KR101871070B1 - Composition for Prevention or Treatment of Arthritis Comprising The Anthriscus sylvestris Hoffm extract - Google Patents

Abstract

The present invention provides a composition for the prevention and treatment of arthritis, which comprises, as an active ingredient, gentian leaf extract (WE-LAS) having an inflammatory cytokine inhibitory effect and a protective effect on joint matrix substances, thereby preventing rheumatoid or degenerative It is possible to provide a functional composition having less side effects and excellent efficacy in the treatment and prevention of arthritis.

Description

TECHNICAL FIELD The present invention relates to a composition for preventing and treating degenerative arthritis, which comprises an extract of Allium cepa L. (WE-LAS) as an active ingredient.

The present invention relates to a composition for preventing and treating arthritis, which contains an extract of Liliaceae (WE-LAS) as an active ingredient. More particularly, the present invention relates to a composition for preventing and treating cartilage- And has excellent effects on the inhibition of inflammatory cytokines and mediators, and a composition for preventing and treating arthritis and a health functional food composition

Arthritis is a disease caused by inflammation and pain in the joints. It is caused by osteoarthristis, rheumatoid arthritis, gout and dry arthritis. 95% of patients with arthritis have degenerative arthritis. Degenerative arthritis is a disease in which the articular cartilage wears off and changes locally degenerative. It is also called osteoarthritis. Degenerative arthritis is a typical degenerative disease that is closely related to aging. It affects about 10 to 15% of the total population, and in particular, 60 to 80% of the elderly people aged 65 or older have degenerative arthritis.

The cause of degenerative arthritis is deeply related to aging and excessive weight, and the older it is, the more and more severe it appears in women. The initial symptom is that one or two joints are accompanied by aching joint pain, and when prolonged, excessive bone formation and joint deformation are caused around the joint. The mechanisms by which degenerative arthritis is induced include increased production of pro-inflammatory cytokines such as TNF-α, IL-1β, and IL-6, and increased production of collagenase, stromelysin, The secretion of the same MMPs is increased, causing damage to the articular cartilage.

As degenerative arthritis is a chronic disease, there is no fundamental therapy. Therefore, pain relief and prevention of cartilage damage are the main treatment goals. Currently, surgical treatment such as arthroscopic surgery, tibial proximal osteotomy, joint partial replacement, and total knee arthroplasty (NSAIDs), analgesics, corticosteroids, and intrahepatic hyaluronic acid injections have been used to treat arthritis.

Nonsteroidal anti-inflammatory drugs (NSAIDs) are effective in relieving pain and relieving inflammation in nerve joints. However, gastrointestinal disorders or abdominal pain are caused. Steroidal anti-inflammatory drugs have side effects such as weight gain and hypertension This is serious, and may simply reduce the pain temporarily, which may lead to overuse, which is a factor that destroys the neural joint and exacerbates the disorder, so use caution.

Therefore, conventional therapies used for joint damage such as arthritis have limited effectiveness, have obvious toxic side effects, can not be used continuously for a long time, and their effectiveness is limited. Therefore, There is a desperate need for a therapeutic or therapeutic agent

Rheumatoid arthritis is an inflammatory disease characterized by multiple arthritis, and autoimmunity is known as a major mechanism. Symptoms include inflammation of the synovial membrane tissue leading to migration of macrophages, dendritic cells, T lymphocytes, and B lymphocytes to synovial tissue, resulting in increased synovial fluid resulting in joint pain, . As inflammation continues, hyperplasia of inflamed synovial tissue destroys the bones and cartilage, deforming the joint structure and causing movement disorders.

In rheumatoid arthritis, the production of pro-inflammatory cytokines such as TNF-α and IL-1β is increased and secretion of MMPs is increased, thereby destroying collagen and proteoglycan constituting articular cartilage Which is known to damage articular cartilage. Therefore, most of the products that develop arthritis drugs as natural materials are commercialized using extracts, and precise mechanism of action is not known. However, most of them are easy to take as oral agents and can be taken for a long time, .

