a polyethylene glycol moiety. In one embodiment, the antagonist is a single variable domain of this disclosure linked to a polyethylene glycol moiety (optionally, said moiety has a size of from about 20 to about 50 kDa, optionally a linear or branched PEG of about 40 kDa) (Optionally). For further details on the PEGylation of dAbs and binding moieties, see WO04081026. In one embodiment, the antagonist comprises a dAb monomer linked to a PEG, wherein the dAb monomer is a single variable domain according to the disclosure.

In another embodiment, a single variable domain, ligand or polypeptide according to the disclosure may be linked to a toxin moiety or toxin.

Protease Resistance: Single variable domains, polypeptides or ligands according to the disclosure may be modified to improve their resistance to protease degradation. As used herein, a peptide or polypeptide (e. G., Domain antibody (dAb)) that is "resistant to protease degradation" is not substantially degraded by the protease when incubated with the protease under conditions suitable for protease activity. The polypeptide (e. G., DAb) may be incubated with the protease at a temperature suitable for the protease activity, for example at 37 or 50 < 0 > C, for up to about 25%, up to about 20%, up to about 15% About 14%, about 13%, about 12%, about 11%, about 10%, about 9%, about 8%, about 7%, about 6%, about 5% 4% or less, about 3% or less, about 2% or less, about 1% or less of the protein is degraded by the protease, or substantially no protein is degraded. Proteolysis can be assessed by any suitable method, such as SDS-PAGE or by functional assays (e. G., Ligand binding) as described herein.

Methods for producing dAbs with improved protease resistance are described, for example, in WO2008149143. In one embodiment, a single variable domain, polypeptide or ligand according to the present disclosure is resistant to degradation by leukocytes and / or trypsin. The polypeptides, immunoglobulin single variable domains and ligands of this disclosure may be resistant to one or more of the following: serine protease, cysteine protease, aspartate protease, thiol protease, matrix metalloprotease, carboxypeptidase (For example, carboxypeptidase A, carboxypeptidase B), trypsin, chymotrypsin, pepsin, papain, elastase, leucozyme, pancreatin, thrombin, plasmin, cathepsin (For example, protease inhibitors), protease inhibitors (e.g., protease inhibitors), proteases (e.g., protease inhibitors), protease inhibitors , Caspase 1, caspase 2, caspase 4, caspase 5, caspase 9, caspase 12, caspase 13), chaffine, picaine, clostrifine, actinidase, bromelain, and Para. In certain embodiments, the protease is trypsin, elastase or leucozyme. Proteases can also be provided by biological extracts, biological homogenates or biological agents. The polypeptides, immunoglobulin single variable domains and ligands disclosed herein may be selected in the presence of the lung protease such that the polypeptide, the immunoglobulin single variable domain and the ligand are resistant to a lung protease. In one embodiment, the protease is a protease found in sputum, mucus (e.g., gastric mucus, runny nose, bronchial mucus), bronchoalveolar lavage fluid, lung homogenate, lung extract, pancreatic extract, gastric juice, saliva. In one embodiment, the protease is found in the eyes and / or tears. Examples of proteases found in the eye include but are not limited to caspase, choline, matrix metalloprotease, disintegrin, metalloproteinase (such as ADAM-disintegrin and metalloproteinase) and thrombospondin motif ADAM, proteosome, tissue plasminogen activator, secretase, cathepsin B and D, cystatin C, serine protease PRSS1, and ubiquitin proteasome pathway (UPP). In one embodiment, the protease is a non-bacterial protease. In one embodiment, the protease is an animal, e. G., A mammal, e. G., A human protease. In one embodiment, the protease is a GI tract protease or a lung tissue protease, for example, a GI tract protease or a lung tissue protease found in a human. The proteases listed herein can also be used in the methods described in, for example, WO2008149143, which involves exposing a repertoire of libraries to a protease.

Stability: In one aspect of this disclosure, the polypeptides, single variable domains, dAbs, ligands, compositions or formulations of this disclosure are incubated for 14 days at 37-50 ° C in Britton Robinson or PBS buffer 0.0 > mg / ml < / RTI > polypeptide or variable domain). In one embodiment, a polypeptide, antagonist, or variant of at least 65, 70, 75, 80, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, Domain etc. remain in the non-aggregated state after the incubation at 37 < 0 > C. In one embodiment, a polypeptide or variable domain of at least 65, 70, 75, 80, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, After incubation at 37 < 0 > C, it is held as a monomer.

In one embodiment, at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 91, 92, 93, 94, 95, 96, 97, 98, 99% of polypeptides, antagonists or variable domains remain unfused after incubation at 50 < 0 > C. In one embodiment, at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, Polypeptides or variable domains of 91, 92, 93, 94, 95, 96, 97, 98, 99% are maintained as monomers after incubation at 50 < 0 > C. In one embodiment, no aggregation of the polypeptide, variable domain, antagonist is observed after any one of the above incubations. In one embodiment, the pI of the polypeptide or variable domain is maintained unchanged or substantially unchanged after incubation at 37 [deg.] C with a concentration of 1 mg / ml polypeptide or variable domain in Britain-Robinson buffer. In one aspect of the disclosure, the polypeptide, variable domain, antagonist, composition or agent of the present disclosure is administered for 7 days in a Britton Robinson buffer at a pH of 7 to 7.5 (e.g., pH 7 or pH 7.5) After incubation (at a concentration of 100 mg / ml of polypeptide or variable domain) at 4 占 폚, it is substantially stable. In one embodiment, at least 95, 95.5, 96, 96.5, 97, 97.5, 98, 98.5, 99 or 99.5% of the polypeptide, antagonist or variable domain remains unfused after the incubation. In one embodiment, at least 95, 95.5, 96, 96.5, 97, 97.5, 98, 98.5, 99 or 99.5% of the polypeptide or variable domains are retained as monomers after the incubation. In one embodiment, no aggregation of the polypeptide, variable domain, antagonist is observed after any one of the above incubations.

In one aspect of the present disclosure, the polypeptides, variable domains, antagonists, compositions or formulations of the present disclosure may be administered in a jet nebulizer, for example a Pari LC + cup, for example at room temperature, (E.g., at a concentration of 40 mg / ml of the polypeptide or variable domain). In one embodiment, at least 65, 70, 75, 80, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 95.5, 96, 96.5, 97, 97.5, 98, 98.5, 99 or 99.5% of the polypeptide, antagonist or variable domain is maintained in the non-aggregated state after said fog. In one embodiment, at least 65, 70, 75, 80, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 95.5, 96, 96.5, 97, 97.5, 98, 98.5, 99 or 99.5% of the polypeptide or variable domains are retained as monomers after said fuming. In one embodiment, no aggregation of polypeptide, variable domain, antagonist is observed after any one of the above haze.

Monomeric form: In one embodiment, the dAbs of the present disclosure are identified primarily as monomers. Suitably, the disclosure provides (substantially) pure monomers. In one embodiment, the dAb is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% pure or 100% pure monomers. The dAb can be analyzed by SEC-MALLS to determine if it is a monomer or forms a higher order number of oligomers in solution. SEC MALLS (size exclusion chromatography using multi-angle laser light scattering) is a non-invasive technique for characterizing macromolecules in solutions familiar to any one of ordinary skill in the art. Briefly, the protein (at a concentration of 1 mg / mL in buffer Dulbecco's PBS) is separated according to its hydrodynamic properties by size exclusion chromatography (column: TSK3000; S200). After separation, the tendency of proteins to scatter light is measured using a multi-angle laser light scattering (MALLS) detector. The intensity of the scattered light while the protein passes through the detector is measured as a function of angle. Along with the protein concentration determined using a refractive index (RI) detector, the measurements allow calculation of the molar mass using a suitable equation (a component of the analytical software Astra v.5.3.4.12).

Therapeutic uses: The present disclosure provides methods for the treatment, inhibition or prevention of diseases associated with TGF beta signaling. In one embodiment, the disease can be caused or result from deregulated TGF beta signaling, overexpression of TGF beta, or a high level of bioavailable TGF beta. Diseases associated with TGF beta signaling include diseases associated with fibrosis of various tissues such as pulmonary fibrosis such as idiopathic pulmonary fibrosis (IPF) and other interstitial lung diseases such as acute respiratory distress syndrome (ARDS), liver cirrhosis and chronic hepatitis Such as fibrosis of the liver, scleroderma, rheumatoid arthritis, ocular disorders, vascular conditions such as restenosis, fibrosis of the skin such as keloid and scarring of the skin and scar formation and dufuktura, and kidneys such as nephritis, Vascular conditions such as restenosis. Other diseases associated with TGF beta signaling include vascular diseases such as hypertension, preeclampsia, hereditary hemorrhagic capillary dilation type I (HHT1), HHT2, pulmonary arterial hypertension, aortic aneurysm, Marfan's syndrome, familial aneurysm disorder, Syndrome, arterial torsion syndrome (ATS). Other diseases associated with TGF beta signaling include diseases of the musculoskeletal system such as duchyne muscular dystrophy and muscle fibrosis. Additional diseases associated with TGF beta signaling include cancer, such as colon, stomach and pancreatic cancer and glioma and NSCLC. The present disclosure also provides a method of targeting cancer, for example, by modulating TGF beta signaling in tumor angiogenesis or through the treatment of cancerous substrates. Other diseases or conditions include those associated with tissue scarring. Other diseases include, but are not limited to, pulmonary diseases such as COPD (chronic obstructive pulmonary disease), liver diseases such as kidney diseases including liver failure (e.g. viral hepatitis, alcohol, obesity, autoimmunity, metabolism, Diabetes, hypertension), hypertrophic cardiomyopathy, transplant rejection (lung / liver / kidney) and hypertrophic and keloid scarring.

"Fibrosis" is a result of excessive deposition of extracellular matrix components, such as collagen, which causes overgrowth, scarring and / or hardening of tissue.

"Dermatofibrosis": Dermatofibromas have different etiologies but include various human disorders with common dysregulation of connective tissue metabolism, especially dermal fibroblasts. Specific examples of dermatofibroma include keloid disease, hypertrophic scar (HS), and scleroderma. Although keloid disease and hypertrophic scars are not subgroups of the same condition, both are produced by scar formation after wound healing, and keloids spread beyond the original wound area, but the hypertrophic scar is limited within the original wound margin. However, it is used to describe skin fibrosis in systemic sclerosis, a systemic disease that causes fibrosis in many organs. In one embodiment, the variable domains, ligands, fusion proteins or polypeptides disclosed herein are used for the prevention or treatment of keloid disease, hypertrophic scarring or sclerosis.

"Keloid" is a fibrotic overgrowth at the site of skin damage that is formed as a result of an abnormal wound healing process in genetically vulnerable individuals, and does not regress unlike normal scarring. The "keloid disease", which is predominantly observed in patients with black pigmented skin, is a benign dermoid fibrotic tumor peculiar to humans that does not become absolutely malignant.

"Dukyutrang construction" is the localization of scar tissue under the skin of the palm. Scar formation is accumulated in the tissue (fascia) that normally grabs the finger to pull it to catch it. As Du Fuctral construction progresses, more and more fascia is thickened and shortened, causing the fingers to bend toward the palm of the hand and to be completely stretched (straightenable), resulting in a flexural constriction that makes the hand unusable in extreme cases.

Scar formation occurs after surgery, damage, or trauma to tissues or organs within the body. These are the result of a repair mechanism that creates an extracellular matrix to replace the missing normal tissue. Skin is the most frequently injured tissue that causes dermal scar formation and can cause adverse consequences including: loss of function; build; And poor aesthetics that can have a psychological impact on the sufferer. The scar can be defined as a visual disturbance of the normal structure and function of the skin structure due to the end product of wound healing (Fergusson et al., 1996). There is currently no therapies to effectively prevent or ameliorate scarring.

The role of TGF beta was observed in pulmonary fibrosis (Wynn et al., J. Pathology 2008, 214, p. 199-210); [Sime et al. J. Clinical Immunology 1997, Vol. -776]). Conversion to increased production of Th2 cytokines and decreased production of Th1 cytokines is observed as a result of unknown lung injury. Overexpression of TGF beta stimulates angiogenesis, fibroblast activation, deposition of ECM, and fibrosis. Animal models (eg, TGF beta overexpression, SMAD3 KO, inhibition of TGF beta R signaling) show that TGF beta is a key mediator for the development of pulmonary fibrosis.

"Idiopathic pulmonary fibrosis (IPF)" is a chronic and progressive disease that causes abnormal and excessive deposition of fibrotic tissue within the lung epilepsy of unknown etiology. Approximately 10-20 patients per 100,000 people develop in the United States each year. The prevalence increases rapidly with age, reaching 175 patients per 100,000 or more over the age of 75 years, and generally occurring between the ages of 50 and 70 years. The 5-year survival rate is 20% and the mean survival time is 2.8 years. Symptoms include dry cough and progressive dyspnea, abnormal chest X-ray or HRCT and reduced lung volume. Current therapies include corticosteroids (prednisone), immunosuppressants (cyclophosphamide) or implants, but no therapy currently available has been proven efficacious. In one embodiment, the single variable domains or polypeptides of the present disclosure provide therapeutic agents for IPF.

Suitably, successful treatment of idiopathic pulmonary fibrosis (IPF) is associated with decreased pulmonary fibroblast proliferation, increased pulmonary fibroblast apoptosis, excessive extracellular matrix synthesis and reduced deposition, increased extracellular matrix destruction and remodeling It will show some protection against progressive tissue damage and recovery of normal histopathology and any one of them.

Suitably, successful treatment will reduce the rate of disease progression.

Therapeutic efficacy against IPF can be demonstrated in a bleomycin-induced pulmonary fibrosis model. In one embodiment, the immunoglobulin single variable domain of the present disclosure cross-reacts with mouse TGF beta RII so that its efficacy can be tested in a mouse model.

TGF beta is an important cell signaling molecule in the regulation of cellular behavior in eye tissue. Overactivation of TGF-beta is implicated in the onset of fibrosis disease in the eye tissue, which is associated with wound healing and can cause tissue homeostasis and eye tissue homeostasis (see, for example, Saika, Laboratory Investigation (2006), 86 , 106-115).

Thus, in one embodiment, diseases associated with TGF beta signaling include ocular disorders, such as fibrotic disorders of the eye tissue. Fibrosis of the eye can occur in the cornea, conjunctiva, lens, or retina. Ocular disorders include but are not limited to proliferative vitreoretinopathy (PVR), disorders after retinal detachment and retinal fibrosis, diabetic retinopathy, glaucoma such as open angle glaucoma, right-sided occlusion, congenital and pseudo-exfoliation syndromes such as chemicals or heat Wound healing response of the lens after burn, or Stevens-Johnson syndrome, and post-cataract complications. TGF beta also has a function in cataractogenesis (Wormstone et al. Exp Eye Res; 83 1238-1245, 2006). Many ocular disorders occur as a result of fibrosis after surgery. In addition, excessive activity of TGF beta 2 (transforming growth factor beta 2) is thought to induce scar formation in and around the eye after glaucoma fistula surgery. TGF-beta2 is a predominant isotype associated with pathological scar formation in the tissues of the eye, including the cornea, retina, conjunctiva, and trabecular meshwork. Scar formation or fibrosis of the fibrous scar can cause the closure of the normal aqueous drainage pathway, leading to elevated intraocular pressure and risk of glaucoma. TGF-beta2 has been shown to be a pathological agent in a pre-clinical model of glaucoma disease. TGF beta 2 levels are elevated in glaucoma patients and in vitro treatment with TGF beta-2 of huTM cells induces phenotypic changes and upregulation of ECM-regulated proteins (MMP-2, PAI-I) (Lutjen- (2005), Biochemical and Biophysical Research Communications Vol. 337, issue 4, p. 1229-1236]; [Fuchshofer et al. (2005), Experimental Eye Research, Vol. 81, Issue 1, pages 1-4] (2003), Experimental Eye Research, Vol. 77, issue 6, p. 757-765]; [ARVO conference poster # 1631 2009]). In addition, overexpression of TGF-beta in the eye leads to glaucoma-like disease in mice (ARVO meeting # 5108 2009) and delivery of TGF beta-2 using AAV inhibits retinal ganglion cell loss in glaucoma rat models (ARVO meeting poster # 5510 2009). More recently, induction of oxidative stress in cultured human optic nerve head-like cells has been shown to increase TFG beta 2 secretion (Yu et al. (2009) Invest. Ophthalmol. Vis. Sci. 50: 1707-1717) ). All of these indicate that a decrease in TGF beta 2 levels can minimize the characteristic optic disc changes seen in glaucoma. However, TGF beta is also known to have an immunosuppressive function and thus may be protective in some respects, so that elevated levels of TGF beta 2 over complete knock down may be useful in the treatment of chronic eye conditions such as glaucoma Lt; / RTI > Thus, diseases that can be treated using dAbs, compositions, etc., in accordance with the present disclosure include scar formation after glaucoma fistula surgery.

Thus, in one aspect, there is provided a method of treating TGF beta signaling, particularly a TGF beta signaling pathway, comprising administering to a mammal in need thereof a therapeutically effective amount or amount of a polypeptide, fusion protein, single variable domain, antagonist or composition according to this disclosure. Methods for the treatment, inhibition or prevention of diseases associated with regulated TGF beta signaling are provided.

In yet another aspect, this disclosure provides an immunoglobulin single variable domain, polypeptide, ligand or fusion protein according to this disclosure for use as a medicament. Suitable medicaments may include an immunoglobulin single variable domain according to the disclosure formatted as described herein.

Suitably, the medicament is a pharmaceutical composition. In a further aspect of the disclosure there is provided a composition (e.g., a pharmaceutical composition) comprising a polypeptide, a single variable domain, a ligand, a composition or antagonist according to the disclosure and a physiologically or pharmaceutically acceptable carrier, diluent or excipient, / RTI > In one embodiment, the composition comprises a vehicle for delivery. In certain embodiments, the polypeptide, fusion protein, single variable domain, antagonist or composition is administered via pulmonary delivery, for example, by inhalation (e.g., by intratracheal, intranasal or oral inhalation, For example, by parenteral, intravenous, intramuscular, intraperitoneal, intraarterial, intrathecal, intraarticular, subcutaneous, intramuscular or rectal administration). In another embodiment, a polypeptide, single variable domain, ligand or fusion protein or composition according to the present disclosure is administered by topical administration, as an eye drop, as a particulate polymer system, as a gel or as an implant, or as a guide, ≪ / RTI > Transmission is targeted to a specific area of the eye, such as the surface of the eye, or to the fistula or lacrimal duct, or to the anterior or posterior of the eye, e.g., the vitreous body. It may also be useful that the immunoglobulin single variable domains, compositions, etc., are delivered to the eye with an ocular permeation enhancer such as sodium caprate or a viscosity enhancer such as hydroxypropylmethylcellulose (HPMC) . In a further embodiment, the polypeptide, fusion protein, single variable domain, antagonist or composition is administered to the skin by local delivery to the skin surface and / or delivery to the area (s) within the skin, e.

Although the most accessible organ of the body for delivery, the stratum corneum (SC), the outermost barrier of the skin, acts as a rate limiting barrier for drug delivery. Traditionally, intradermal injection was needed to avoid SC to allow delivery of the drug to the site of action in the deeper layers of the skin. However, delivery may be achieved through other transdermal delivery methods. Chemical enhancers that alter the lipid structure of SC; A peptide promoter that allows transport through the hair follicle; Encapsidation of particles including liposomes, niosomes, ethosomes and transfersomes which are believed to aid in the local fluidization of lipids and the formation of depots for extended effects (see, for example, RTI ID = 0.0 > encapsidation < / RTI > can be used for delivery. Ion migration, involving the application of small potentials across the skin, was used for topical drug delivery. Ion migration allows the transfer of charged and neutral molecules by electrophoresis and electroosmosis, respectively. By using microneedles to create micrometer-sized channels in the skin to overcome SC, proteins can pass through these channels to the epidermis. The microneedles can be broadly classified into hollow and hollow microneedles. Filled microneedles are used to disrupt the SC prior to drug administration and may be coated to deliver the drug as it dissolves from the needle, or it may be soluble to allow drug release while the needle is dissolved in place. The hollow microneedles allow injection of the liquid formulation of the drug substance. Unlike iontophoresis, electroporation requires a high voltage of> 50V to alter the skin permeability to improve drug penetration. The thermal and radio frequency ablation methods disrupt SC by local heating and ablation of the SC. In thermal ablation, disruption occurs after application of high temperatures for a short period of time, and high frequency excision involves the use of high frequencies to vibrate the microelectrode on the skin to cause localized fever. In addition, the collapse of the SC can be achieved through laser abrasion, application of low frequency ultrasound (ultrasonic wave), and jet injectors using high speed to propel the drug through the SC.

The disclosure also provides a method of treating a disease using a polypeptide, a single variable domain, a composition, a ligand or an antagonist according to the disclosure. In one embodiment, the disease is histiocytic fibrosis, such as keloid disease or Dukyury traumatic constriction.

In one aspect of the disclosure, a polypeptide, a single variable domain, a ligand, a composition or an antagonist is provided for the treatment and / or prevention of a disease or condition associated with TGF beta signaling in a human. In yet another aspect, there is provided the use of a polypeptide, a single variable domain, a composition or an antagonist in the manufacture of a medicament for the treatment or prevention of a disease or condition associated with TGF beta signaling in a human. In another aspect, there is provided a method of treating and / or preventing a disease or condition associated with TGF beta signaling in a human patient, comprising administering to the patient a polypeptide, single variable domain, composition or antagonist. The present disclosure also relates to a method of treatment comprising administering to a subject in need thereof a therapeutically effective amount of a ligand (e. G., An antagonist, or a single variable domain) of the subject disclosure.

In another embodiment, this disclosure is directed to a method of treating idiopathic pulmonary fibrosis comprising administering to a subject in need thereof a therapeutically effective amount of a ligand (e. G., An antagonist, or a single variable domain) of the subject disclosure .

The present disclosure also relates to a drug delivery device comprising a composition of the present disclosure (e. G., A pharmaceutical composition). In some embodiments, the drug delivery device comprises a plurality of therapeutically effective doses of a ligand.

In another embodiment, the drug delivery device may be a parenteral delivery device, an intravenous delivery device, an intramuscular delivery device, an intraperitoneal delivery device, a transdermal or intradermal delivery device, a pulmonary delivery device, an intraarterial delivery device, An intradermal device, an intradermal device, a capsule, a tablet, a fogging device, an inhaler, an atomizer, an aerosolizing device (for example, an intramuscular injection device, an intravenous injection device, a subcutaneous delivery device, an aerosolizer, a mister, a dry powder inhaler, a metered dose inhaler, a metered dose sprayer, a metered dose mister, a metered dose atomiser, and a catheter. In one embodiment, the drug delivery device is a transdermal or intradermal device.

Suitably, the disclosure provides a pulmonary delivery device comprising a polypeptide, a single variable domain, a composition or an antagonist according to the present disclosure. The device may be an inhaler or intranasal administration device. Suitably, the use of a pulmonary delivery device may deliver a ligand or the like according to this disclosure of a therapeutically effective dose.

In another embodiment, the disclosure provides an eye delivery device comprising a polypeptide, a single variable domain, a composition or an antagonist according to the present disclosure. Suitably, a ligand or the like according to the present disclosure of a therapeutically effective dose can be delivered by using an eye delivery device.

As used herein, the term "dose" means the amount of ligand administered to a subject at one time (unit dose), or two or more administrations over a defined time interval. For example, the dose may be administered orally or parenterally (e.g., by single administration, or by two or more administrations) for a period of 1 day (24 hours) (daily dose), 2 days, 1 week, 2 weeks, (E. G., A ligand comprising an immunoglobulin single variable domain that binds to TGF beta RII) that is administered to a subject throughout the course of a) < / RTI > The interval between capacities can be any desired amount of time. In certain embodiments, the single variable domains or polypeptides of the invention are administered by injection every week or every two weeks or every 7-10 days, e.g. every 7, 8, 9 or 10 days, especially by intradermal delivery do.

In one embodiment, the single variable domain of the present disclosure is a dAb monomer optionally arbitrarily unformatted (e. G., Not PEGylated or not extended half-life) or linked to PEG, optionally as a dry powder formulation, optionally in a patient by inhalation For the treatment and / or prevention of pulmonary conditions (e. G., Idiopathic pulmonary fibrosis), for the delivery of pulmonary fibrosis (e.

The ligands of this disclosure provide several advantages. For example, as described herein, a ligand can be tailored to have the desired in vivo serum half-life. Domain antibodies are much smaller than conventional antibodies and can be administered to achieve better tissue permeability than conventional antibodies. Thus, ligands comprising dAbs and dAbs provide advantages over conventional antibodies when administered to treat diseases such as TGF beta-signal transduction-mediated diseases. In particular, the pulmonary delivery of the dAbs of this disclosure for the treatment of idiopathic pulmonary fibrosis enables the specific local delivery of inhibitors of TGF beta signaling. Advantageously, the unformatted dAb monomer that specifically binds and inhibits TGF beta RII is small enough to be absorbed into the lung via pulmonary delivery.

Examples of WO2007085815 are incorporated herein by reference to provide details of relevant assays, formatting and experiments that may equally be applied to the ligands of this disclosure.

All publications, including but not limited to the patents and patent applications mentioned in this specification, are hereby incorporated by reference in their entirety as if fully set forth.

This application is further described in the following examples for purposes of illustration only.

Example

Example  One. TGF beta RII Coupled to dAb Choice of

mouse TGF beta RII Coupled to dAb Choice of

Naïve selection : 4G and 6G naive phage libraries were used, displaying the antibody single variable domains expressed from the GAS1 leader sequence (see WO2005093074) for 4G and additionally the heating / cooling preliminary selection (see WO04101790) for 6G . The DOM23 lead was used for the VH and VK libraries (4G H11-19 and 6G VH2-4 (VH dAb) and 4G kappa, 4G kappa2 and 6G kappa (V kappa) for the recombinant mouse and human TGF- beta RII / Fc chimeric protein dAb) was isolated by panning. These chimeric proteins are encoded by amino acid residues 24 to 159 of the extracellular domain of human TGF-beta receptor type II fused to the Fc region of human IgGl in human embryonic kidney cell line HEK-F (Lin et al., 1992, Cell 68: 775-785). ≪ / RTI >

Recombinant mice and human TGF-? RII / Fc chimeric proteins were biotinylated using EZ-LINK ™ Sulfo-NHS-LC-Biotin reagent (Pierce, Rockford, USA) (Henderikx, et al. , 2002, Selection of antibodies against biotinylated antigens. Antibody Phage Display: Methods and protocols, Ed. O'Brien and Atkin, Humana Press. The phage library was collected into six groups; 4G κ1 and κ2, 6G κ, 4G H11-13, 4G H14-16, 4G H17-19 and 6G VH2-4. We have collected 1x10 ¹¹ phage per library.

The phage were resuspended in 2% saline in phosphate buffered saline with the addition of 10 [mu] M human IgG Fc fragment (native IgG Fc fragment from human myeloma plasma IgG, Calbiochem, CA, cat. No. 401104) And blocked in MARVEL (TM) powdered milk (MPBS). 200 nM biotinylated mouse TGF-? RII / Fc was incubated with blocked phage and Fc fragment mixtures for 1 hour at room temperature before streptavidin dinabeads (Dynal, UK) ≪ / RTI > for 5 minutes. The beads were washed 7 times with 1 ml phosphate buffered saline / 0.1% Tween ™ (PBST) and then washed with 1 ml phosphate buffered saline (PBS). The biotinylated mouse TGF- [beta] RII / Fc-conjugated phage was eluted in 500 [mu] l 1 mg / ml trypsin in PBS for 10 min and then treated with 1.75 ml algebraic propagator Escherichia coli TG1 . ≪ / RTI > Cells were plated on 2 x TYE (tryptone yeast extract) agar plates supplemented with 15 ug / ml tetracycline. For subsequent rounds of selection, cells were scraped from the plate and used to inoculate 50 ml 2 x TY (tryptone yeast) + 15 ug / ml tetracycline culture grown at 37 ° C overnight for phage amplification.

The culture was centrifuged overnight at 4566 g for 10 minutes to recover the amplified phage. 40 ml of the supernatant containing the amplified phage was added to 10 ml of PEG / NaCl (20% v / w PEG 8000 + 2.5 M NaCl) and incubated on ice for 45-60 minutes. The sample was centrifuged at 4566 g for 30 minutes to pellet the precipitated phage. The supernatant was discarded and the phage pellet resuspended in 2 ml 15% v / v glycerol / PBS. The phage sample was transferred to a 2 ml Eppendorf tube and centrifuged at g for 10 minutes to remove any remaining bacterial cell debris. The phage was used as the input phage for the second round of selection. The second round of selection was performed as described for the first round except that approximately 1 x 10 ¹⁰ phages were added and 200 nM human TGF-β RII / Fc or 20 nM mouse TGF-β RII / Fc was used in the selection Respectively.

The result of the second round was cloned from the fd-phage vector pDOM4 into pDOM10. The vector pDOM4 is a derivative of the fd phage vector in which the gene III signal peptide sequence has been replaced with a yeast glycolipid anchored surface protein (GAS) signal peptide. It also contains a c-myc tag between the leader sequence and gene III, which again places the gene III back in frame. The leader sequence functions not only in the phage display vector but also in other prokaryotic expression vectors and can be used universally. pDOM10 is a plasmid vector designed for solubility expression of dAb. It is based on the pUC119 vector and is expressed under the control of the LacZ promoter. Expression of the dAb into the supernatant was ensured by fusion to the universal GAS leader signal peptide (see WO2005093074) of the dAb gene at the N-terminal end. In addition, the FLAG-tag was added to the C-terminal end of the dAb.

Using a QIAPREP ™ Spin MINIPREP ™ kit according to the manufacturer's instructions (Cat. No. 27104, Qiagen), cells were infected from fd-phage displaying the selected dAb Subcloning of the dAb gene was performed by isolating pDOM4 DNA. DNA was amplified by PCR using biotinylated oligonucleotides DOM57 (5'TTGCAGGCGTGGCAACAGCG-3 '(SEQ ID NO: 197) and DOM6 (5'-CACGACGTTGTAAAACGACGGCC-3' (SEQ ID NO: 198)), and SalI and NotI restriction endonucleases The ligated product was transformed into E. coli HB2151 cells by electroporation and the TYE plate supplemented with 100 [mu] g / ml carbenicillin (tryptone yeast < RTI ID = 0.0 > (TYE-carb). Individual clones were selected and expressed in overnight-expressing autologous-inducing medium (high-level protein expression system, Novagen, Novagen) supplemented with 100 ug / ml carbenicillin in 96- ) And grown with shaking at 30 DEG C or 37 DEG C. These expression plates were then centrifuged at 1800 g for 10 minutes. [0154] The dAb clones bound to the mouse and / or human TGF- [beta] RII / Fc were analyzed by ELISA And (By GE Healthcare) screen or by MSD (Meso Scale Discovery) conjugated black screen. For ELISA, a 96-well Maxisorp ™ Immunoplate (Nunc, Denmark) was coated with human or mouse TGF-β RII / Fc overnight at 4 ° C. Wells were washed three times with PBST followed by 1 hour Tween ™ (1% TPBS) in PBS for 1 hour The blocking was removed and a 1: 1 mixture of 1% TPBS and dAb supernatant was added for 1 hour at room temperature The plates were washed three times with PBST and incubated with detection antibody (monoclonal anti-FLAG M2 The plates were incubated with a colorimetric substrate (SUREBLUE ™ 1-component TMB microwell peroxidase solution (Sigma-Aldrich, UK)) and incubated for 1 hour at room temperature. , KPL, Maryland, USA) And was measured for optical density (OD) at 450 nM, OD ₄₅₀ is proportional to the amount of bound detection antibody. For Biacore (TM), the supernatant was diluted 1: 1 in HBS-EP buffer, and the binding to biotinylated human and mouse TGF- [beta] RII / Fc was measured using Biacore ™ Screened with Biacore (TM), GlyHealthCare (TM) coated with oitinylated hRII-Fc and 1550 Ru biotinylated mRII-Fc). The sample was transferred in Biacore (TM) at a flow rate of 50 l / min.

Naive  Human selection and screening

human TGF beta RII Coupled to dAb Choice of

Naive selection was performed as described for murine TGFbRII, except that 150 and 15 nM biotinylated human TGFbRII / Fc were used in rounds 1 and 2, respectively. The third round was performed using the same method as for round 2, except that 1.5 nM biotinylated human TGFbRII / Fc was used.

The result of the third round was cloned from the fd-phage vector pDOM4 into pDOM10. Subcloning of the dAb gene by isolating pDOM4 DNA from cells infected by fd-phage displaying the selected dAb using the quiaprept ™ spin miniprep ™ kit according to the manufacturer's instructions (Cat. No. 27104, quiagen) Respectively. Plasmised DNA was digested with SalI and NotI restriction endonucleases, and the dAb gene insert was ligated with pDOM10 digested with SalI, NotI, and PstI restriction endonuclease. The ligation products were subjected to electroporation. Transformed into E.coli HB2151 cells and plated on TYE plates (Trypton yeast extract) (TYE-carb) supplemented with 100 g / ml carbenicillin. Individual clones were selected and expressed in 96-well plates overnight at 30 rpm at 250 rpm, 1 ml / well in expressing autologous-derived medium (Novagen) supplemented with 100 ug / ml carbenicillin. These plates were then centrifuged at 1800 g for 10 minutes. Soluble dAb supernatants were screened for antigen binding by TGFbRII MSD binding assay combined with fluorescence polarization determination assays. The number of human TGFbRII binders was high and there were too many clones to proceed with further characterization. Thus, the sequence of a subset of clones was determined and further characterized as having a unique sequence.

TGFBRII MSD  Binding assay

The assays were used to determine binding activity of anti-TGFbRII dAbs. The TGFbRII-Fc antigen was coated onto the MSD plate and then blocked to prevent non-specific binding. Continuous diluted supernatant containing soluble FLAG-tagged dAb was added. After incubation, the plate was washed and only the dAbs specifically bound to TGFBRII-Fc were retained bound to the plate. The bound dAbs were detected with rutellinylated anti-FLAG tagged antibody and MSD read buffer. The concentration of the dAb in the supernatant dilution was determined using the fluorescence polarization concentration determination assay, and then the concentration binding curve was generated.

(R & D Systems, Cat. # 110-HG) was inoculated into 384 well MSD high binding plates (Mesoscale) in the presence of 0.5 [mu] l / well of 60 [mu] g / ml human TGFbRII-Fc, 60 [mu] g / ml mouse TGFbRII- Discovery). The plates were air-dried at room temperature for a minimum of 4 hours to a maximum of overnight. Plates were blocked with 50 μl / well of 5% Marbles ™ + 0.1% Tween ™ 20 in Tris buffered saline (TBS) for 1 hour at room temperature or overnight at 4 ° C. The blocking reagent was gently shaken off the plate and removed from the wells. A 1: 3 dilution of dAb supernatant was prepared in 2xTY medium. The dAb was expressed in the pDOM10 expression vector and the dAb protein was expressed as the FLAG fusion protein. The blocking reagent was removed and 10 [mu] l / well of diluted dAb supernatant was transferred to the blocked MSD plate. The dAb supernatant was screened as a 4-point curve or an 11-point curve. In addition to the diluted dAb supernatant, two controls were included in each plate, one was a low control (normalized to 0% binding) lacking TGFbRII binding specificity and the other was a high control (< RTI ID = 0.0 > 100% < / RTI > bond) (data not shown).

Plates were incubated with dAb supernatant and control samples for 1 hour at room temperature and then washed three times with 50 μl / well of TBS + 0.1% Tween ™. 15 [mu] l / well ruthenylated anti-FLAG antibody was added to the plate and incubated for 1 hour at room temperature. Bacteriophage N-acetyl-L-glutamic acid was prepared from ruthenium II tris-bipyridine N-monoclonal antibody according to the manufacturer's instructions (Mesoscale Discovery, catalog number R91BN-1) using an anti-FLAG antibody (anti- FLAG M2 monoclonal antibody, Sigma Lt; RTI ID = 0.0 > hydroxysuccinimide. ≪ / RTI > Rutanylated anti-FLAG antibodies were added to all wells except mouse anti-human IgG1 Fc antibody control wells. Instead, 15 [mu] l / well of anti-mouse MSD tag (Mesoscale Discovery, catalog number R31AC-1) was added. The anti-mouse MSD tag was diluted to a final concentration of 750 ng / ml in 2% Marbles ™ + 0.1% Tween ™ 20 in TBS. Plates were incubated for 1 hour at room temperature and washed three times with 50 [mu] l / well TBS + 0.1% Tween ™. 35 [mu] l 1x MSD read buffer (Mesoscale Discovery) was added to each well and the plate read on a MSD Sector 6000 reader (Mesoscale Discovery).

The data was analyzed using the XC50 Activity Base. All data were normalized to the mean of the high and low control wells for each plate, the low control was normalized to 0% bond and the high control was normalized to 100% bond. Four parameter curve pits were applied to the normalized data, and concentration conjugation curves were generated using dAb concentrations calculated using fluorescence polarization concentration determination of dAb in supernatant assays.

The four parameter feet used were:

y = {(ad) / [1+ (x / c) ^b ]} + d

Where a is the minimum, b is the Hill slope, c is XC50, and d is the maximum.

Supernatant  In black dAb Of fluorescence polarization

By this assay, the concentration of soluble FLAG-tagged dAb expressed in the supernatant can be determined. Fluorescently labeled-FLAG peptide was mixed with anti-FLAG antibody. The fluorescent molecule was excited with the polarized light at a wavelength of 531 nm and the emitted polarized light was read at a wavelength of 595 nm. Addition of the FLAG-tagged dAb resulted in the replacement of the fluorescent peptide from the anti-FLAG antibody, which again reduced the polarization of the emitted signal. Standard curves of purified FLAG-tagged VH dummy dAbs at known concentrations were made and used to inversely calculate the concentration of soluble dAbs in the supernatant. Concentration data were combined with binding activity data and concentration binding curves were generated for the dAb supernatant.

The dAb supernatant was serially diluted 1: 2, 1: 4, 1: 8 and 1:16 in 2xTY medium, followed by 1:10 dilution in phosphate buffered saline (PBS). The diluted supernatant was transferred to a black 384 well plate. Standard curves were generated by serial dilution of the purified VH dummy dAb to 1: 1.7 in 10% v / v 2xTY medium in PBS. The highest dAb concentration was 10 μM, and a total of 16 dilutions were present. 5 [mu] l of each dilution was transferred to a 384 well plate. A mixture of 5 nM FLAG peptide labeled with Cy3b at the c-terminus, 100 mM anti-FLAG M2 monoclonal antibody (Sigma, catalog number F3165), 0.4 mg / ml bovine serum albumin (BSA) in 2 mM CHAPs buffer Respectively. 5 [mu] l of the mixture was transferred into wells (both supernatant and standard curve wells) in the presence of diluted dAb. Plates were centrifuged at 1000 rpm (216 g) for 1 minute and then incubated in the dark for 15 minutes at room temperature. The plate was read with an ENVISION ™ reader (Perkin Elmer) equipped with the following filters:

Here is the filter: BODIPY TMR FP 531

Emission filter 1: BODIPY TMR FP P pol 595

Emission filter 2: BODIPY TMR FP P pol 595

Mirror: BODIPY TMR FP Dual Enh

A standard curve was created and used to inversely calculate the concentration of soluble dAb in the supernatant.

Mouse and human TGF- [beta] RII / Fc-conjugated dAbs identified in ELISA, Biacore (TM) and MSD binding assays were expressed at 30 ° C for 48-72 hours overnight in expression autoradiogenic medium (Onex ™, Norvagen). The culture was centrifuged (4,600 rpm for 30 minutes) and the supernatant was transferred to a STREAMLINE ™ -protein A bead (Amersham Biosciences, Ziehl Healthcare ™, UK, binding capacity: 5 mg ml of dAb / bead) at 4 [deg.] C overnight or at room temperature for at least 1 hour. The beaded chromatography column was filled and washed with 1x or 2x PBS, followed by 10 or 100 mM Tris-HCl pH 7.4 (Sigma, UK). The bound dAb was eluted with 0.1 M glycine-HCl pH 2.0 and neutralized with 1 M Tris pH 8.0. The OD at 280 nm of the dAb was measured and the protein concentration was determined using the extinction coefficient calculated from the amino acid composition of dAb.

The amino acid and nucleic acid sequences of anti-human and anti-murine TGFRII dAb nb rides are presented below.

The CDRs defined by the Kabat of the anti-human and anti-murine TGFRII dAb nb rides are shown in Tables 1 and 2 below, respectively.