The materials that have been developed so far include injecting hyaluronic acid, which is similar in composition to joint fluid, or taking glucosamine and chondroitin as health supplements, and developing it using natural materials used in medicinal herbs and other medicines such as herbal medicine have.

On the other hand, Anthriscus sylvestris Hoffmann is a perennial herb with a height of 70-100cm. Flowering period is flowering in May-June, white, 5-12 flowers, and fertile period is 7-8 months. The roots are fusiform, 3-10cm long, 7-15cm in diameter, dark brown on the outside, grayish white on the surface and characterized by a little bit of taste.

It is cultivated mostly in the southern part of Gyeongsang and Cholla province centered on Heuksan island, and it is cultivated in Ulleungdo area and is distributed in Japan, China, Siberia and Eastern Europe. The former is a representative spring herb of Ulleungdo, which is harvested first when snow is melted by sprouting in the snow during the winter. The root portion is used as herb medicine, and the young leaf has a unique flavor and a bland taste. The way to eat young leaves is to eat raw or cooked as a herb, and nowadays, it is sold as a product made of pickles.

Anthricin, isoanthricin, podophyllotoxin, angeloyl podophyllotoxin, morelensin, yatein, 7-hydrxyytein, anhydropodorhizol, arctigenin are known to be used as analgesics for the treatment of fever, germ, cold, cough, asthma and headache. and bursehernin, coumarin-based substances such as praeruptorins A, B, C, E, qianth coumarin D, acetyl angeloyl khellactone, acetyl tigloyl khellactone, decursin and nodakenin. Anthricin, known as lignan, is known to inhibit UV-induced skin pigmentation as well as anticancer effects in various cancer cell lines.

In addition, the whitening effect of the compounds isolated from the prior art showed inhibition of melanin formation by B-16 mouse melanoma cell lines induced by IBMX stimulation, and the inhibition of collagen biosynthesis by aging, It is known to be much more effective in aging.

However, the mechanism and extent of the effect of these herbal medicinal ingredients are not yet known, and if the medicinal ingredients of these herbs are identified and their pharmacokinetics are determined, the pharmaceutical application range of the native medicinal herb is broadened, It is thought that it can help to prevent and prevent.

Korean Patent Registration No. 10-0840723 discloses a medicinal herb that has been traditionally used in Oriental medicine, such as Euphorbiae kansui, Anthriscus sylvestris, Croton Tiglium, Aconitum carmichaeli, Daphne genkwa, A method for efficiently extracting an active extract capable of relieving airway constriction, which is a symptom of asthma disease, by promoting the activity of a beta 2 receptor from Calystegia soldanella and Sapium japonicum, Health food, and herbal medicines for prevention and treatment of asthma as an active ingredient. Korean Patent Publication No. 10-1429197 discloses an antimicrobial composition comprising an extract of Anthriscus sylvestris and falcarindiol or deoxypodophyllotoxin isolated therefrom as an active ingredient, Falcarindiol and deoxypodophyllotoxin isolated therefrom exhibit a strong antimicrobial activity against Helicobacter pylori, Staphylococcus aureus and Escherichia coli, thereby preventing or treating diseases caused by pathogenic bacteria Which is useful for the treatment of cancer. Korean Patent Publication No. 10-0500642 discloses a cosmetic composition for skin whitening which contains Umbelliferae extract, Lepidium apetalum Wild. Extract or a mixture thereof as an active ingredient and inhibits skin pigmentation without side effects have. Korean Patent Laid-Open Publication No. 10-2005-0084724 discloses an anthracin-containing composition separated from Anthriscus sylvestris Hoffm., Which has anti-inflammatory and anti-allergic activity. More specifically, Inhibits the production of PAF, which is a cause of inflammation and allergic diseases, inhibits the activity of cyclooxygenase-2 and lipoxygenase (5-LO) to prevent the production of eicosanoids, , The composition containing anthracin separated from the general formula of the present invention has been disclosed in terms of medicines or health functional foods for the prevention and treatment of various inflammatory or allergic diseases. However, the above prior arts differ from the composition and effect of the present invention in the composition for prevention and treatment of arthritis, which contains the target leaf extract (WE-LAS) as an active ingredient of the present invention.