Example  2. DSC  (Differential scanning calorimetry) - Naive  Clone

The thermal stability of the dAb was determined using differential scanning calorimetry (DSC). The dAb was dialyzed overnight in PBS to a final concentration of 1 mg / ml. Dialysis buffer was used as a reference for all samples. DSC measurements were performed at a heating rate of 180 ° C / hour using a JiSelfCare ™ -MICROCAL ™ VP-DSC capillary cell microthermal analyzer. A typical scan range was 20-90 ° C for both the reference buffer and the protein sample. Under these experimental conditions, re-scans were performed each time to assess the degree of protein refolding. After each protein sample scan, the capillary cells were washed with a solution of 5% DECON (TM) (Fisher-Scientific) in water and PBS scans were performed. The resulting data traces were analyzed using Origin 7.0 software. The DSC trace from the reference buffer scan was subtracted from the protein sample scan. The exact molar concentration of the protein sample was entered into a data analysis routine to obtain values for the melting temperature (Tm), enthalpy (? H) and Van't Hoff enthalpy (? Hv) values. The data was fitted to the non-two-state model (N2M). The best fit was obtained using 1 or 2 transition events. The Tm value obtained for the dAb described herein is 52.1 캜 to 73.3 캜. The Tm values and the percentage of refolding are shown in Table 3.

All molecules maintain a tertiary structure to at least 52 캜 when heated.

Example  3. SEC - MALS  ( Angle - LASER - Size exclusion chromatography with light scattering) - Naive clone

They were analyzed by SEC-MALLS (size exclusion chromatography with polygon-LASER-light scattering) to determine if the dAb forms higher oligomers than in the monomer in solution. An Agilent 1100 series HPLC system equipped with an autosampler and UV detector (controlled by Empower software) was used with a Wyatt Mini Dawn Treos (LS) detector and Wyatt Mini- And connected to Optilab rEX DRI (Differential Refractive Index (RI) detector). The detector was connected in the following order: -UV-LS-RI. Both RI and LS instruments operate at a wavelength of 658 nm; UV signals were monitored at 280 nm and 220 nm. Domain antibodies (100 microliters injection at a concentration of 1 mg / mL in PBS) were separated according to their hydrodynamic characteristics by size exclusion chromatography using a JiHealthcare 占 10/300 Superdex 75 column. The mobile phase was PBS + 10% ethanol. The intensity of scattered light was measured as a function of angle while the protein passed through the detector. The measurements along with the protein concentration determined using the RI detector allowed the calculation of the molar mass using a suitable equation (a component of the analytical software Astra v.5.3.4.14). The monomer content of all dAbs described herein is from 65% to 98%. The data are presented in Table 4.

The molecules listed in Tables 3 and 4 were selected based on the solution state (propensity to monomer) content and thermal stability. All molecules exhibit a tendency toward more than 65% of monomers and maintain a tertiary structure up to at least 52 캜 upon heating.

Example  4. TGF beta RII  Black against inhibition ( Naive  Clone)

MC3T3 - E1 Luciferase  Black - Method m1:

The MC3T3-E1 luciferase assay measures the ability of dAbs to inhibit TGF [beta] -induced expression of CAGA-luciferase in MC3T3-E1 cells. Three copies of the TGF beta -reactive sequence motif, termed CAGA box, are present in the human PAI-I promoter and specifically bind to Smad3 and 4 proteins. Cloning multiple copies of the CAGA box into a Luciferase reporter construct gives the transfected system TGFβ reactivity to the transfected cells. This assay uses MC3T3-E1 cells (mouse osteoblasts) stably transfected with the [CAGA] ₁₂ -luciferase reporter construct (Dennler, et al., (1998) EMBO J. 17, 3091-3100) ).

Soluble dAbs were tested for their ability to block TGF-? 1 signaling through the Smad3 / 4 pathway.

The protocol used to generate the data indicated as method m1 in Table 5 is as follows. Briefly, 2.5 x 10 ⁴ MC3T3-cells in a black medium (RPMI medium (Gibco, Invitrogen Ltd, Paisley, England), 10% heat-inactivated Tasso serum, and 1% penicillin / streptomycin) E1 cells / well were added to tissue culture 96-well plates (nanks) and then dAb and TGF-? 1 (final concentration 1 ng / ml) were added and incubated for 6 hours at 37 ° C, 5% CO ₂ . (Promega, UK) was added to the wells, incubated at room temperature for 2 minutes to dissolve the cells, and the resulting luminescence was detected in the luminescent system Respectively.

The assays were run several times to obtain the mean and range of the% inhibition% values, which are summarized in Table 5. The above method has been modified and described below.

Deformed MC3T3 - E1 Luciferase  Black - Method m2:

MC3T3-E1 cells were cultured in "plating medium" (MEM-alpha + ribonucleoside + deoxyribonucleoside (Invitrogen 22571), 5% activated carbon stripped FCS (Perbio Sciences UK Stock (SH30068.03), 1/100 of sodium pyruvate (Invitrogen 11360), 1.25 x (1 ml) in a 96 well plate (nk 13610) in 250 ug / ml of geneticin 50 mg / ml (Invitrogen, 10131027) 10 ⁴ / well and incubated overnight at 37 ° C, 5% CO _{2. The} medium was replaced from the cells by "black medium" (DMEM (Invitrogen 31966021) 25 mM Hepes (Invitrogen) (R & D, 240B) was added to 4x EC 80. The plates were incubated for 6 hours at 37 ° C in 5% CO ₂ STEADYLITE ™ Luciferase reagent (Perkin Elmer 6016987) was added to the wells High, was measured on a plate reader immersion ™ incubator, and the resulting light emitting Envy is at room temperature for 30 minutes.

Each dAb was titrated double in the assay and the% inhibition was determined (n = 2). The assays were run several times to obtain the mean and range of the% inhibition% values, which are summarized in Table 5. Test QC parameters were matched; In-house small molecules show IC50 ranging from 100 to 900 nM for mouse assay. In addition, the robust Z factor was greater than 0.4 and the TGF-β EC80 was within six times the concentration added to the assay.

A549 IL- 11 release assay - h1 :

The A549 interleukin-11 (IL-11) release assay measures the ability of dAbs to inhibit human TGF-? 1 stimulated IL-11 release from A549 cells. TGF-β1 binds directly to TGF-βRII and induces association of the TGF-βRI / II complex. TGF-? RI is phosphorylated and is capable of signaling through several pathways, including the Smad4 pathway. Activation of the Smad4 pathway results in the release of IL-11. IL-11 is secreted into the cellular supernatant and is therefore measured by colorimetric ELISA.

Soluble dAbs were tested for their ability to block TGF-? 1 signaling through the Smad4 pathway. Briefly, "black medium" (DMEM high glucose medium (Gibco TM, Invitrogen EL, USA Paisley), 10% heat inactivated TaSo serum (PAA, Austria), 10 mM HEPES (Final concentration 3 ng / ml) (R & D Systems, UK) was added to tissue culture 96 well plates (nank) after addition of 1 x 10 < ⁵ > A549 cells / well in Triticum annuum / Penicillin / Streptomycin (PAA, Abingdon) was added and incubated at 37 [deg.] C, 5% CO ₂ overnight. The dAb was dialyzed into PBS and assayed. The concentration of IL-11 released into the supernatant was measured using human IL-11 DUOSET ™ (R & D Systems, Abingdon, UK) according to the manufacturer's instructions.

The A549 IL-11 release assay is referred to in Table 5 and 6 as assay method h1. The assays were run several times to obtain the mean and range of the% inhibition% values, which are summarized in Table 5. Test QC parameters were matched; The in-house small molecule shows an IC50 range of 50 to 500 nM for human assays.

SBE - bla HEK 293T cell sensor test - h2 :

Members of the Smad family of signaling molecules are components of intracellular pathways that transport the TGF-β signal from the cell surface to the nucleus. TGF-β1 binds directly to TGF-II and induces association of the TGF-βRI / II complex. Smad2 and Smad3 are then phosphorylated by TGF-? RI and subsequently form a heteromeric complex with the co-SMAD family member Smad4. These complexes translocate to the nucleus, where they bind to DNA and regulate gene transcription.

Cell Sensor SBE-bla HEK 293T cells contain the beta-lactamase reporter gene under the control of the Smad binding element (SBE), which is stably integrated into HEK 293T cells (Invitrogen, UK). The cells are reactive to TGF-? I and can be used to detect agonists / antagonists of the Smad2 / 3 signaling pathway.

Soluble dAbs were tested for their ability to block TGF-? 1 signaling through the pathway according to the following method based on the optimized method of Invitrogen, UK (cell line K1108).

Growth medium (DMEM high glucose, Invitrogen 21068028, 10% dialysed US FBS (Invitrogen 26400-044), 0.1 mM (1/100) non-essential amino acids (Invitrogen 11140-050), 25 mM (1/40) The cells were incubated with HEPES buffer (Sigma H0887), 1 mM (1/100) sodium pyruvate (Invitrogen 11360-070), 1% GLUTAMAX ™ (200 mM Invitrogen 35050038), 5 μg / ml blasticidin (Invitrogen R21001)) and subjected to direct assay from in-house frozen (at 4x10 ⁷ / ml) frozen cells. Cells were plated at 20,000 cells / well in cell culture plates (Costar 3712) in plating medium (containing 1% FCS and without blasticidin). After incubating the cells overnight, the purified dAbs were diluted in "black medium" (DMEM (Invitrogen 31966021), 25 mM Hepes (Invitrogen)) and added to the cells at 4 × final assay concentration. After 1 hour incubation at 37 DEG C, TGF-beta (R & D Systems; 240B) was added to 4x EC80 and incubated for an additional 5 hours. A LIVEBLAZER ™ substrate (Invitrogen K1030) was prepared according to the manufacturer's instructions and added in 8x volume. Plates were incubated in cows at room temperature for 16 hours and read on an Envision ™ plate reader according to the Invitrogen protocol.

The SBE-bla HEK cell sensor (CELLSENSOR) assay is referred to in Table 5 and 6 as method h2. Each dAb was titrated doubly in assay, IC50 was determined and the% inhibition was determined (n = 2). Only the inhibition% is mentioned in Table 5, since it is difficult to obtain the whole curve in the mouse assay. The assay was performed several times to obtain the mean and range of values, which are summarized in Tables 5 and 6. < tb > < TABLE > The arithmetic mean IC50 was calculated using pIC50 (IC50 - log), and the range was calculated by adding log standard deviation from the average pIC50 and subtracting it, then inverse transforming it to IC50. Test QC parameters were matched; The in-house small molecule shows an IC50 range of 50 to 500 nM for human assays. In addition, the robust Z factor was greater than 0.4 and the TGF-β EC80 was within six times the concentration added to the assay.

The results are shown in Tables 5 and 6.

The mouse clones were selected based on the appearance of more than 40% neutralization of TGF-β in some assays. The only exception to this was DOM23m-72. The clone also showed excellent neutralization curves (data not shown). Human clones were selected on the basis that the average IC50 was less than 15 [mu] M.

Example  5. Naive  Clone ( Example  1) from the real Error Prone ) Affinity mature

Mutation-induced mutagenesis was performed to improve the affinity of the identified dAbs as activities with appropriate biochemical characteristics (as described above).

Generation of the phage library: Real-generated libraries of DOM23h-843, DOM23h-850, DOM23h-854, DOM23h-855, DOM23h-865, DOM23h-866, DOM23h-874, DOM23h-883, DOM23h-439 and DOM23h- Were prepared using GENEMORPH ™ II random mutagenesis kit (Stratagene, Cat No 200550). The target dAb gene was amplified by PCR using Taq DNA polymerase and oligonucleotide DOM008 (5'-AGCGGATAACAATTTCACACAGGA-3 '(SEQ ID NO: 185)) and DOM009 (5'-CGCCAGGGTTTTCCCAGTCACGAC-3' (SEQ ID NO: 186) After amplification, the diluted PCR product was digested with oligonucleotides DOM172 (5'-TTGCAGGCGTGGCAACAGCG-3 '(SEQ ID NO: 187)) and DOM173 (5'-CACGACGTTGTAAAACGACGGCC- And re-amplified using DNA polymerase. The PCR product was further amplified using Taq DNA polymerase and oligonucleotides DOM172 and DOM173 to increase the yield of DNA product. The PCR product was digested with Sal I and Not I restriction endonuclease. The undigested product and digested ends were removed from the digested product using streptavidin beads (Dynal Biotech, UK). For anti-human error induction selection, the digested product is ligated into pDOM4 phage vector digested with Sal I and Not I restriction endonuclease. E. coli TB1 cells were used for transformation. Transformed cells were plated on 2xTY agar plates supplemented with 15 [mu] g / ml tetracycline to obtain library sizes of > 1x10 < ^{7 >} transformants.

Human TGF beta RII specific dAb real selection: DOM23h-843, DOM23h-850, DOM23h-854, DOM23h-855, DOM23h-865, DOM23h-866, DOM23h-874, DOM23h-883, DOM23h- Three rounds of selection were performed using the 439 library. Round 1 was performed using 1 nM biotinylated human TGF beta RII / Fc (N13241-57). Two different methods were followed for rounds 2 and 3: Method 1 used an antigen of the dimeric TGF beta RII / Fc form, and Method 2 used a soluble monomeric form of TGF beta RII. Method 1: Round 2 was performed using 1 nM biotinylated human TGF beta RII / Fc with 1 [mu] M non-biotinylated human TGF beta RII / Fc competitor. Round 3 was performed using 100 pM biotinylated human TGF beta RII / Fc with 1 [mu] M non-biotinylated human TGF beta RII / Fc (N12717-4). Method 2: Round 2 was performed using 1 nM biotinylated human TGF beta RII with 1 [mu] M non-biotinylated human TGF beta RII competitor. Round 3 was performed using 100 pM biotinylated human TGF beta RII with 1 [mu] M non-biotinylated human TGF beta RII competitor.

The second and third round selection results were subcloned into the pDOM13 vector as described above. Individual clones were selected and expressed at 0.5 ml / well in expression overnight self-inducing medium supplemented with 100 [mu] g / ml carbenicillin for 24 hours at 850 rpm, 37 [deg.] C, 90% humidity in 96-well plates. The plate was then centrifuged at 1800 g for 10 minutes. The supernatants were diluted 1/5 or 1/2 in HBS-EP buffer and biotinylated for binding to biotinylated human TGF-? RII / Fc Biacore ™ (according to the manufacturer's recommendations 1000 Ru biotinylated (SAIC chip coated with hRII-Fc) (Biacore (TM), GlyHealthCare (TM)). The sample was transferred on Biacore (TM) at a flow rate of 50 l / min. Bound clones, with high numbers of resonance units (RU) and / or with an improved off-rate compared to the mock clones, were expressed in 50 ml overnight overnight expression autologous induction medium at 30 ° C for 48-72 hours, And centrifuged at 4,600 rpm for 30 minutes. The supernatant was incubated with the stream line-protein beads overnight at 4 ° C. The beaded drip column was then filled and washed with 5 column volumes of 2x PBS followed by a bed volume of 10 mM Tris-HCl pH 7.4 and the bound dAb was eluted with 0.1 M glycine-HCl pH 2.0 Eluted and neutralized with 1 M Tris-HCl pH 8.0. The OD was measured at 280 nm of the dAb and the protein concentration was determined using the extinction coefficient calculated from the amino acid composition of dAb.

In-vitro analysis of off-rate improved real-time selection: The purified dAb was treated with the same tests as in nave selection, namely via core, SBE-bla HEK 293T cell sensor assay (h2), DSC, and SEC-MALS. An example of an improved clone relative to a mock clone is given in Table 6A. The IC50 value is the average of experiment n.

<Table 6A>

Affinity Mature  order

Example  6. DOM23h Affinity maturation of -271-7 strain

Both domain IDs DOM23h-271 (SEQ ID NO: 199) were isolated from the phage library in a prior selection campaign and variant DOM23h-271-7 (SEQ ID NO: 201) was isolated from the phage library as described in WO 2011/012609, Later isolated. DOM23h-271-7 (SEQ ID NO: 201) was selected for further affinity maturation based on its binding kinetics, sequence and biophysical behavior. Affinity maturation was performed using degenerative mutagenesis to remodulate the CDRs, and improved leads were identified using DNA display or phage display. Two types of libraries have been made to dedifferentiate CDRs and are referred to as triplet and doped libraries. To prepare the triplicate library, oligonucleotide primers containing each CDR were designed, and the codons for the three amino acids in each primer were replaced with NNS codons to diversify the three positions. A large number of oligonucleotides were used to contain all of the targeted amino acids in each CDR, i.e., two for CDR1, three for CDR2, and six for CDR3. A complementary oligonucleotide primer was used to amplify a sequence fragment comprising each mutated CDR, and also an overlapping sequence fragment comprising the remainder of the dAb coding sequence. These fragments were mixed and assembled by splice extension overlapping PCR to produce full length dAb coding sequence. The product was PCR amplified using primers DOM172 (SEQ ID NO: 187) and DOM173 (SEQ ID NO: 188), digested with SalI and NotI and ligated to similarly cut pDOM4 (described above) and ligated into pIE2A2 (described in WO2006018650). The doped library was essentially constructed using a similar method as described in WO2006018650. A single-degenerate oligonucleotide primer was used to contain all the mutations in each CDR. The diversified amino acids in each primer have been specified using the condensed codon to specify multiple amino acids. Five amino acids were different in CDR1, seven amino acids in CDR2, and 13 amino acids in CDR3. Within the primer, the following truncation codons are used: 'a' = 91% A + 3% T + 3% G + 3% C; 'g' = 91% G + 3% T + 3% C + 3% A; 'c' = 91% C + 3% T + 3% G + 3% A; 't' = 91% T + 3% A + 3% G + 3% C; 'S' = 50% G and 50% C. Upper case represents 100% of the specified nucleotides. The primers used were as follows:

Degradation library primers were used in the same manner as triplicate primers. Each diversified CDR was amplified separately and then combined with the parental fragment using splice extension overlap. The fragment was subcloned into pDOM4 and pIE2A2 using SalI and NotI.

DNA  display

Selection was made using in vitro in vitro compartmentalisation and a DNA display using scArc DNA binding protein essentially as described in WO2006018650. Briefly, TGFbRII-FC antigen was biotinylated using a 5: 1 molar ratio of biotin and EZ-LINK ™ Sulfo-NHS-LC-Biotin kit (Thermo # 21327). The expression cassette containing the DNA fragment containing the Arc operator sequence and the diversified dAb library was PCR amplified from the pIE2A2 vector using an adjacent primer. The product was purified from eGel (Invitrogen) and diluted to 1.7 or 0.85 nM in 1 mg / ml BSA. For improved binder selection, the doped and ternary libraries were treated separately under slightly different conditions. A triple CDR library was combined to generate a pooled CDR 1, 2 or 3 library. A selection of 10 rounds was used for each kind of library. For both methods, after two selection cycles, the diversified CDRs were amplified and recombined by splice overlap extension PCR to produce a fourth library with mutations in all three CDRs.

For the doped library, 5 x 10 ⁸ copies of DNA were mixed with 50 μl of EXPRESSWAY ™ in vitro translation mix (Invitrogen). Each of the reactants contained 10.0 [mu] l SLYD (TM) extract; 10.0 [mu] l 2.5x reaction buffer; 12.5 [mu] l 2x feed buffer; 1.0 l methionine (75 mM); 1.25 [mu] l Amino acid mix (50 mM); 15 ㎕ H ₂ O; 0.5 [mu] l T7 polymerase; 0.25 ul anti-HA mAb 3F10 (Roche, cat. 1 867 423); And 1.5 [mu] l glutathione (100 mM) (Sigma). This was added to 800 μL of a hydrophobic phase (SPAN ™ -80, (Fluka) + 0.5% in hard white mineral oil (Sigma)) in a 4 mL glass vial (CHROMACOL ™ 4SV P837) Triton X-100 (Sigma)) and stirred at 2000 rpm for 4-5 minutes. The tube was sealed and incubated at 30 [deg.] C for 3 hours. All subsequent steps were carried out at room temperature. To extract the DNA-protein complex, 200 μl of C + buffer (10 mM Tris, 0.1 M KCl, 0.05% Tween ™ -20, 5 mM MgCl ₂ , 1% BSA, pH 7.4) and 500 μl of hexane were added to the vial , Mixed, transferred to a microtube, and centrifuged at 13000 g for 1 minute. The organic phase was removed and the aqueous phase re-extracted 3-5 times with 800 [mu] l of hexane until the interface was nearly clear. For the first five rounds of selection, biotinylated TGFbRII-FC was pre-bound to streptavidin dinavide (TM) (Invitrogen) and added to the extracted complex to form 40, 40, 10, 5 and 5 nM antigens Round 1, 2, 3, 4 and 5). T1 beads were used for selections 1-3, and C1 was used for selections 4 and 5. After 30 min incubation, the beads were washed 3-5 times with C + buffer. The DNA complexes that remain bound to the beads were then recovered by PCR using the adjacent primers. Selection rounds 6-10 are referred to as the 'availability' selection, where the biotinylated TGFbRII-FC presents concentrations of 5, 5, 4, 5 and 5 nM (rounds 6, 7, 8, 9 and 10 respectively) Was added directly to the complex after the extraction, and incubated for 30 minutes to establish binding. The non-biotinylated TGFbRII-FC was then added as competitor to 74, 750, 400, 250 and 250 nM (rounds 6, 7, 8, 9 and 10 respectively) and 15, 15, 30, 30 and 30 Min (rounds 6, 7, 8, 9 and 10, respectively). In rounds 9 and 10, the double-stranded oligonucleotide containing the ARC operator sequence was cloned into C + buffer used for hexane extraction to reduce cross-reactivity between any non-complexed DNA and excess protein released from the emulsion, nM. After the competition period, 10 占 퐇 of C1 streptavidin dinabead 占 was added. After 10 minutes, the beads were washed 5 times with buffer C + and the bound complexes were recovered by PCR using the adjacent primers as described above. The PCR product was purified on eGel and used in the next selection cycle. After the tenth selection, the recovered product was digested with SalI and NotI enzymes and cloned into similarly digested pDOM13 for expression.

But selected by using a method similar to the triple element library, using 1x10 ⁹ copies of DNA from the first round selection, and subsequently was used for 5x10 ⁸ dogs. In addition, the incubation time for protein expression in the emulsion was shortened to 2 hours. Soluble biotinylated TGFbRII FC was used at 25, 10, 5, 5, 5, 2.5, 2.5, 2.5, 2.5, 2.5, 2.5 nM in all 10 selection rounds respectively. The biotinylated targets were incubated with the extracted complexes for 30 minutes. In selection rounds 5-10, the non-biotinylated TGFbRII-FC competitor was added to final concentrations of 250 nM for 15, 30, 60, 60, 75, and 90 minutes, respectively, followed by the addition of C1 streptavidin dinabead Was added. In Round 5, the competing temperature was room temperature, but from Round 6 the competing temperature was raised to 30 占 폚. Arc operator decoy oligonucleotides were included in selection rounds 1-4 to reduce cross-complexation of defective DNA.

After selection, the dAb encoding the insert was excised from the DNA display expression cassette using SalI and NotI and cloned into pDOM13 bacterial expression vector. The dAbs were sequenced and expressed in TB Onex ™ media and screened by Biacore ™ to identify clones with an improved off-rate compared to the monoclon. Clones with improved off rates were expressed and purified, affinity assessed by Biacore (TM), and efficacy evaluated by cell sensor assay. Clones showing poor kinematic profiles, containing undesirable sequence motifs, or exhibiting very low yields did not continue their investigation. Three clones of interest were further selected. Clones DOM23h-271-21 (SEQ ID NO: 29) and DOM23h-271-22 (SEQ ID NO: 30) were isolated from doped library selections. The clone DOM23h-271-27 (SEQ ID NO: 31) was isolated from the triplicate library selection. The affinities of the selected clones for human TGFbRII-FC are shown in Table 7.

Phage display:

Ternary or doped libraries in separate CDR1, CDR2 and CDR3 pools were incubated over two rounds of selection using 4 rounds, or 20 pM, followed by 2 pM antigen at concentrations of 10 nM, 1 nM, 100 pM and 20 pM, respectively And treated with phage selection rounds as described above for biotinylated human TGF- [beta] RII / Fc antigen. The insert from the phage selection was cloned into the pDOM10 expression vector and a supernatant with an improved off-rate relative to the mock clone was selected for further study. Domain antibodies and their affinity and bioavailability purified against human TGF- [beta] RII / Fc antigen were tested with Biacore (TM) T100 and the above-described cell sensor assay (data not shown). The affinities of selected clones for human TGFbRII-FC are shown in Table 8.

The sequence of selected clones with improved activity is determined and the full sequence and CDR sequences are shown below.

Common methods for coupled kinematics - T100

Biacore ™ analysis was performed using a capture surface on a CM4 chip. Anti-human IgG was used as the capture agent and bound to the CM4 biosensor chip by primary amine coupling. Antigen molecules fused to human Fc were captured on the immobilized surface at a level of 250-300 resonant units and domain antibodies of defined concentrations, diluted in transfer buffer, were passed over the captured surface. Scanning of the buffer on the captured antigen surface was used for double reference. The captured surface was regenerated after injection of each domain antibody using 3 M magnesium chloride solution; Regeneration removed the captured antigen, but did not significantly affect the ability of the surface to capture the antigen in subsequent cycles. All migration was carried out at 25 &lt; 0 &gt; C using HBS-EP buffer as mobile buffer. Data was generated using BiacoreT100 and fitted to a 1: 1 binding model embedded in the software. When non-specific binding was observed at higher concentrations, the binding curves at this concentration were removed from the assay set.

CDR3 Further diversification of

The DOM23h-271-7 derivative with the highest affinity contained methionine at positions 96 and 100B. These positions with positions 99, 100D, 100E and 100G were varied using NNK mutagenesis to determine if substitution could be made. NNK libraries were prepared as described above using the primer PEP-26-F to introduce selected site diversity in the DOM23h-271-22 or DOM23h-271-102 background. DOM23h-271-102 contains mutations at positions 27 and 55 which give improved affinity than DOM23h-271-7.

A DNA display library was constructed, and 5 nM in successive rounds; 0.5 nM; 0.1 nM; 0.1 nM; 0.1 nM; &Lt; / RTI &gt; and a concentration of 0.1 nM as described above for the biotinylated hTGFbRII-FC. In rounds 4-6, the non-biotinylated TGFbRII-FC competitor was added at final concentrations of 100 nM for 60, 90, and 90 minutes, respectively, followed by the addition of C1 streptavidin dinabead (TM). After selection, the dAb insert was PCR amplified using primers PelB NcoVh and PEP011, digested with NcoI and EcoRI, and cloned into bacterial expression vector pC10.

The cloned product was expressed and screened by Biacore. Clones with similar or better off rates to DOM23h-271-22 were sequenced, purified and assessed for affinity by Biacore (TM) and cell-cell assay. Clones showing poor kinematic profiles, containing undesirable sequence motifs, or exhibiting very low yields did not continue their investigation. DOM23h-271-50 was selected for further affinity maturation.

Example  7. At positions 61 and 64 TGFbRII dAb  Sequence ( DOM23h Introduction of mutations into the -271 line)

D61N and K64R double mutations have previously been introduced in various TGFR [beta] II dAb strains and have been shown to improve efficacy (WO2011 / 012609). These mutations were introduced into the TGFbRII dAb DOM23h-271 strain to investigate whether similar efficacy improvements could be achieved. Other mutations at this position were investigated to determine if further potency enhancement could be achieved.

Mutants were introduced into the DOM23h-271 (SEQ ID NO: 199) backbone by overlap extension using polymerase chain reaction (PCR) (Ho, et al., Gene 1989 77 (1)); A complementary oligonucleotide primer was used to generate two DNA fragments with overlapping or complementary ends. These fragments were combined in a subsequent association PCR, where the overlapping ends annealed, whereby the 3 'overlap of each strand contained a complementary strand and a primer for 3' extension of the resulting fusion product further amplified by PCR Respectively. A specific modification in the nucleotide sequence was introduced by introducing a nucleotide change into the overlapping oligonucleotide primer. The target dAb gene fragment was amplified by two separate PCRs using SUPERTAQ ™ polymerase (HT Biotechnology). DOM23h-271 was chosen because it has a low affinity for TGFbRII so that the improvement in affinity is clearly measurable using Biacore (TM). Mutations at positions 61 and 64 were coded using degenerate oligonucleotides that mutated in combination of two positions and affinity selections were used to enrich the mutants with improved binding affinities. Because the NR mutation is known to be predominant, the mutation was avoided in the library by using a restricted codon at position 61, NNG. The codon encodes 13 amino acids but does not include amino acids F, Y, C, H, I, N, Free Cys is not advantageous in the dAb and asparagine is also undesirable in this position, thus only five preferred amino acid combinations are excluded. At position 64, the NNK codon was used to provide the full range of possible amino acids.

The pair of oligonucleotides used to introduce the mutation was PE008 (adjacent to the 5 'start of the dAb gene: 5'-TTGCAGGCGTGGCAACAGCGTCGACAGAGGTGCAGCTGTTGGAG-3') (SEQ ID NO: 19) with 271-6164 R (5'-GCGTAGTATGTACGATTACCAATCGG- ) (SEQ ID NO: 192) and 271-6164 deg-F mutated with AS1309 (adjacent to the 3'end of the dAb gene: 5'- TGTGTGTGTGTGGCGGCCGCGCTCGAGTGCCTGACCAGGGTTCCCTGACCCCA-3 ') (SEQ ID NO: 195) 5'-GGTAATCGTACATACTACGCA NNG TCCGTG NNK GGCCGGTTCACCATCTCCCGC-3 ') (SEQ ID NO: 194). Two PCR fragments were combined in association PCR using SuperTak ™ DNA polymerase without the addition of primers. The fusion product was then amplified by adding the adjacent primers PE008 and AS1309 to the PCR reaction. The mutated dAbs were digested with SalI and NotI restriction endonucleases, ligated into similarly digested pDOM13 expression vectors, 0.0 &gt; HB2151 &lt; / RTI &gt; cells. The D61N, K64R mutation was also introduced into DOM23h-271 in the same manner, except that primer 271-6164 NR-F (5'-GGTAATCGTACATACTACGCAAACTCCGTGCGCGGCCGGTTCACCATCTCCCGC-3 ') (SEQ ID NO: 196) was used instead of 271-6164 deg-F. The mutated dAbs were identified by sequencing. Thirteen clones with a novel combination of mutations at positions 61 and 64 were identified, but eleven retained additional mutations due to PCR errors. These are shown in Table 11. Note: Clones with improved affinity are underlined. Clones with additional mutations are indicated by an asterisk.

To determine the effect of the mutation, the selected clones were expressed in TBOnex ™ in 96 well plates for 72 hours at 30 ° C or for 24 hours at 37 ° C. The supernatant was made transparent by centrifugation, filtered through a 0.22 mu m filter, and then evaluated for off-rate by Biacore (TM).

Biacore (TM) A100 analysis was performed using a capture surface on a CM5 chip. Anti-human IgG was used as the capture agent and coupled to the CM5 biosensor chip by primary amine coupling. Antigen molecules fused to human Fc were captured on the immobilized surface at a level of 200-300 resonant units and supernatant or purified domain antibodies were passed over the captured surface. The medium on the captured antigen surface or the injection of the buffer was used for the double reference. On each flow cell, a protein A spot allowed the identification of the presence of domain antibodies on each scanned sample. The surface was regenerated after injection of each domain antibody using 3 M magnesium chloride solution; Regeneration removed the captured antigen, but did not significantly affect the ability of the surface to capture the antigen in subsequent cycles. All migration was carried out at 25 &lt; 0 &gt; C using HBS-EP buffer as mobile buffer. Data was generated using Biacore &lt; (R) &gt; A100 and analyzed using its underlying software. Kinematics from the purified samples were fitted to a 1: 1 binding model and supernatant off rates were analyzed using a 1: 1 dissociation model and / or using the binding and stability levels of each sample relative to the parent molecule.

Among the clones tested, 46 clones with improved off-rate compared to parent DOM23h-271 dAb, as shown in Table 11, were identified. Mutations D61R and D61K were found to improve binding regardless of mutation at position 64. Many combinations appeared to be better than the original D61N, K64R mutations, including RE, RM, RF and RY.

Selected mutants with improved off-rates were purified and applied to full BiacoreTM A100 kinetic analysis to determine their affinity (Table 10). In addition, the thermal stability of the mutants was also determined by the generation of a melting profile in the presence of SYPRO ™ Orange (Invitrogen). Briefly, the purified dAb was diluted to 50 and 100 μg / ml in a 1: 500 dilution of Cipro ™ Orange in PBS and incubated in a Mini OPTICON ™ PCR instrument (BioRad) 90 ° C melting curve. The Tm of the major positive metastasis was determined at each concentration and used to calculate the estimated Tm value of 1 mg / ml as an indicator of the melting temperature for comparison (Table 10).

Mutations D61R, K64D and D61R, K64F were selected because of their small affects on Tm and good affinity improvement. These mutants were transferred to the affinity matured DOM23h-271 derivative DOM23h-271-22 (SEQ ID NO: 30) to make dAb DOM23h-271-39 (SEQ ID NO: 37) and DOM23h-271-40 (SEQ ID NO: 38). This mutation has been found to provide enhanced efficacy by improved affinity by Biacore ™, including cross-reactivity with murine TGFbRIIFC, and cell sensor assays. However, mutations have also been found to decrease Tm as measured by DSC and increase aggregation of dab in PBS as measured by SEC MALLS. These assays were performed as described above except that the buffer for SEC MALLS was 0.4 M NaCl, 0.1 M sodium phosphate and 10% isopropanol pH 7. [ These results are summarized in Table 12 (average values for human cell sensor assay and mouse 3T3 luciferase assay are presented).

The sequence of the dab mentioned in this example is presented below:

Example  8. System DOM23h -439-20, DOM23h -843-13, DOM23h -855-21 and DOM23h Affinity matured by CDR diversification of -271-50

The domain antibodies DOM23h-855-21 (SEQ ID NO: 204) and DOM23h-843-13 (SEQ ID NO: 206) correspond to the nude clones DOM23h-855 (SEQ ID NO: 13) and DOM23h-843 (SEQ ID NO: 10), respectively, RTI ID = 0.0 &gt; affinity-induced &lt; / RTI &gt; Domain antibody DOM23h-439 was isolated from the phage library in the preceding selection campaign described in WO 2011/012609, and subsequently the mutant DOM23h-439-20 (SEQ ID NO: 208) was isolated from the phage library as described in detail in Example 5, It was isolated by maturity. Domain antibody DOM23h-271-50 (SEQ ID NO: 214) was generated by CDR3 re-diversification of the CDR-directed directed affinity matured mutant DOM23h-271-22 (SEQ ID NO: 30) as detailed in Example 6 . DOM23h-855-21, DOM23h-843-13, DOM23h-439-20 and DOM23h-271-50 all based on their binding kinetics, efficacy, sequence and biologic behavior in the SBE-bla HEK 293T cell sensor assay Were selected for further affinity maturation. Affinity maturation was performed using metamorphic mutagenesis to remodulate CDRs, and improved leads were identified using phage display. The diversity was introduced into the CDR by the preparation of a doped or NNK library.

DOM23h-271-50 was matured affinity using the NNK library (saturation mutagenesis), oligonucleotide primers containing each CDR were designed, and codons for the five amino acids in each primer were replaced with NNK codons And 5 locations were simultaneously diversified. Single or multiple oligonucleotides were used to include all targeted amino acids in each CDR, i.e., one for CDR1, two for CDR2, and three for CDR3. CDR-directed affinity maturation is achieved using polymerase chain reaction (PCR); A complementary oligonucleotide primer was used to amplify a sequence fragment comprising each mutated CDR, and also an overlapping sequence fragment comprising the remainder of the dAb coding sequence. These fragments were mixed and assembled by splice extension overlapping PCR to produce full length dAb coding sequence. The product was PCR amplified using the primers PelB NcoVh (SEQ ID NO: 210) and PEP044 (5'-GGAACCCTGGTCACCGTCTCGAGCGCGGCCGCATAATAAGAATTCA-3 'SEQ ID NO: 215), digested with NcoI and NotI and ligated into NotI and NcoI digested pDOM4-gene3-pelB hybrid vectors Respectively. The pDOM4-gene3-pelB hybrid vector is a modified version of the pDOM4 vector described above, but has been modified to replace the GAS leader sequence with the pelB (pectate lyase B) signal peptide.

The domain antibodies DOM23h-855-21, DOM23h-843-13 and DOM23h-439-20 were affinity matured using a doped library. The doped library was prepared essentially as described above and as described in WO2006018650. Single axis degenerate oligonucleotide primers were used to contain all mutations in each CDR. The diversified amino acids in each primer have been specified using an achromatic codon to code multiple amino acids. The following truncation codons were used: 'a' = 85% A + 5% T + 5% G + 5% C; 'g' = 85% G + 5% T + 5% C + 5% A; 'c' = 85% C + 5% T + 5% G + 5% A; 't' = 85% T + 5% A + 5% G + 5% C; 'S' = 50% G and 50% C. Upper case represents 100% of the specified nucleotides. For the DOM23h-439-20 doped library, 5 amino acids in CDR1, 6 amino acids in CDR2 and 11 amino acids in CDR3 were varied to include phenylalanine at position 100. For the DOM23h-855-21-doped library, the five amino acids in CDR1, the seven amino acids in CDR2 and the eight amino acids in CDR3 have been diversified. For the DOM23h-843-13 doped library, the five amino acids in CDR1, the six amino acids in CDR2 and the eight amino acids in CDR3 were diversified and diversified by introducing the 94 degree codon VRK in front of CDR3. For each dAb, four doped libraries were constructed, one for CDR1, another for CDR2, and another for CDR3, and the fourth library was for all CDRs diversified. Degradation library primers were used in the same manner as triplicate primers. Each diversified CDR was amplified separately and then combined with the parental fragment using splice extension overlap and the full-length product was amplified using primers PelB NcoVh (SEQ ID NO: 210) and DOM (SEQ ID NO: 188). The fragment was subcloned into pDOM4-gene3-pelB hybrid vector using NcoI and NotI.

Degradation primer sequence:

Phage display:

Except that the NNK or doped library in separate CDR1, CDR2, CDR3 and combined CDR1, 2 and 3 pools was omitted except for the human IgG Fc fragment previously added in Example 1 and the blocking step performed for a minimum of 20 minutes (Round 1, 2, 3, 4, 5, and 6, respectively) biotinylated monomeric human TGF-β as well as 100 nM, 10 nM, 1 nM, 1 nM, 0.1 nM and 0.1 nM 0.0 &gt; RII &lt; / RTI &gt; In selection rounds 4 and 6 competitors were incubated with the labeled antigen after introducing by incubation for 30 min with 100 nM non-biotinylated antigen (rounds 4 and 6). For DOM 23h-439-20 (CDR1, CDR3 and combined pool) and DOM 23h-855-21 (CDR3), a seventh round of selection was performed with 0.1 nM biotinylated monomeric human TGF-β RII antigen and 100 nM competitor For 120 min or for 20 min for 20 pM biotinylated monomeric human TGF- [beta] RII antigen and 100 nM competitor for 30 min. The phage-harvested TG1 cells overnight overnight culture was amplified between selection rounds by centrifugation at 4000 g for 30 min. 40 ml of the supernatant containing the amplified phage was added to 10 ml of PEG / NaCl (20% v / w PEG 8000 + 2.5 M NaCl) and incubated on ice for 60 minutes. The sample was centrifuged at 4000 g for 40 minutes to pellet the precipitated phage. The supernatant was discarded and the phage pellet resuspended in 1 ml 15% v / v glycerol / PBS. The phage sample was transferred to a 2 ml Eppendorf tube and centrifuged for 10 minutes to remove any remaining bacterial cell debris. The diversified domain antibody Vh gene from the phage selection was PCR amplified using the primers PEP011VHStopNotIR (5'-CCCTGGTCACCGTCTCGAGCTAATAGGCGGCCGCGAATTC-3 '(SEQ ID NO: 231) and Nco1 VHF (5'-TATCGTCCATGGCGGAGGTGCAGCTGTTGGAGTCTGG-3' Ligated to pC10 vector digested with NotI restriction endonuclease and also digested with NcoI and Not I. pC10 is a plasmid vector based on the pUC119 vector and expressed under the control of an enhanced LacZ promoter designed for soluble expression of dAb. Expression of the dAb into the supernatant is possible by fusion of the dAb gene to the pelB signal peptide at the N-terminal end. The ligation products are transformed into chemically competent E. coli HB2151 cells and lysed at 100 &lt; RTI ID = 0.0 &gt; Of carbenicillin. Individual clones were selected and plated in 96-well plates at 100 &lt; RTI ID = 0.0 &gt; Expressed in overnight-expressing autologous-derived medium (high-level protein expression system, Norvagen) supplemented with ug / ml carbenicillin and grown with shaking at 250 rpm for 66 hours at 30 캜 or for 24 hours at 37 캜. , The plate was centrifuged at 3500 g for 15 minutes and the supernatant was filtered using a 0.45 μ filter plate (Millipore). The supernatant containing the domain antibody was diluted with human TGF (non-data). The biotinylated antigen was captured on the SA chip according to the manufacturer's instructions, and hybridized with HBS-EP at 25 &lt; 0 &gt; C Analysis was carried out using buffer. The samples were transferred in Biacore (TM) at a flow rate of 30 l / min. Chip recovery was performed using glycine at low pH. The data (not shown) was analyzed for off-rate by fitting to a 1: 1 dissociation model, and supernatants were also analyzed for protein A binding to estimate expression levels. Domain antibodies with improved off-rates compared to the parent antibody were selected for further study. The improved clones were expressed in overnight induction vehicle induction medium (Onex ™, Norvagen) supplemented with 100 μg / ml carbenicillin and defoamer (Sigma) at 30 ° C. for 48-72 hours while shaking at 250 rpm. The supernatant was centrifuged (4,200 rpm, 40 min) and the supernatant was added to a stream line ™ -protein bead (Amersham Biosciences, Ziehl Healthcare ™, UK, binding capacity: 5 mg dAb / Lt; 0 &gt; C or room temperature for at least 1 hour. The bead chromatography column was filled and washed with PBS, followed by 10 mM Tris-HCl pH 7.4 (Sigma, UK). The bound dAb was eluted with 0.1 M glycine-HCl pH 2.0 and neutralized with 1 M Tris-HCl pH 8.0. The OD at 280 nm of the dAb was measured and the protein concentration was determined using the extinction coefficient calculated from the amino acid composition of dAb. Affinity matured domain antibodies were assayed using Biacore (TM) T200 (data for two preferred dAbs are presented in Example 9) and SBE-bla HEK 293T cell sensor assay (two preferred dAbs &Lt; / RTI &gt; is presented in Example 11). Biophysical properties including thermal stability and solution state were determined using differential scanning calorimetry (DSC) and size exclusion chromatography with polychromatic-laser-light scattering (SEC-MALS) (data for two desirable dAbs As shown in Example 10).

Amino acid and nucleic acid sequences of affinity matured DOM23h-439-20 and DOM23h-271-50 anti-human TGFRII dAb

The CDRs defined by the Kabat of the anti-human TGFRII dAb affinity lead are shown in Table 13.

DOM23h -439-25 and DOM23h Additional variants of the nucleotide sequence -271-123

The D61N and K64R mutations as described in Example 7 were introduced in combination or separately in DOM23h-439-25, DOM23h-271-123 and DOM23h-271-129 affinity matured dAbs. The introduction of the V48I mutation in DOM23h-439-25 and DOM23h-271-123 dAbs was also tested to determine if it could confer improved efficacy. Spontaneous mutation at Kabat position 48 was observed in many improved dAbs from the DOM23h-439 strain both after test maturation and CDR-specific affinity maturation. Alanine at the C-terminus of the Vh region immediately downstream of Kabat residue 113 was also added to DOM23h-439-25, DOM23h-271-123 and DOM23h-271-129 and all variants of said dAb with mutations mentioned above . Mutations were made by DOM23h-439-25 (SEQ ID NO: 234), DOM23h-271-123 (SEQ ID NO: 236) and DOM23h-271-129 (SEQ ID NO: 234) by overlap extension using polymerase chain reaction (PCR) SEQ ID NO: 240). Specific mutations in the nucleotide sequence were introduced by incorporating nucleotide changes into the overlap oligonucleotide primers and insertion of alanine at the end of the Vh region was achieved by using a 3 ' oligonucleotide designed to contain an alanine residue after Kabat position 113 .

The following oligonucleotides were used to introduce mutations (mutated residues are indicated by underlined):

To determine the effect of the mutation, the dAb was expressed for 72 hours at 30 ° C with shaking at 250 rpm in TB Onex ™ supplemented with 100 μg / ml carbenicillin and defoamer (Sigma). The culture was centrifuged (4,200 rpm for 40 minutes) and the dAb was affinity purified as described above using Streamline ™ -protein beads (Amersham Biosciences, Ziehl Healthcare ™, UK). The affinities and efficacy of domain antibody variants are shown in Example 11 with data for the preferred dAb with Biacore (TM) T200 (data for preferred dAb is presented in Example 9) and SBE-bla HEK 293T cell sensor assay ).

The amino acid and nucleic acid sequences of DOM23h-439-25 (SEQ ID NO: 234) and DOM23h-271-123 (SEQ ID NO: 236) anti-human TGFRII dAb modified to include C-terminal alanine and D61N, K64R or V48I mutations are presented below :

Example  9. affinity Mature  Domain antibody Via core  Kinematic analysis

Anti-human IgG was immobilized on the via core CM4 chip by primary amine coupling according to the manufacturer's instructions. Human TGF-? RII / Fc, cynomolgus TGF-? RII / Fc or human Fc fragments were captured on the surface. Domain antibodies were passed on two trapped receptors at three concentrations of 100, 10 and 1 nM (DOM23h-439 dAb) or 100, 25 and 6.25 nM (DOM23h-271 dAb). Only 100 nM concentration of each dab was passed through the human Fc fragment to confirm the specificity of binding to the extracellular TGF-β RII domain. Scanning of the buffer on the captured antigen surface was used for double reference. The captured surface was regenerated after injection of each domain antibody using 3 M magnesium chloride solution; Regeneration removed the captured antigen, but did not significantly affect the ability of the surface to capture the antigen in subsequent cycles. All migration was carried out at 25 &lt; 0 &gt; C using HBS-EP buffer as mobile buffer. Data was generated using Biacore (TM) T200 and fitted to a 1: 1 binding model embedded in software. Table 14 shows the binding kinetics of the tested dAbs. The DOM23h-271 dAb and DOM23h-439 lines were moved in separate experiments.

Example  10. affinity Mature dAb of Biophysics  evaluation

The thermal stability of the dAb was determined using differential scanning calorimetry (DSC). The dAb was dialyzed overnight in PBS and adjusted to a final concentration of 1 mg / ml. Dialysis buffer was used as a reference for all samples. DSC was carried out at a heating rate of 180 ° C / hour using a Moses cell micro-thermal analyzer VP-DSC (Ji Healthcare / Microcal). A typical scan range was 20-90 ° C for both the reference buffer and the protein sample. After each reference buffer and sample were paired, the capillary cells were washed with a solution of 5% decon (Fisher-Scientific) in water followed by PBS. The resulting data traces were analyzed using Origin 7.0 software. The DSC trace obtained from the reference buffer was subtracted from the sample trace. The exact molar concentration of the sample was entered into the data analysis routine to obtain values for the melting temperature (Tm), enthalpy (? H) and Van Hope enthalpy (? Hv) values. The data was fitted to a non-two-state model. The best pit and dependent values were obtained using 1 or 2 transition events. Also, the on-set unfolding temperature was determined by integrating each sample temperature history from zero. The value was then determined as the temperature at which the 4% sample was unfolded.

<Table 14A>

Angle - size exclusion chromatography with laser-light scattering ( SEC - MALLS ) &Lt; / RTI &gt;

They were analyzed by SEC-MALLS (size exclusion chromatography with polygon-laser-light scattering) to determine if the dAb forms a higher order oligomer rather than monomeric in solution. An Agilent 1100 series HPLC system equipped with an autosampler and a UV detector (controlled by Empower Software) was connected to Wyatt Mini Donotreose (LS) detector and Wyatt OptiLab rEX DRI (Differential Refractive Index (RI) detector) Respectively. The detector was connected in the following order: -UV-LS-RI. Both RI and LS instruments operate at a wavelength of 658 nm; UV signals were monitored at 280 nm and 220 nm. Domain antibodies (50 microliters injection at a concentration of 1 mg / mL in PBS) were separated according to their hydrodynamic properties by size exclusion chromatography using a TSK2000 column. The mobile phase was 0.2 M NaCl, 0.1 M NaPO ₄ , and 15% n-propanol. The intensity of scattered light was measured as a function of angle while the protein passed through the detector. The measurements along with the protein concentration determined using the RI detector allowed the calculation of the molar mass using a suitable equation (a component of the analytical software Astra v.5.3.4.14). The solution state as a monomer ratio is shown in Table 15. &lt; tb &gt;&lt; TABLE &gt;

Example  11. SBE - bla HEK  Affinity in 293T cell sensor black Mature dAb On by TGF β- RII  control

The assay was carried out identically as outlined in Example 4, Assay h2.

The test was performed several times to obtain the mean and range of values summarized in Table 16. The arithmetic mean IC50 was calculated using the log IC50, and the range was calculated by adding and subtracting the log standard deviation from the mean IC50 and then inversely converting to IC50. The calibration QC parameters were met; The robust Z factor was greater than 0.4 and the TGF-β EC80 was within six times the concentration added to the assay. The results are shown in Table 16.

Sequence matching table

                                SEQUENCE LISTING <110> BEATON, Andrew       DIMECH, Caroline       ERTL, Peter F.       FORD, Susannah       MCADAM, Ruth <120> LIGANDS THAT BIND TGF-BETA RECEPTOR I          <130> PB64388 <150> 61 / 430,235 <151> 2011-01-06 <160> 291 <170> FastSEQ for Windows Version 4.0 <210> 1 <211> 119 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 1 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Glu Gly             20 25 30 Thr Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Ala Ile Leu Ala Ala Gly Ser Asn Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Lys Arg Gln Glu Arg Asp Gly Phe Asp Tyr Trp Gly Gln Gly             100 105 110 Thr Leu Val Thr Val Ser Ser         115 <210> 2 <211> 119 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 2 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ala Gly             20 25 30 Arg Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Ala Ile Asn Arg Asp Gly Thr Arg Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys His Asp Asp Gly His Gly Asn Phe Asp Tyr Trp Gly Gln Gly             100 105 110 Thr Leu Val Thr Val Ser Ser         115 <210> 3 <211> 120 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 3 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ser Ser Ser Ser Thr Phe Thr Asp Asp             20 25 30 Arg Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Ala Ile Gln Pro Asp Gly His Thr Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Glu Gln Asp Val Lys Gly Ser Ser Ser Phe Asp Tyr Trp Gly Gln             100 105 110 Gly Thr Leu Val Thr Val Ser Ser         115 120 <210> 4 <211> 119 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 4 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ala Glu Asp             20 25 30 Arg Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Ala Ile Asp Pro Gln Gly Gln His Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Gln Ser Thr Gly Ser Ala Thr Ser Asp Tyr Trp Gly Gln Gly             100 105 110 Thr Leu Val Thr Val Ser Ser         115 <210> 5 <211> 124 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 5 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Met Ser Tyr             20 25 30 Arg Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Gln Val Val Glu Tyr Ser Arg Thr His Lys Gly Val Phe Asp             100 105 110 Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser         115 120 <210> 6 <211> 122 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 6 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Phe Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Glu Gly Tyr             20 25 30 Arg Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Ala Ile Asp Ser Leu Gly Asp Arg Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Gln Gly Leu Thr His Gln Ser Pro Ser Thr Phe Asp Tyr Trp             100 105 110 Gly Gln Gly Thr Leu Val Thr Val Ser Ser         115 120 <210> 7 <211> 116 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 7 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Glu Ala Tyr             20 25 30 Lys Met Thr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Tyr Ile Thr Pro Ser Gly Gly Gln Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Tyr Gly Ser Ser Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val             100 105 110 Thr Val Ser Ser         115 <210> 8 <211> 119 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 8 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Gly Asp Gly             20 25 30 Arg Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Ala Ile Glu Gly Ala Gly Ser Asp Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Gln Ala Ser Arg Asn Ser Pro Phe Asp Tyr Trp Gly Gln Gly             100 105 110 Thr Leu Val Thr Val Ser Ser         115 <210> 9 <211> 120 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 9 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Ser             20 25 30 Glu Met Ala Trp Ala Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Leu Ile Arg Arg Asn Gly Asn Ala Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Val Thr Lys Asp Arg Ser Val Leu Phe Asp Tyr Trp Gly Gln             100 105 110 Gly Thr Leu Val Thr Val Ser Ser         115 120 <210> 10 <211> 120 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 10 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ser Ser Gly Phe Thr Phe Asp Gln Asp             20 25 30 Arg Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Ala Ile Glu Ser Gly Gly His Arg Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Gln Asn Glu Ser Gly Arg Ser Gly Phe Asp Tyr Trp Gly Gln             100 105 110 Gly Thr Leu Val Thr Val Ser Ser         115 120 <210> 11 <211> 119 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 11 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Ala Ala             20 25 30 Arg Met Trp Trp Ala Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Ala Ile Ala Asp Ile Gly Asn Thr Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Gln Ser Gly Ser Glu Asp His Phe Asp Tyr Trp Gly Gln Gly             100 105 110 Thr Leu Val Thr Val Ser Ser         115 <210> 12 <211> 121 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 12 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ala Gln Asp             20 25 30 Arg Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Gln Asp Leu His Gly Thr Ser Ser Leu Phe Asp Tyr Trp Gly             100 105 110 Gln Gly Thr Leu Val Thr Val Ser Ser         115 120 <210> 13 <211> 120 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 13 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Glu Asn Thr             20 25 30 Ser Met Gly Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Arg Ile Asp Pro Lys Gly Ser His Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Gln Arg Glu Leu Gly Lys Ser His Phe Asp Tyr Trp Gly Gln             100 105 110 Gly Thr Leu Val Thr Val Ser Ser         115 120 <210> 14 <211> 119 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 14 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Arg Ser Tyr             20 25 30 Glu Met Thr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Lys Ile Asp Pro Ser Gly Arg Phe Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Gly Arg Thr Asp Leu Gln Leu Phe Asp Tyr Trp Gly Gln Gly             100 105 110 Thr Leu Val Thr Val Ser Ser         115 <210> 15 <211> 121 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 15 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asn Tyr             20 25 30 Trp Met Arg Trp Ala Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Tyr Ile Thr Pro Lys Gly Asp His Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Glu Ser Leu His Asn Glu Arg Val Lys His Phe Asp Tyr Trp Gly             100 105 110 Gln Gly Thr Leu Val Thr Val Ser Ser         115 120 <210> 16 <211> 121 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 16 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Thr Ser Tyr             20 25 30 Arg Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Val Ile Asp Ser Thr Gly Ser Ala Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Gln Gln Ala Gly Ser Ala Met Gly Glu Phe Asp Tyr Trp Gly             100 105 110 Gln Gly Thr Leu Val Thr Val Ser Ser         115 120 <210> 17 <211> 116 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 17 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ser Ser Gly Phe Thr Phe Val Asn Tyr             20 25 30 Arg Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Ala Ile Ser Gly Ser Gly Asp Lys Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys His Gly Leu Ser Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val             100 105 110 Thr Val Ser Ser         115 <210> 18 <211> 116 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 18 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asn Asp Met             20 25 30 Arg Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Val Ile Asn Ala Asp Gly Asn Arg Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Asp Gly Leu Pro Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val             100 105 110 Thr Val Ser Ser         115 <210> 19 <211> 123 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 19 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Thr Thr Tyr             20 25 30 Gly Met Gly Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Trp Ile Glu Lys Thr Gly Asn Lys Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Ala Gly Arg His Ile Lys Val Arg Ser Ser Asp Phe Asp Tyr             100 105 110 Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser         115 120 <210> 20 <211> 123 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 20 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Lys Arg Tyr             20 25 30 Ser Met Gly Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Val Ile Asn Asp Leu Gly Ser Leu Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Gly Asn Ile Ser Met Val Arg Pro Gly Ser Trp Phe Asp Tyr             100 105 110 Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser         115 120 <210> 21 <211> 123 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 21 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Phe Glu Tyr             20 25 30 Pro Met Gly Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Val Ile Ser Gly Asp Gly Gln Arg Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Ser His Thr Gly Thr Val Arg His Leu Glu Thr Phe Asp Tyr             100 105 110 Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser         115 120 <210> 22 <211> 120 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 22 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Gly Gln Glu             20 25 30 Ser Met Tyr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Ser Gly Thr Arg Ile Lys Gln Gly Phe Asp Tyr Trp Gly Gln             100 105 110 Gly Thr Leu Val Thr Val Ser Ser         115 120 <210> 23 <211> 123 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 23 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Met Asp Tyr             20 25 30 Arg Met Tyr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Gly Ile Asp Pro Thr Gly Leu Arg Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Ile Lys Trp Gly Glu Met Gly Ser Tyr Lys Thr Phe Asp Tyr             100 105 110 Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser         115 120 <210> 24 <211> 124 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 24 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Met Asp Tyr             20 25 30 Asp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Met Ile Arg Glu Asp Gly Gly Lys Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Ala Arg Val Pro Tyr Arg Arg Gly His Arg Asp Asn Phe Asp             100 105 110 Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser         115 120 <210> 25 <211> 120 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 25 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ser Ser Gly Phe Thr Phe Glu Pro Val             20 25 30 Ile Met Gly Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Ala Ile Glu Ala Arg Gly Gly Gly Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Pro Gly Arg His Leu Ser Gln Asp Phe Asp Tyr Trp Gly Gln             100 105 110 Gly Thr Leu Val Thr Val Ser Ser         115 120 <210> 26 <211> 119 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 26 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Arg Tyr             20 25 30 Arg Met Met Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Thr Ile Asp Pro Ala Gly Met Leu Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Arg Leu Ala Ser Arg Ser His Phe Asp Tyr Trp Gly Gln Gly             100 105 110 Thr Leu Val Thr Val Ser Ser         115 <210> 27 <211> 119 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 27 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Glu Tyr             20 25 30 Asp Met Ala Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Arg Ile Arg Ser Asp Gly Val Arg Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Asp Arg Ala Lys Asn Gly Trp Phe Asp Tyr Trp Gly Gln Gly             100 105 110 Thr Leu Val Thr Val Ser Ser         115 <210> 28 <211> 119 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 28 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Lys Tyr             20 25 30 Lys Met Ala Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Leu Ile Phe Pro Asn Gly Val Pro Thr Tyr Tyr Ala Asn Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Tyr Ser Gly Gln Gly Arg Asp Phe Asp Tyr Trp Gly Gln Gly             100 105 110 Thr Leu Val Thr Val Ser Ser         115 <210> 29 <211> 124 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 29 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Thr Glu Tyr             20 25 30 Arg Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Ala Ile Glu Pro Ile Gly Asn Arg Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Gln Met Pro Gly Arg Lys Trp Thr Ala Lys Phe Arg Trp Asp             100 105 110 Tyr Trp Gly Gln Gly Thr Leu Val Ile Val Ser Ser         115 120 <210> 30 <211> 124 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 30 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Thr Glu Tyr             20 25 30 Arg Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Ala Ile Glu Pro Ile Gly Asn Arg Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Gln Met Pro Gly Gln Lys Trp Met Ala Lys Ser Arg Phe Asp             100 105 110 Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser         115 120 <210> 31 <211> 124 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 31 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Thr Glu Tyr             20 25 30 Arg Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Ala Ile Glu Pro Ile Gly Gln Lys Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Gln Ile Pro Gly Arg Lys Trp Thr Ala Asn Ser Arg Phe Asp             100 105 110 Tyr Trp Gly Gln Gly Thr Leu Val Ile Val Ser Ser         115 120 <210> 32 <211> 124 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 32 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Thr Glu Tyr             20 25 30 Arg Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Ala Ile Glu Pro Ile Gly Asn Arg Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Gln Ile Pro Gly Arg Lys Trp Thr Ala Asn Gly Arg Lys Asp             100 105 110 Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser         115 120 <210> 33 <211> 124 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 33 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Thr Phe Thr Glu Tyr             20 25 30 Arg Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Ala Ile Glu Pro Ile Gly His Arg Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Gln Ile Pro Gly Arg Lys Trp Thr Ala Asn Ser Arg Phe Asp             100 105 110 Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser         115 120 <210> 34 <211> 124 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 34 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Thr Glu Tyr             20 25 30 Arg Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Ala Ile Glu Pro Ile Gly Asn Arg Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Gln Ile Pro Gly Gln Arg Trp Thr Gly Asn Ser Arg Phe Asp             100 105 110 Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser         115 120 <210> 35 <211> 124 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 35 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Thr Glu Tyr             20 25 30 Arg Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Ala Ile Glu Pro Ile Gly Asn Arg Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Gln Phe Pro Gly Arg Lys Trp Thr Ala Asn Ser Arg Ser Serp             100 105 110 Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser         115 120 <210> 36 <211> 124 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 36 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Thr Glu Tyr             20 25 30 Arg Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Ala Ile Glu Pro Ile Gly Asn Arg Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Gln Ile Pro Gly Arg Lys Gly Thr Ala Asn Ser Arg Phe Asp             100 105 110 Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser         115 120 <210> 37 <211> 124 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 37 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Thr Glu Tyr             20 25 30 Arg Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Ala Ile Glu Pro Ile Gly Asn Arg Thr Tyr Tyr Ala Arg Ser Val     50 55 60 Asp Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Gln Met Pro Gly Gln Lys Trp Met Ala Lys Ser Arg Phe Asp             100 105 110 Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser         115 120 <210> 38 <211> 124 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 38 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Thr Glu Tyr             20 25 30 Arg Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Ala Ile Glu Pro Ile Gly Asn Arg Thr Tyr Tyr Ala Arg Ser Val     50 55 60 Phe Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Gln Met Pro Gly Gln Lys Trp Met Ala Lys Ser Arg Phe Asp             100 105 110 Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser         115 120 <210> 39 <211> 357 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 39 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttagt gaggggacga tgtggtgggt ccgccaggct 120 ccagggaagg gtctagagtg ggtctcagct attttggctg ctggttctaa tacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggac accgcggtat attactgtgc gaaaaagagg 300 caggagcggg atgggtttga ctactggggt cagggaaccc tggtcaccgt ctcgagc 357 <210> 40 <211> 357 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 40 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttagt gctgggcgga tgtggtgggt ccgccaggct 120 ccagggaagg gtctagagtg ggtctcagcg attaatcggg atggtactag gacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgtgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggac accgcggtat attactgtgc gaaacatgat 300 gatggtcatg gtaattttga ctactggggt cagggaaccc tggtcaccgt ctcgagc 357 <210> 41 <211> 360 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 41 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatc cacctttacg gatgatagga tgtggtgggt ccgccaggct 120 ccagggaagg gtctagagtg ggtctcagct attcagcctg atggtcatac gacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggac accgcggtat attactgtgc ggaacaggat 300 gttaaggggt cgtcttcgtt tgactactgg ggtcagggaa ccctggtcac cgtctcgagc 360 <210> 42 <211> 357 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 42 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttgcg gaggatcgga tgtggtgggt ccgccaggct 120 ccagggaagg gtctagagtg ggtctcagct attgatcctc agggtcagca tacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggac accgcggtat attactgtgc gaaacagtct 300 actgggtctg ctacgtctga ctactggggt cagggaaccc tggtcaccgt ctcgagc 357 <210> 43 <211> 372 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 43 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttatg agttatagga tgtggtgggt ccgccaggct 120 ccagggaagg gtctagagtg ggtctcagct atttctccga gtggtagtga tacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggac accgcggtat attactgtgc gaaacaggtg 300 gtggagtatt cgcgtactca taagggtgtg tttgactact ggggtcaggg aaccctggtc 360 accgtctcga gc 372 <210> 44 <211> 366 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 44 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtt cctgcgtctc 60 tcctgtgcag cctccggatt cacctttgag gggtatagga tgtggtgggt ccgccaggct 120 ccagggaagg gtctagagtg ggtctcagct attgattctc tgggtgatcg tacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagtctgcg tgccgaggac accgcggtat attactgtgc gaaacagggg 300 cttacgcatc agtctccgag tacttttgg tactggggtc agggaaccct ggtcaccgtc 360 tcgagc 366 <210> 45 <211> 348 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 45 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggagggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttgag gcgtataaga tgacgtgggt ccgccaggct 120 ccagggaagg gtctggagtg ggtctcatat attacgccgt ctggtggtca gacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggac accgcggtat attactgtgc gaaatatggt 300 tcgagttttg actactgggg tcagggaacc ctggtcaccg tctcgagc 348 <210> 46 <211> 357 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 46 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttggg gatggtcgta tgtggtgggt ccgccaggct 120 ccagggaagg gtctagagtg ggtctcagct attgaggggg cgggttcgga tacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggac accgcggtat attactgtgc gaaacaggcg 300 tcgcggaatt cgccgtttga ctactggggt caggggaccc tggtcaccgt ctcgagc 357 <210> 47 <211> 360 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 47 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttgat gatagtgaga tggcgtgggc ccgccaggct 120 ccagggaagg gtctagagtg ggtctcactt attcggcgta atggtaatgc tacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggac accgcggtat attactgtgc gaaagttacg 300 cggctcgtt <210> 48 <211> 360 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 48 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttgat caggatcgga tgtggtgggt ccgccaggct 120 ggtctagagg gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggac accgcggtat attactgtgc gaaacagaat 300 gagtcggggc gttcgggttt tgactactgg ggtcagggaa ccctggtcac cgtctcgagc 360 <210> 49 <211> 357 <212> DNA <213> Artifificla Sequence <400> 49 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttgat gcggctagga tgtggtgggc ccgccaggct 120 ccagggaagg gtctagagtg ggtctcagcg attgcggata ttggtaatac tacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggac accgcggtat attactgtgc gaaacagtct 300 ggttcggagg atcattttga ctactggggt cagggaaccc tggtcaccgt ctcgagc 357 <210> 50 <211> 363 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 50 gaggtgcagc tgttggagtc cgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttgct caggatcgga tgtggtgggt ccgccaggct 120 ccagggaagg gtctagagtg ggtctcagct attagtggta gtggtggtag cacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggac accgcggtat attactgtgc gaaacaggat 300 ttgcatggta ctagttcttt gtttgactac tggggtcagg gaaccctggt caccgtctcg 360 agc 363 <210> 51 <211> 360 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 51 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttgag aatacgagta tgggttgggt ccgccaggct 120 ccagggaagg gtctagagtg ggtctcacgt attgatccta agggtagtca tacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa tacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggac accgcggtat attactgtgc gaaacagcgt 300 gagttgggta agtcgcattt tgactactgg ggtcagggaa ccctggtcac cgtctcgagc 360 <210> 52 <211> 357 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 52 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttcgt agttatgaga tgacttgggt ccgccaggct 120 ccagggaagg gtctagagtg ggtctcaaag attgatcctt cgggtcgttt tacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggat accgcggtat attactgtgc gaaaggtcgg 300 acggatcttc agctttttga ctactggggt cagggaaccc tggtcaccgt ctcgagc 357 <210> 53 <211> 363 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 53 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt caccttttcg aattattgga tgcggtgggc ccgccaggct 120 ccagggaagg gtctagagtg ggtctcatat attactccta agggtgatca tacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggac accgcggtat attactgtgc ggaatcgctt 300 cataatgagc gtgttaagca ttttgactac tggggtcagg gaaccctggt caccgtctcg 360 agc 363 <210> 54 <211> 363 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 54 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttact agttatcgta tgtggtgggt ccgccaggct 120 ccagggaagg gtctagagtg ggtctcagtt attgattcta ctggttcggc tacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggat accgcggtat attactgtgc gaaacagcag 300 gctgggagtg cgatggggga gtttgactac tggggtcagg gaaccctggt caccgtctcg 360 agc 363 <210> 55 <211> 348 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 55 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttgtt aattatcgta tgtggtgggt ccgccaggct 120 ccagggaagg gtctagagtg ggtctcagct attagtggta gtggtgataa gacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggac accgcggtat attactgtgc gaaacatggg 300 ctgtcgtttg actactgggg tcagggaacc ctggtcaccg tctcgagc 348 <210> 56 <211> 348 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 56 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttaat gatatgagga tgtggtgggt ccgccaggct 120 ccagggaagg gtctagagtg ggtctcagtg attaatgctg atggtaatag gacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggat accgcggtat attactgtgc gaaagatggg 300 ctgccttttg actactgggg tcagggaacc ctggtcaccg tctcgagc 348 <210> 57 <211> 369 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 57 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttacg acttatggta tgggttgggt ccgccaggct 120 ccagggaagg gtctagagtg ggtctcatgg attgagaaga cgggtaataa gacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggac accgcggtat attactgtgc gaaagcgggg 300 aggcatatta aggtgcgttc gagggatttt gactactggg gtcagggaac cctggtcacc 360 gtctcgagc 369 <210> 58 <211> 369 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 58 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttaag aggtattcta tgggttgggt ccgccaggct 120 ccagggaagg gtctagagtg ggtctcagtt attaatgatc tgggtagttt gacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggac accgcggtat attactgtgc gaaagggaat 300 attagtatgg tgaggccggg gagttggttt gactactggg gtcagggaac cctggtcacc 360 gtctcgagc 369 <210> 59 <211> 369 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 59 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttttt gagtatccta tgggttgggt ccgccaggct 120 ccagggaagg gtctagagtg ggtctcagtt attagtgggg atggtcagcg gacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggac accgcggtat attactgtgc gaaaagtcat 300 acggggactg tgaggcatct ggagacgttt gactactggg gtcagggaac cctggtcacc 360 gtctcgagc 369 <210> 60 <211> 360 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 60 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttggt caggagagta tgtattgggt ccgccaggct 120 ccagggaagg gtctagagtg ggtctcagct attagtggta gtggtggtag cacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggac accgcggtat attactgtgc gaaaagtggt 300 acgcggatta agcagggttt tgactactgg ggtcagggaa ccctggtcac cgtctcgagc 360 <210> 61 <211> 369 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 61 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttatg gattatagga tgtattgggt ccgccaggct 120 ccagggaagg gtctagagtg ggtctcaggg attgatccta ctggtttgcg gacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggac accgcggtat attactgtgc gaaaattaag 300 tggggggaga tggggagtta taagactttt gactactggg gtcagggaac cctggtcacc 360 gtctcgagc 369 <210> 62 <211> 372 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 62 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttatg gattatgata tgagttgggt ccgccaggct 120 ccagggaagg gtctagagtg ggtctcaatg attcgtgagg atggtggtaa gacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggac accgcggtat attactgtgc gaaagcgagg 300 gtgccttatc ggcgtgggca tagggataat tttgactact ggggtcaggg aaccctggtc 360 accgtctcga gc 372 <210> 63 <211> 360 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 63 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cttccggatt cacctttgag ccggttatta tggggtgggt ccgccaggct 120 ccagggaagg gtctagagtg ggtctcagct attgaggcgc ggggtggggg gacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggac accgcggtat attactgtgc gaaacctggg 300 cggcatctta gtcaggattt tgactactgg ggtcagggaa ccctggtcac cgtctcgagc 360 <210> 64 <211> 357 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 64 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttgat cggtatcgta tgatgtgggt ccgccaggct 120 ccagggaagg gtctagagtg ggtctcaacg attgatcctg ctggtatgct tacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggac accgcggtat attactgtgc gaaaaggctg 300 gcttcgcgga gtcattttga ctactggggt cagggaaccc tggtcaccgt ctcgagc 357 <210> 65 <211> 357 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 65 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgcgcag cctccggatt caccttttct gagtatgata tggcttgggt ccgccaggct 120 ccagggaagg gtcttgagtg ggtctcacgg attcgttctg atggtgttag gacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggac accgcggtat attactgtgc gaaagatcgt 300 gctaagaatg gttggtttga ctactggggt cagggaaccc tggtcaccgt ctcgagc 357 <210> 66 <211> 357 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 66 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttgat aagtataaga tggcttgggt ccgccaggct 120 ccagggaagg gtctggagtg ggtctcactt atttttccga atggtgttcc tacatactac 180 gcaaactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggac accgcggtat attactgtgc gaaatatagt 300 ggtcaggggc gggattttga ctactggggt cagggaaccc tggtcaccgt ctcgagc 357 <210> 67 <211> 372 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 67 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttacc gagtatagga tgtggtgggt ccgccaggct 120 ccggggaagg gtctcgagtg ggtctcagcg attgagccga ttggtaatcg tacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggat accgcggtat attactgtgc gaaacagatg 300 ccgggccgga agtggacggc caagttccgc tgggactact ggggtcaggg aaccctggtc 360 atcgtctcga gc 372 <210> 68 <211> 372 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 68 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttacg gagtatagga tgtggtgggt ccgccaggct 120 ccggggaagg gtctcgagtg ggtctcagcg attgagccga ttggtaatcg tacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggat accgcggtat attactgtgc gaaacagatg 300 cccggccaga agtggatggc caagtcccgc ttcgactact ggggtcaggg aaccctggtc 360 accgtctcga gc 372 <210> 69 <211> 372 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 69 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttacg gagtatagga tgtggtgggt ccgccaggct 120 ccagggaagg gtctcgagtg ggtctcagcg attgagccga ttggtcagaa gacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggat accgcggtat attactgtgc gaaacagatt 300 ccggggcgta agtggactgc taattcgcgg tttgactact ggggtcaggg aaccctggtc 360 atcgtctcga gc 372 <210> 70 <211> 372 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 70 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttacg gagtatagga tgtggtgggt ccgccaggct 120 ccggggaagg gtctcgagtg ggtctcagcg attgagccga ttggtaatcg tacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggat accgcggtat attactgtgc gaaacagatt 300 ccggggcgta agtggactgc taatggtcgt aaggactact ggggtcaggg aaccctggtc 360 accgtctcga gc 372 <210> 71 <211> 372 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 71 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatc cacctttacg gagtatagga tgtggtgggt ccgccaggct 120 ccggggaagg gtctcgagtg ggtctcagcg attgagccga ttggtcatag gacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggat accgcggtat attactgtgc gaaacagatt 300 ccggggcgta agtggactgc taattcgcgg tttgactact ggggtcaggg aaccctggtc 360 accgtctcga gc 372 <210> 72 <211> 372 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 72 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttacg gagtatagga tgtggtgggt ccgccaggct 120 ccggggaagg gtctcgagtg ggtctcagcg attgagccga ttggtaatcg tacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggat accgcggtat attactgtgc gaaacagatt 300 ccggggcagc ggtggactgg taattcgcgg tttgactact ggggtcaggg aaccctggtc 360 accgtctcga gc 372 <210> 73 <211> 372 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 73 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttacg gagtatagga tgtggtgggt ccgccaggct 120 ccggggaagg gtctcgagtg ggtctcagcg attgagccga ttggtaatcg tacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggat accgcggtat attactgtgc gaaacagttt 300 ccggggcgta agtggactgc taattcgcgg tctgactact ggggtcaggg aaccctggtc 360 accgtctcga gc 372 <210> 74 <211> 372 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 74 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttacg gagtatagga tgtggtgggt ccgccaggct 120 ccggggaagg gtctcgagtg ggtctcagcg attgagccga ttggtaatcg tacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggat accgcggtat attactgtgc gaaacagatt 300 ccggggcgta agggaactgc taattcgcgg tttgactact ggggtcaggg aaccctggtc 360 accgtctcga gc 372 <210> 75 <211> 372 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 75 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttacg gagtatagga tgtggtgggt ccgccaggct 120 ccggggaagg gtctcgagtg ggtctcagcg attgagccga ttggtaatcg tacatactac 180 gcacgctccg tggacggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggat accgcggtat attactgtgc gaaacagatg 300 cccggccaga agtggatggc caagtcccgc ttcgactact ggggtcaggg aaccctggtc 360 accgtctcga gc 372 <210> 76 <211> 372 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 76 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttacg gagtatagga tgtggtgggt ccgccaggct 120 ccggggaagg gtctcgagtg ggtctcagcg attgagccga ttggtaatcg tacatactac 180 gcacgctccg tgttcggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggat accgcggtat attactgtgc gaaacagatg 300 cccggccaga agtggatggc caagtcccgc ttcgactact ggggtcaggg aaccctggtc 360 accgtctcga gc 372 <210> 77 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 77 Ser Glu Gly Thr Met Trp  1 5 <210> 78 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 78 Ser Ala Gly Arg Met Trp  1 5 <210> 79 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 79 Thr Asp Arg Met Trp  1 5 <210> 80 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 80 Ala Glu Asp Arg Met Trp  1 5 <210> 81 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 81 Met Ser Tyr Arg Met Trp  1 5 <210> 82 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 82 Glu Gly Tyr Arg Met Trp  1 5 <210> 83 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 83 Glu Ala Tyr Lys Met Thr  1 5 <210> 84 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 84 Gly Asp Gly Arg Met Trp  1 5 <210> 85 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 85 Asp Asp Ser Glu Met Ala  1 5 <210> 86 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 86 Asp Gln Asp Arg Met Trp  1 5 <210> 87 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 87 Asp Ala Ala Arg Met Trp  1 5 <210> 88 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 88 Ala Gln Asp Arg Met Trp  1 5 <210> 89 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 89 Glu Asn Thr Ser Met Gly  1 5 <210> 90 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 90 Arg Ser Tyr Glu Met Thr  1 5 <210> 91 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 91 Ser Asn Tyr Trp Met Arg  1 5 <210> 92 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 92 Thr Ser Tyr Arg Met Trp  1 5 <210> 93 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 93 Val Asn Tyr Arg Met Trp  1 5 <210> 94 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 94 Asn Asp Met Arg Met Trp  1 5 <210> 95 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 95 Thr Thr Tly Gly Met Gly  1 5 <210> 96 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 96 Lys Arg Tyr Ser Met Gly  1 5 <210> 97 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 97 Phe Glu Tyr Pro Met Gly  1 5 <210> 98 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 98 Gly Gln Glu Ser Met Tyr  1 5 <210> 99 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 99 Met Asp Tyr Arg Met Tyr  1 5 <210> 100 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 100 Met Asp Tyr Asp Met Ser  1 5 <210> 101 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 101 Glu Pro Val Ile Met Gly  1 5 <210> 102 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 102 Asp Arg Tyr Arg Met Met  1 5 <210> 103 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 103 Ser Glu Tyr Asp Met Ala  1 5 <210> 104 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 104 Asp Lys Tyr Lys Met Ala  1 5 <210> 105 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 105 Gly Phe Thr Phe Thr Glu Tyr Arg Met Trp  1 5 10 <210> 106 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 106 Gly Phe Thr Phe Thr Glu Tyr Arg Met Trp  1 5 10 <210> 107 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 107 Gly Phe Thr Phe Thr Glu Tyr Arg Met Trp  1 5 10 <210> 108 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 108 Gly Phe Thr Phe Thr Glu Tyr Arg Met Trp  1 5 10 <210> 109 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 109 Gly Ser Thr Phe Thr Glu Tyr Arg Met Trp  1 5 10 <210> 110 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 110 Gly Phe Thr Phe Thr Glu Tyr Arg Met Trp  1 5 10 <210> 111 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 111 Gly Phe Thr Phe Thr Glu Tyr Arg Met Trp  1 5 10 <210> 112 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 112 Gly Phe Thr Phe Thr Glu Tyr Arg Met Trp  1 5 10 <210> 113 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 113 Ala Ile Leu Ala Ala Gly Ser Asn Thr Tyr Tyr Ala Asp Ser Val Lys  1 5 10 15 Gly      <210> 114 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 114 Ala Ile Asn Arg Asp Gly Thr Arg Thr Tyr Tyr Ala Asp Ser Val Lys  1 5 10 15 Gly      <210> 115 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 115 Ala Ile Gln Pro Asp Gly His Thr Thr Tyr Tyr Ala Asp Ser Val Lys  1 5 10 15 Gly      <210> 116 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 116 Ala Ile Asp Pro Gln Gly Gln His Thr Tyr Tyr Ala Asp Ser Val Lys  1 5 10 15 Gly      <210> 117 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 117 Ala Ile Ser Pro Ser Gly Ser Asp Thr Tyr Tyr Ala Asp Ser Val Lys  1 5 10 15 Gly      <210> 118 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 118 Ala Ile Asp Ser Leu Gly Asp Arg Thr Tyr Tyr Ala Asp Ser Val Lys  1 5 10 15 Gly      <210> 119 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 119 Tyr Ile Thr Pro Ser Gly Gly Gln Thr Tyr Tyr Ala Asp Ser Val Lys  1 5 10 15 Gly      <210> 120 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 120 Ala Ile Glu Gly Ala Gly Ser Asp Thr Tyr Ala Asp Ser Val Lys  1 5 10 15 Gly      <210> 121 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 121 Leu Ile Arg Arg Asn Gly Asn Ala Thr Tyr Tyr Ala Asp Ser Val Lys  1 5 10 15 Gly      <210> 122 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 122 Ala Ile Glu Ser Gly Gly His Arg Thr Tyr Tyr Ala Asp Ser Val Lys  1 5 10 15 Gly      <210> 123 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 123 Ala Ile Ala Asp Ile Gly Asn Thr Thr Tyr Ala Asp Ser Val Lys  1 5 10 15 Gly      <210> 124 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 124 Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys  1 5 10 15 Gly      <210> 125 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 125 Arg Ile Asp Pro Lys Gly Ser His Thr Tyr Tyr Ala Asp Ser Val Lys  1 5 10 15 Gly      <210> 126 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 126 Lys Ile Asp Pro Ser Gly Arg Phe Thr Tyr Tyr Ala Asp Ser Val Lys  1 5 10 15 Gly      <210> 127 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 127 Tyr Ile Thr Pro Lys Gly Asp His Thr Tyr Tyr Ala Asp Ser Val Lys  1 5 10 15 Gly      <210> 128 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 128 Val Ile Asp Ser Thr Gly Ser Ala Thr Tyr Tyr Ala Asp Ser Val Lys  1 5 10 15 Gly      <210> 129 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 129 Ala Ile Ser Gly Ser Gly Asp Lys Thr Tyr Tyr Ala Asp Ser Val Lys  1 5 10 15 Gly      <210> 130 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 130 Val Ile Asn Ala Asp Gly Asn Arg Thr Tyr Tyr Ala Asp Ser Val Lys  1 5 10 15 Gly      <210> 131 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 131 Trp Ile Glu Lys Thr Gly Asn Lys Thr Tyr Tyr Ala Asp Ser Val Lys  1 5 10 15 Gly      <210> 132 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 132 Val Ile Asn Asp Leu Gly Ser Leu Thr Tyr Tyr Ala Asp Ser Val Lys  1 5 10 15 Gly      <210> 133 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 133 Val Ile Ser Gly Asp Gly Gln Arg Thr Tyr Tyr Ala Asp Ser Val Lys  1 5 10 15 Gly      <210> 134 <211> 18 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 134 Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys  1 5 10 15 Gly Arg          <210> 135 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 135 Gly Ile Asp Pro Thr Gly Leu Arg Thr Tyr Tyr Ala Asp Ser Val Lys  1 5 10 15 Gly      <210> 136 <211> 18 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 136 Met Ile Arg Glu Asp Gly Gly Lys Thr Tyr Tyr Ala Asp Ser Val Lys  1 5 10 15 Gly Arg          <210> 137 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 137 Ala Ile Glu Ala Arg Gly Gly Gly Thr Tyr Tyr Ala Asp Ser Val Lys  1 5 10 15 Gly      <210> 138 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 138 Thr Ile Asp Pro Ala Gly Met Leu Thr Tyr Tyr Ala Asp Ser Val Lys  1 5 10 15 Gly      <210> 139 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 139 Arg Ile Arg Ser Asp Gly Val Arg Thr Tyr Tyr Ala Asp Ser Val Lys  1 5 10 15 Gly      <210> 140 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 140 Leu Ile Phe Pro Asn Gly Val Pro Thr Tyr Tyr Ala Asn Ser Val Lys  1 5 10 15 Gly      <210> 141 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 141 Ala Ile Glu Pro Ile Gly Asn Arg Thr Tyr Tyr Ala Asp Ser Val Lys  1 5 10 15 Gly      <210> 142 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 142 Ala Ile Glu Pro Ile Gly Asn Arg Thr Tyr Tyr Ala Asp Ser Val Lys  1 5 10 15 Gly      <210> 143 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 143 Ala Ile Glu Pro Ile Gly Gln Lys Thr Tyr Tyr Ala Asp Ser Val Lys  1 5 10 15 Gly      <210> 144 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 144 Ala Ile Glu Pro Ile Gly Asn Arg Thr Tyr Tyr Ala Asp Ser Val Lys  1 5 10 15 Gly      <210> 145 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 145 Ala Ile Glu Pro Ile Gly His Arg Thr Tyr Tyr Ala Asp Ser Val Lys  1 5 10 15 Gly      <210> 146 <211> 18 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 146 Ala Ile Glu Pro Ile Gly Asn Arg Thr Tyr Tyr Ala Asp Ser Ser Val  1 5 10 15 Lys Gly          <210> 147 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 147 Ala Ile Glu Pro Ile Gly Asn Arg Thr Tyr Tyr Ala Asp Ser Val Lys  1 5 10 15 Gly      <210> 148 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 148 Ala Ile Glu Pro Ile Gly Asn Arg Thr Tyr Tyr Ala Asp Ser Val Lys  1 5 10 15 Gly      <210> 149 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 149 Lys Arg Gln Glu Arg Asp Gly Phe Asp Tyr  1 5 10 <210> 150 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 150 His Asp Asp Gly His Gly Asn Phe Asp Tyr  1 5 10 <210> 151 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 151 Glu Gln Asp Val Lys Gly Ser Ser Ser Phe Asp Tyr  1 5 10 <210> 152 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 152 Gln Ser Thr Gly Ser Ala Thr Ser Asp Tyr  1 5 10 <210> 153 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 153 Gln Val Val Glu Tyr Ser Arg Thr His Lys Gly Val Phe Asp Tyr  1 5 10 15 <210> 154 <211> 13 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 154 Gln Gly Leu Thr His Gln Ser Pro Ser Thr Phe Asp Tyr  1 5 10 <210> 155 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 155 Tyr Gly Ser Ser Phe Asp Tyr  1 5 <210> 156 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 156 Gln Ala Ser Arg Asn Ser Pro Phe Asp Tyr  1 5 10 <210> 157 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 157 Val Thr Lys Asp Arg Ser Val Leu Phe Asp Tyr  1 5 10 <210> 158 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 158 Gln Asn Glu Ser Gly Arg Ser Gly Phe Asp Tyr  1 5 10 <210> 159 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 159 Gln Ser Gly Ser Glu Asp His Phe Asp Tyr  1 5 10 <210> 160 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 160 Gln Asp Leu His Gly Thr Ser Ser Leu Phe Asp Tyr  1 5 10 <210> 161 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 161 Gln Arg Glu Leu Gly Lys Ser His Phe Asp Tyr  1 5 10 <210> 162 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 162 Gly Arg Thr Asp Leu Gln Leu Phe Asp Tyr  1 5 10 <210> 163 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 163 Ser Leu His Asn Glu Arg Val Lys His Phe Asp Tyr  1 5 10 <210> 164 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 164 Gln Gln Ala Gly Ser Ala Met Gly Glu Phe Asp Tyr  1 5 10 <210> 165 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 165 His Gly Leu Ser Phe Asp Tyr  1 5 <210> 166 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 166 Asp Gly Leu Pro Phe Asp Tyr  1 5 <210> 167 <211> 14 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 167 Ala Gly Arg His Ile Lys Val Arg Ser Ser Asp Phe Asp Tyr  1 5 10 <210> 168 <211> 14 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 168 Gly Asn Ile Ser Met Val Arg Pro Gly Ser Trp Phe Asp Tyr  1 5 10 <210> 169 <211> 14 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 169 Ser His Thr Gly Thr Val Arg His Leu Glu Thr Phe Asp Tyr  1 5 10 <210> 170 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 170 Ser Gly Thr Arg Ile Lys Gln Gly Phe Asp Tyr  1 5 10 <210> 171 <211> 14 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 171 Ile Lys Trp Gly Glu Met Gly Ser Tyr Lys Thr Phe Asp Tyr  1 5 10 <210> 172 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 172 Ala Arg Val Pro Tyr Arg Arg Gly His Arg Asp Asn Phe Asp Tyr  1 5 10 15 <210> 173 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 173 Pro Gly Arg His Leu Ser Gln Asp Phe Asp Tyr  1 5 10 <210> 174 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 174 Arg Leu Ala Ser Arg Ser His Phe Asp Tyr  1 5 10 <210> 175 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 175 Asp Arg Ala Lys Asn Gly Trp Phe Asp Tyr  1 5 10 <210> 176 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 176 Tyr Ser Gly Gln Gly Arg Asp Phe Asp Tyr  1 5 10 <210> 177 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 177 Gln Met Pro Gly Arg Lys Trp Thr Ala Lys Phe Arg Trp Asp Tyr  1 5 10 15 <210> 178 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 178 Gln Met Pro Gly Gln Lys Trp Met Ala Lys Ser Arg Phe Asp Tyr  1 5 10 15 <210> 179 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 179 Gln Ile Pro Gly Arg Lys Trp Thr Ala Asn Ser Arg Phe Asp Tyr  1 5 10 15 <210> 180 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 180 Gln Ile Pro Gly Arg Lys Trp Thr Ala Asn Gly Arg Lys Asp Tyr  1 5 10 15 <210> 181 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 181 Gln Ile Pro Gly Arg Lys Trp Thr Ala Asn Ser Arg Phe Asp Tyr  1 5 10 15 <210> 182 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 182 Gln Ile Pro Gly Gln Arg Trp Thr Gly Asn Ser Arg Phe Asp Tyr  1 5 10 15 <210> 183 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 183 Gln Phe Pro Gly Arg Lys Trp Thr Ala Asn Ser Arg Ser Asp Tyr  1 5 10 15 <210> 184 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 184 Gln Ile Pro Gly Arg Lys Gly Thr Ala Asn Ser Arg Phe Asp Tyr  1 5 10 15 <210> 185 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 185 agcggataac aatttcacac agga 24 <210> 186 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 186 cgccagggtt ttcccagtca cgac 24 <210> 187 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 187 ttgcaggcgt ggcaacagcg 20 <210> 188 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 188 cacgacgttg taaaacgacg gcc 23 <210> 189 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 189 gcagcctccg gattcacctt tacsgastat agsatgtgst gggtccgcca ggctccgggg 60 <210> 190 <211> 64 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 190 gggtctcgag tgggtctcag csattgascc satsggsaas cgsacatact acgcagactc 60 cgtg 64 <210> 191 <211> 77 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 191 gcggtatatt actgtgcgaa acasatsccs ggscgsaast gsacsgcsaa stcscgstts 60 gactactggg gtcaggg 77 <210> 192 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 192 ttgcaggcgt ggcaacagcg tcgacagagg tgcagctgtt ggag 44 <210> 193 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 193 gcgtagtatg tacgattacc aatcgg 26 <210> 194 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <220> <221> misc_feature <222> 22, 23, 31, 32 <223> n = A, T, C or G <400> 194 ggtaatcgta catactacgc anngtccgtg nnkggccggt tcaccatctc ccgc 54 <210> 195 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 195 tgtgtgtgtg tggcggccgc gctcgagacg gtgaccaggg ttccctgacc cca 53 <210> 196 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 196 ggtaatcgta catactacgc aaactccgtg cgcggccggt tcaccatctc ccgc 54 <210> 197 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 197 ttgcaggcgt ggcaacagcg 20 <210> 198 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 198 cacgacgttg taaaacgacg gcc 23 <210> 199 <211> 124 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 199 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Thr Glu Tyr             20 25 30 Arg Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Ala Ile Glu Pro Ile Gly Asn Arg Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Gln Ile Pro Gly Arg Lys Trp Thr Ala Asn Ser Arg Phe Asp             100 105 110 Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser         115 120 <210> 200 <211> 372 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 200 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttacg gagtatagga tgtggtgggt ccgccaggct 120 ccggggaagg gtctcgagtg ggtctcagcg attgagccga ttggtaatcg tacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggat accgcggtat attactgtgc gaaacagatt 300 ccggggcgta agtggactgc taattcgcgg tttgactact ggggtcaggg aaccctggtc 360 accgtctcga gc 372 <210> 201 <211> 124 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 201 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Thr Glu Tyr             20 25 30 Arg Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Ala Ile Glu Pro Ile Gly Asn Arg Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Gln Ile Pro Gly Arg Lys Trp Thr Ala Asn Ser Arg Phe Asp             100 105 110 Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser         115 120 <210> 202 <211> 372 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 202 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttacg gagtatagga tgtggtgggt ccgccaggct 120 ccggggaagg gtctcgagtg ggtctcagcg attgagccga ttggtaatcg tacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggat accgcggtat attactgtgc gaaacagatt 300 ccggggcgta agtggactgc taattcgcgg tttgactact ggggtcaggg aaccctggtc 360 accgtctcga gc 372 <210> 203 <211> 360 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 203 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttgag aatacgagta tgggttgggt ccgccaggct 120 ccagggaagg gtctagagtg ggtctcacgt attgatccta agggtagtca tacatactac 180 acagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa tacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggac accgcggtat attactgtgc gaaacagcgt 300 gagttgggta agtcgtattt tgactactgg ggtcagggaa ccctggtcac cgtctcgagc 360 <210> 204 <211> 120 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 204 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Glu Asn Thr             20 25 30 Ser Met Gly Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Arg Ile Asp Pro Lys Gly Ser His Thr Tyr Tyr Thr Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Gln Arg Glu Leu Gly Lys Ser Tyr Phe Asp Tyr Trp Gly Gln             100 105 110 Gly Thr Leu Val Thr Val Ser Ser         115 120 <210> 205 <211> 360 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 205 gaggtgcagc tgttggagtc tgggggaggc ctggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttgat caggatcgga tgtggtgggt ccgccaggcc 120 ggtctagagg gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggac accgcggtat attactgtgc gaatcagaat 300 aagtcggggc gttcgggttt tgactactgg ggtcagggaa ccctggtcac cgtctcgagc 360 <210> 206 <211> 120 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 206 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ser Ser Gly Phe Thr Phe Asp Gln Asp             20 25 30 Arg Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Ala Ile Glu Ser Gly Gly His Arg Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Asn Gln Asn Lys Ser Gly Arg Ser Gly Phe Asp Tyr Trp Gly Gln             100 105 110 Gly Thr Leu Val Thr Val Ser Ser         115 120 <210> 207 <211> 366 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 207 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttggg acggagcaga tgtggtgggt ccgccaggct 120 ccagggaagg gtctagagtt tgtctcacgt attgattcgc ctggtgggag gacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggac accgcggtat attactgtgc gaaacggcat 300 gcggctgggg tttcgggtac ttattttgac tactggggtc agggaaccct ggtcaccgtc 360 tcgagc 366 <210> 208 <211> 122 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 208 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Gly Thr Glu             20 25 30 Gln Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Phe Val         35 40 45 Ser Arg Ile Asp Ser Pro Gly Gly Arg Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Arg His Ala Gly Val Ser Gly Thr Tyr Phe Asp Tyr Trp             100 105 110 Gly Gln Gly Thr Leu Val Thr Val Ser Ser         115 120 <210> 209 <211> 81 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <220> <221> misc_feature <222> 25, 26, 34, 35, 43, 44, 49, 50, 52, 53, 58, 59 <223> n = A, T, C or G <400> 209 gcggtatatt actgtgcgaa acagnnsccc ggcnnsaagt ggnnsgccnn snnscgcnns 60 gactactggg gtcagggaac c 81 <210> 210 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 210 gcccagccgg ccatggcgga ggtgcagctg ttggagtctg gg 42 <210> 211 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 211 gaattcgcgg ccgcctatta gctcgagacg gtgaccaggg 40 <210> 212 <211> 372 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 212 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatc cacctttacg gagtatagga tgtggtgggt ccgccaggct 120 ccggggaagg gtctcgagtg ggtctcagcg attgagccga ttggtcatag gacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggat accgcggtat attactgtgc gaaacaggcg 300 cccggcgaga agtggctcgc ccggggccgc ttggactact ggggtcaggg aaccctggtc 360 accgtctcga gc 372 <210> 213 <211> 124 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 213 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Thr Phe Thr Glu Tyr             20 25 30 Arg Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Ala Ile Glu Pro Ile Gly His Arg Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Gln Ala Pro Gly Glu Lys Trp Leu Ala Arg Gly Arg Leu Asp             100 105 110 Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser         115 120 <210> 214 <211> 124 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 214 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Thr Phe Thr Glu Tyr             20 25 30 Arg Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Ala Ile Glu Pro Ile Gly His Arg Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Gln Ala Pro Gly Glu Lys Trp Leu Ala Arg Gly Arg Leu Asp             100 105 110 Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser         115 120 <210> 215 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 215 ggaaccctgg tcaccgtctc gagcgcggcc gcataataag aattca 46 <210> 216 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 216 gcagcctccg gattcacctt tggsacsgag cagatgtggt gggtccgcca ggctccaggg 60 <210> 217 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 217 aagggtctag agtttgtctc acgsattgat tcsccsggtg gscgsacata ctacgcagac 60 tccgtg 66 <210> 218 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 218 gcggtatatt actgtgcgaa acgscatgcs gcsggsgtst csggsacsta ytttgactac 60 tggggtcagg gaacc 75 <210> 219 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Nucliec acid sequence <400> 219 gcagcctccg gattcacctt tgatcaggat cgsatgtggt gggtccgcca ggccccaggg 60 <210> 220 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 220 aagggtctag agtgggtctc agcsattgag tcsggsggtc atcgsacata ctacgcagac 60 tccgtg 66 <210> 221 <211> 69 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 221 accgcggtat attactgtgc gvrkcagaat aagtcsggsc gstcsggstt tgactactgg 60 ggtcaggga 69 <210> 222 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 222 gcagcctccg gattcacctt tgagaatacs tcsatgggst gggtccgcca ggctccaggg 60 <210> 223 <211> 81 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 223 aagggtctag agtgggtctc acgsattgat ccsaagggtt cscatacata ctacacsgac 60 tccgtgaagg gccggttcac c 81 <210> 224 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 224 gcggtatatt actgtgcgaa acagcgsgag ctsggsaagt cstaytttga ctactggggt 60 caggga 66 <210> 225 <211> 69 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <220> <221> misc_feature <222> 22, 23, 25, 26, 28, 29, 31, 32, 37, 38 <223> n = A, T, C or G <400> 225 gcagcctccg gattcacctt tnnknnknnk nnkatgnnkt gggtccgcca ggctccgggg 60 aagggtctc 69 <210> 226 <211> 80 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <220> <221> misc_feature <222> 38, 39, 44, 45, 47, 48, 50, 51, 56, 57 <223> n = A, T, C or G <400> 226 ccgccaggct ccggggaagg gtctcgagtg ggtctcannk attnnknnkn nkggtnnkcg 60 tacatactac gcagactccg 80 <210> 227 <211> 80 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <220> <221> misc_feature <222> 47, 48, 50, 51, 53, 54, 56, 57, 59, 60 <223> n = A, T, C or G <400> 227 ccgccaggct ccggggaagg gtctcgagtg ggtctcagcg attgagnnkn nknnknnknn 60 kacatactac gcagactccg 80 <210> 228 <211> 80 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <220> <221> misc_feature <222> 25, 26, 28, 29, 31, 32, 34, 35, 37, 38 <223> n = A, T, C or G <400> 228 accgcggtat attactgtgc gaaannknnk nnknnknnka agtggatggc cgtgggccgc 60 ttggactact ggggtcaggg 80 <210> 229 <211> 80 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <220> <221> misc_feature <222> 34, 35, 37, 38, 40, 41, 43, 44, 46, 47 <223> n = A, T, C or G <400> 229 accgcggtat attactgtgc gaaacagaag cccnnknnkn nknnknnkgc cgtgggccgc 60 ttggactact ggggtcaggg 80 <210> 230 <211> 80 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <220> <221> misc_feature <222> 46, 47, 49, 50, 52, 53, 55, 56, 58, 59 <223> n = A, T, C or G <400> 230 accgcggtat attactgtgc gaaacagaag cccggccaga agtggnnknn knnknnknnk 60 ttggactact ggggtcaggg 80 <210> 231 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 231 ccctggtcac cgtctcgagc taataggcgg ccgcgaattc 40 <210> 232 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 232 tatcgtccat ggcggaggtg cagctgttgg agtctgg 37 <210> 233 <211> 366 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 233 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttggg acggagcaga tgtggtgggt ccgccaggct 120 ccagggaagg gtctagagtt tgtctcacgt attgattcgc ctggtgggag gacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggac accgcggtat attactgtgc gaaacggcga 300 cccacggggg tgtccgggac gttttatgac tactggggtc agggaaccct ggtcaccgtc 360 tcgagc 366 <210> 234 <211> 122 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 234 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Gly Thr Glu             20 25 30 Gln Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Phe Val         35 40 45 Ser Arg Ile Asp Ser Pro Gly Gly Arg Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Arg Arg Pro Thr Gly Val Ser Gly Thr Phe Tyr Asp Tyr Trp             100 105 110 Gly Gln Gly Thr Leu Val Thr Val Ser Ser         115 120 <210> 235 <211> 372 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 235 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatc cacctttacg gagtatagga tgtggtgggt ccgccaggct 120 ccggggaagg gtctcgagtg ggtctcagcg attgagccga ttggtcatag gacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggat accgcggtat attactgtgc gaaacaggcg 300 cccggcgaga agtgggcgag gcggtgggat ttggactact ggggtcaggg aaccctggtc 360 accgtctcga gc 372 <210> 236 <211> 124 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 236 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Thr Phe Thr Glu Tyr             20 25 30 Arg Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Ala Ile Glu Pro Ile Gly His Arg Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Gln Ala Pro Gly Glu Lys Trp Ala Arg Arg Trp Asp Leu Asp             100 105 110 Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser         115 120 <210> 237 <211> 366 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 237 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttggg accgatcaga tgtggtgggt ccgccaggct 120 ccagggaagg gtctagagtt tgtctcacgc attgattccc ccggtgggcg gacatactac 180 gcaaactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggac accgcggtat attactgtgc gaaacggcag 300 ccggcggggg tgtcggggaa gtacgttgac tactggggtc agggaaccct ggtcaccgtc 360 tcgagc 366 <210> 238 <211> 122 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 238 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Gly Thr Asp             20 25 30 Gln Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Phe Val         35 40 45 Ser Arg Ile Asp Ser Pro Gly Gly Arg Thr Tyr Tyr Ala Asn Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Arg Gln Pro Ala Gly Val Ser Gly Lys Tyr Val Asp Tyr Trp             100 105 110 Gly Gln Gly Thr Leu Val Thr Val Ser Ser         115 120 <210> 239 <211> 372 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 239 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatc cacctttacg gagtatagga tgtggtgggt ccgccaggct 120 ccggggaagg gtctcgagtg ggtctcagcg attgagccga ttggtcatag gacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggat accgcggtat attactgtgc gaaacaggcg 300 cccaatcaga ggtatgttgc ccggggccgc ttggactact ggggtcaggg aaccctggtc 360 accgtctcga gc 372 <210> 240 <211> 124 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 240 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Thr Phe Thr Glu Tyr             20 25 30 Arg Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Ala Ile Glu Pro Ile Gly His Arg Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Gln Ala Pro Asn Gln Arg Tyr Val Ala Arg Gly Arg Leu Asp             100 105 110 Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser         115 120 <210> 241 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 241 Gly Ser Thr Phe Thr Glu Tyr Arg Met Trp  1 5 10 <210> 242 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 242 Ala Ile Glu Pro Ile Gly His Arg Thr Tyr Tyr Ala Asp Ser Val Lys  1 5 10 15 Gly      <210> 243 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 243 Gln Ala Pro Gly Glu Lys Trp Ala Arg Arg Trp Asp Leu Asp Tyr  1 5 10 15 <210> 244 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 244 Gly Ser Thr Phe Thr Glu Tyr Arg Met Trp  1 5 10 <210> 245 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 245 Ala Ile Glu Pro Ile Gly His Arg Thr Tyr Tyr Ala Asp Ser Val Lys  1 5 10 15 Gly      <210> 246 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 246 Gln Ala Pro Asn Gln Arg Tyr Val Ala Arg Gly Arg Leu Asp Tyr  1 5 10 15 <210> 247 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 247 Gly Phe Thr Phe Gly Thr Glu Gln Met Trp  1 5 10 <210> 248 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 248 Arg Ile Asp Ser Pro Gly Gly Arg Thr Tyr Tyr Ala Asp Ser Val Lys  1 5 10 15 Gly      <210> 249 <211> 13 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 249 Arg Arg Pro Thr Gly Val Ser Gly Thr Phe Tyr Asp Tyr  1 5 10 <210> 250 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 250 Gly Phe Thr Phe Gly Thr Asp Gln Met Trp  1 5 10 <210> 251 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 251 Arg Ile Asp Ser Pro Gly Gly Arg Thr Tyr Tyr Ala Asn Ser Val Lys  1 5 10 15 Gly      <210> 252 <211> 13 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 252 Arg Gln Pro Ala Gly Val Ser Gly Lys Tyr Val Asp Tyr  1 5 10 <210> 253 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 253 gggtctagag tttatttcac gtattgattc gcc 33 <210> 254 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 254 gggaggacat actacgcaaa ctccgtgaag ggccgg 36 <210> 255 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 255 cgcagactcc gtgcgtggcc ggttcacc 28 <210> 256 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 256 gggaggacat actacgcaaa ctccgtgcgt ggccggttca cc 42 <210> 257 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 257 ggacatacta cgcaaactcc gtgaagggcc gg 32 <210> 258 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 258 cgcagactcc gtgcgtggcc ggttcacc 28 <210> 259 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 259 ggacatacta cgcaaactcc gtgcgtggcc ggttcacc 38 <210> 260 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 260 ccctggtcac cgtctcgagc gcgtaataag cggccgcaga tta 43 <210> 261 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 261 ataaggccat ggcggaggtg cagctgttgg agtctg 36 <210> 262 <211> 369 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 262 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttggg acggagcaga tgtggtgggt ccgccaggct 120 ccagggaagg gtctagagtt tgtctcacgt attgattcgc ctggtgggag gacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggac accgcggtat attactgtgc gaaacggcga 300 cccacggggg tgtccgggac gttttatgac tactggggtc agggaaccct ggtcaccgtc 360 tcgagcgcg 369 <210> 263 <211> 123 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 263 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Gly Thr Glu             20 25 30 Gln Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Phe Val         35 40 45 Ser Arg Ile Asp Ser Pro Gly Gly Arg Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Arg Arg Pro Thr Gly Val Ser Gly Thr Phe Tyr Asp Tyr Trp             100 105 110 Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala         115 120 <210> 264 <211> 369 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 264 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttggg acggagcaga tgtggtgggt ccgccaggct 120 ccagggaagg gtctagagtt tatttcacgt attgattcgc ctggtgggag gacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggac accgcggtat attactgtgc gaaacggcga 300 cccacggggg tgtccgggac gttttatgac tactggggtc agggaaccct ggtcaccgtc 360 tcgagcgcg 369 <210> 265 <211> 123 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 265 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Gly Thr Glu             20 25 30 Gln Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Phe Ile         35 40 45 Ser Arg Ile Asp Ser Pro Gly Gly Arg Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Arg Arg Pro Thr Gly Val Ser Gly Thr Phe Tyr Asp Tyr Trp             100 105 110 Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala         115 120 <210> 266 <211> 369 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 266 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttggg acggagcaga tgtggtgggt ccgccaggct 120 ccagggaagg gtctagagtt tgtctcacgt attgattcgc ctggtgggag gacatactac 180 gcaaactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggac accgcggtat attactgtgc gaaacggcga 300 cccacggggg tgtccgggac gttttatgac tactggggtc agggaaccct ggtcaccgtc 360 tcgagcgcg 369 <210> 267 <211> 123 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 267 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Gly Thr Glu             20 25 30 Gln Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Phe Val         35 40 45 Ser Arg Ile Asp Ser Pro Gly Gly Arg Thr Tyr Tyr Ala Asn Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Arg Arg Pro Thr Gly Val Ser Gly Thr Phe Tyr Asp Tyr Trp             100 105 110 Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala         115 120 <210> 268 <211> 369 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 268 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttggg acggagcaga tgtggtgggt ccgccaggct 120 ccagggaagg gtctagagtt tgtctcacgt attgattcgc ctggtgggag gacatactac 180 gcagactccg tgcgtggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggac accgcggtat attactgtgc gaaacggcga 300 cccacggggg tgtccgggac gttttatgac tactggggtc agggaaccct ggtcaccgtc 360 tcgagcgcg 369 <210> 269 <211> 123 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 269 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Gly Thr Glu             20 25 30 Gln Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Phe Val         35 40 45 Ser Arg Ile Asp Ser Pro Gly Gly Arg Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Arg Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Arg Arg Pro Thr Gly Val Ser Gly Thr Phe Tyr Asp Tyr Trp             100 105 110 Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala         115 120 <210> 270 <211> 369 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 270 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttggg acggagcaga tgtggtgggt ccgccaggct 120 ccagggaagg gtctagagtt tgtctcacgt attgattcgc ctggtgggag gacatactac 180 gcaaactccg tgcgtggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggac accgcggtat attactgtgc gaaacggcga 300 cccacggggg tgtccgggac gttttatgac tactggggtc agggaaccct ggtcaccgtc 360 tcgagcgcg 369 <210> 271 <211> 123 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 271 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Gly Thr Glu             20 25 30 Gln Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Phe Val         35 40 45 Ser Arg Ile Asp Ser Pro Gly Gly Arg Thr Tyr Tyr Ala Asn Ser Val     50 55 60 Arg Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Arg Arg Pro Thr Gly Val Ser Gly Thr Phe Tyr Asp Tyr Trp             100 105 110 Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala         115 120 <210> 272 <211> 375 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 272 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatc cacctttacg gagtatagga tgtggtgggt ccgccaggct 120 ccggggaagg gtctcgagtg ggtctcagcg attgagccga ttggtcatag gacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggat accgcggtat attactgtgc gaaacaggcg 300 cccggcgaga agtgggcgag gcggtgggat ttggactact ggggtcaggg aaccctggtc 360 accgtctcga gcgcg 375 <210> 273 <211> 125 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 273 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Thr Phe Thr Glu Tyr             20 25 30 Arg Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Ala Ile Glu Pro Ile Gly His Arg Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Gln Ala Pro Gly Glu Lys Trp Ala Arg Arg Trp Asp Leu Asp             100 105 110 Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala         115 120 125 <210> 274 <211> 375 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 274 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatc cacctttacg gagtatagga tgtggtgggt ccgccaggct 120 ccggggaagg gtctcgagtg ggtctcagcg attgagccga ttggtcatag gacatactac 180 gcaaactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggat accgcggtat attactgtgc gaaacaggcg 300 cccggcgaga agtgggcgag gcggtgggat ttggactact ggggtcaggg aaccctggtc 360 accgtctcga gcgcg 375 <210> 275 <211> 125 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 275 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Thr Phe Thr Glu Tyr             20 25 30 Arg Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Ala Ile Glu Pro Ile Gly His Arg Thr Tyr Tyr Ala Asn Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Gln Ala Pro Gly Glu Lys Trp Ala Arg Arg Trp Asp Leu Asp             100 105 110 Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala         115 120 125 <210> 276 <211> 375 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 276 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatc cacctttacg gagtatagga tgtggtgggt ccgccaggct 120 ccggggaagg gtctcgagtg ggtctcagcg attgagccga ttggtcatag gacatactac 180 gcagactccg tgcgtggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggat accgcggtat attactgtgc gaaacaggcg 300 cccggcgaga agtgggcgag gcggtgggat ttggactact ggggtcaggg aaccctggtc 360 accgtctcga gcgcg 375 <210> 277 <211> 125 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 277 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Thr Phe Thr Glu Tyr             20 25 30 Arg Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Ala Ile Glu Pro Ile Gly His Arg Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Arg Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Gln Ala Pro Gly Glu Lys Trp Ala Arg Arg Trp Asp Leu Asp             100 105 110 Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala         115 120 125 <210> 278 <211> 375 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 278 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatc cacctttacg gagtatagga tgtggtgggt ccgccaggct 120 ccggggaagg gtctcgagtg ggtctcagcg attgagccga ttggtcatag gacatactac 180 gcaaactccg tgcgtggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggat accgcggtat attactgtgc gaaacaggcg 300 cccggcgaga agtgggcgag gcggtgggat ttggactact ggggtcaggg aaccctggtc 360 accgtctcga gcgcg 375 <210> 279 <211> 125 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 279 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Thr Phe Thr Glu Tyr             20 25 30 Arg Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Ala Ile Glu Pro Ile Gly His Arg Thr Tyr Tyr Ala Asn Ser Val     50 55 60 Arg Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Gln Ala Pro Gly Glu Lys Trp Ala Arg Arg Trp Asp Leu Asp             100 105 110 Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala         115 120 125 <210> 280 <211> 375 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 280 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatc cacctttacg gagtatagga tgtggtgggt ccgccaggct 120 ccggggaagg gtctcgagtg gatttcagcg attgagccga ttggtcatag gacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggat accgcggtat attactgtgc gaaacaggcg 300 cccggcgaga agtgggcgag gcggtgggat ttggactact ggggtcaggg aaccctggtc 360 accgtctcga gcgcg 375 <210> 281 <211> 125 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 281 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Thr Phe Thr Glu Tyr             20 25 30 Arg Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Ile         35 40 45 Ser Ala Ile Glu Pro Ile Gly His Arg Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Gln Ala Pro Gly Glu Lys Trp Ala Arg Arg Trp Asp Leu Asp             100 105 110 Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala         115 120 125 <210> 282 <211> 375 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 282 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatc cacctttacg gagtatagga tgtggtgggt ccgccaggct 120 ccggggaagg gtctcgagtg ggtctcagcg attgagccga ttggtcatag gacatactac 180 gcagactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggat accgcggtat attactgtgc gaaacaggcg 300 cccaatcaga ggtatgttgc ccggggccgc ttggactact ggggtcaggg aaccctggtc 360 accgtctcga gcgcg 375 <210> 283 <211> 125 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 283 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Thr Phe Thr Glu Tyr             20 25 30 Arg Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Ala Ile Glu Pro Ile Gly His Arg Thr Tyr Tyr Ala Asp Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Gln Ala Pro Asn Gln Arg Tyr Val Ala Arg Gly Arg Leu Asp             100 105 110 Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala         115 120 125 <210> 284 <211> 375 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 284 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatc cacctttacg gagtatagga tgtggtgggt ccgccaggct 120 ccggggaagg gtctcgagtg ggtctcagcg attgagccga ttggtcatag gacatactac 180 gcaaactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggat accgcggtat attactgtgc gaaacaggcg 300 cccaatcaga ggtatgttgc ccggggccgc ttggactact ggggtcaggg aaccctggtc 360 accgtctcga gcgcg 375 <210> 285 <211> 125 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 285 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Thr Phe Thr Glu Tyr             20 25 30 Arg Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Ala Ile Glu Pro Ile Gly His Arg Thr Tyr Tyr Ala Asn Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Gln Ala Pro Asn Gln Arg Tyr Val Ala Arg Gly Arg Leu Asp             100 105 110 Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala         115 120 125 <210> 286 <211> 375 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 286 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatc cacctttacg gagtatagga tgtggtgggt ccgccaggct 120 ccggggaagg gtctcgagtg ggtctcagcg attgagccga ttggtcatag gacatactac 180 gcaaactccg tgcgtggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggat accgcggtat attactgtgc gaaacaggcg 300 cccaatcaga ggtatgttgc ccggggccgc ttggactact ggggtcaggg aaccctggtc 360 accgtctcga gcgcg 375 <210> 287 <211> 125 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 287 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Thr Phe Thr Glu Tyr             20 25 30 Arg Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val         35 40 45 Ser Ala Ile Glu Pro Ile Gly His Arg Thr Tyr Tyr Ala Asn Ser Val     50 55 60 Arg Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Gln Ala Pro Asn Gln Arg Tyr Val Ala Arg Gly Arg Leu Asp             100 105 110 Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala         115 120 125 <210> 288 <211> 369 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 288 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttggg acggagcaga tgtggtgggt ccgccaggct 120 ccagggaagg gtctagagtt tatttcacgt attgattcgc ctggtgggag gacatactac 180 gcaaactccg tgaagggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggac accgcggtat attactgtgc gaaacggcga 300 cccacggggg tgtccgggac gttttatgac tactggggtc agggaaccct ggtcaccgtc 360 tcgagcgcg 369 <210> 289 <211> 123 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 289 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Gly Thr Glu             20 25 30 Gln Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Phe Ile         35 40 45 Ser Arg Ile Asp Ser Pro Gly Gly Arg Thr Tyr Tyr Ala Asn Ser Val     50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Arg Arg Pro Thr Gly Val Ser Gly Thr Phe Tyr Asp Tyr Trp             100 105 110 Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala         115 120 <210> 290 <211> 369 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid sequence <400> 290 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgcgtctc 60 tcctgtgcag cctccggatt cacctttggg acggagcaga tgtggtgggt ccgccaggct 120 ccagggaagg gtctagagtt tatttcacgt attgattcgc ctggtgggag gacatactac 180 gcaaactccg tgcgtggccg gttcaccatc tcccgcgaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgcg tgccgaggac accgcggtat attactgtgc gaaacggcga 300 cccacggggg tgtccgggac gttttatgac tactggggtc agggaaccct ggtcaccgtc 360 tcgagcgcg 369 <210> 291 <211> 123 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence <400> 291 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly  1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Gly Thr Glu             20 25 30 Gln Met Trp Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Phe Ile         35 40 45 Ser Arg Ile Asp Ser Pro Gly Gly Arg Thr Tyr Tyr Ala Asn Ser Val     50 55 60 Arg Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys                 85 90 95 Ala Lys Arg Arg Pro Thr Gly Val Ser Gly Thr Phe Tyr Asp Tyr Trp             100 105 110 Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala         115 120

Claims (31)

An anti-TGF beta RII immunoglobulin single variable domain having the amino acid sequence of SEQ ID NO: 267. 2. The anti-TGF beta RII immunoglobulin single variable domain of claim 1, which binds to human TGF beta RII. 3. The anti-TGF beta RII immunoglobulin single variable domain of claim 2, further binding to mouse TGF beta RII and / or cyno TGF beta RII. 2. The anti-TGF beta RII immunoglobulin single variable domain of claim 1 which neutralizes TGF beta activity. 2. The anti-TGF beta RII immunoglobulin single variable domain of claim 1, which inhibits binding of TGF beta to TGF beta RII. The anti-TGF beta RII immunoglobulin single variable domain of claim 1, linked to an antibody Fc region comprising one or both of the CH2 and CH3 domains and optionally a hinge region. 6. An isolated polypeptide comprising an anti-TGF beta RII immunoglobulin single variable domain according to any one of claims 1 to 6 and binding to TGF beta RII. 6. An isolated nucleic acid molecule encoding an anti-TGF beta RII immunoglobulin single variable domain according to any one of claims 1 to 6 or a polypeptide comprising same. 9. The isolated nucleic acid molecule of claim 8 comprising a nucleic acid molecule of SEQ ID NO: 266. 12. A vector comprising a nucleic acid molecule according to claim 9. 12. A host cell comprising a nucleic acid molecule according to claim 9 or a vector comprising the same. A host cell comprising the nucleic acid molecule encoding the anti-TGF beta RII immunoglobulin single variable domain according to any one of claims 1 to 6 or a polypeptide comprising the same, or a vector comprising the nucleic acid molecule, Maintaining the polypeptide under conditions suitable for expression of the nucleic acid molecule or vector to produce a polypeptide comprising an immunoglobulin single variable domain
Wherein the polypeptide comprises an anti-TGF beta RII immunoglobulin single variable domain according to any one of claims 1 to 6. Cancer, tissue fibrosis comprising an anti-TGF beta RII immunoglobulin single variable domain according to any one of claims 1 to 6 or a polypeptide comprising it; Liver fibrosis; Rheumatoid arthritis; Ocular disorders; Skin fibrosis; Renal fibrosis; Wound healing; Or &lt; / RTI &gt; 14. A pharmaceutical composition according to claim 13 for use in the treatment of pulmonary fibrosis, idiopathic pulmonary fibrosis, liver cirrhosis, chronic hepatitis, keloid of the skin, Dupuytren's Contracture, nephritis, neuropathy or restenosis. Use of an anti-TGF beta RII immunoglobulin single variable domain according to any one of claims 1 to 6 or a polypeptide comprising it for the treatment of cancer by modulating TGF beta signaling in tumor angiogenesis &Lt; / RTI &gt; 7. An anti-TGF beta RII immunoglobulin single variable domain according to any one of claims 1 to 6 or a polypeptide comprising the same,
A device for applying the immunoglobulin single variable domain or polypeptide to the skin
Cancer, &lt; / RTI &gt; Liver fibrosis; Rheumatoid arthritis; Ocular disorders; Skin fibrosis; Renal fibrosis; Wound healing; Or kits for the treatment of angiopathies. 17. The kit of claim 16, wherein the device is an intracutaneous delivery device.
delete delete delete delete delete delete delete delete delete delete delete delete delete delete