In recent years, efforts to find natural physiologically active substances for medicinal plants for the prevention and treatment of various diseases have been actively carried out all over the world, and research and development efforts for searching and utilizing new natural physiologically active substances have been rapidly increasing ( Anthriscus sylvestris Hoffmann), which is used safely as a therapeutic agent for cough, asthma and laryngitis recently, and its pharmaceutical functions such as anticancer and antimicrobial immune inducer have been revealed. And to provide a composition for combating disease prevention and prevention in today's society.

The present invention aims to provide a composition for preventing and treating arthritis which comprises an extract of Liliaceae leaf (WE-LAS) as an active ingredient. It is intended to inhibit the inflammatory cytokine of the Liliaceae leaf extract (WE-LAS) 1b, TNF-a, IL-6 and inflammatory proteins (iNOS and COX-2) in cartilage cells of white rats induced by IL-1β induced by IL-1β, 2) and increase the expression of PPAR-g, thereby reducing the production of inflammatory factors, NO or PGE2.

In addition, Aggrecanase-1, Aggrecanase-2, and MMP-3 expression were reduced to stabilize Aggrecan, a substrate component of joints, and to suppress the degradation of gelatin, a basement membrane component, by decreasing expression of MMP-2 and MMP-9 A pharmaceutical composition for preventing and treating arthritis.

As another embodiment of the present invention, there is provided a health functional food composition for prevention or improvement of arthritis, which comprises a hot-water extract of Wako leaf (WE-LAS) as an active ingredient. The pharmaceutical composition for preventing and treating arthritis and the health functional food composition for preventing or improving arthritis may be contained in an amount of 0.1 to 99.9% by weight.

The present invention provides a composition for preventing and treating arthritis, which comprises, as an active ingredient, gentian leaf extract (WE-LAS) according to the present invention, which can reduce side effects in the prevention and treatment of rheumatic or degenerative arthritis, It is possible to provide a functional composition capable of performing an efficient function.

FIG. 1 is a graph showing the toxicity of cells after obtaining cartilage cells from white rats and treating them with concentration-dependent leaf extract (WE-LAS).
FIG. 2 is a graph showing the effect of reducing the inflammatory response of the leaf blade extract (WE-LAS) induced by the inflammatory response to cartilage cells.
FIG. 3 is a graph showing the inflammatory response factors of the leaf blade extract (WE-LAS) induced by inflammatory response to cartilage cells.
FIG. 4 is a graph showing arthritis-related factors of the leaf blade extract (WE-LAS) induced by inflammatory response to chondrocytes.
FIG. 5 is a graph showing the activity of gelatinase in the leaf blade extract (WE-LAS) induced by inflammatory response to chondrocytes.

The present invention relates to the use of inflammatory cytokines IL-1b, TNF-a, IL-6 and inflammatory proteins (iNOS and COX-2) in chondrocytes induced by IL- ), Decreased expression of PPAR-g and decreased production of NO and PGE2, which are inflammatory factors, and decreased expression of Aggrecanase-1, Aggrecanase-2 and MMP-3, Aggrecan was stabilized and decreased the expression of MMP-2 and MMP-9, thereby confirming the effect of inhibiting the degradation of gelatin, a constituent of basement membrane. Prior to the experiment of the present invention, detailed material preparation and method will be described in detail.

Ⅰ. Preparation of test materials and method

 1. Preparation of hot water extract

Prepare leaf Anthriscus sylvestris Hoffmann . Preferably one or more selected from the group consisting of water, an alcohol having 1 to 5 carbon atoms, an alcohol-diluted water, and a mixture thereof, more preferably at least one selected from the group consisting of water, an alcohol having 1 to 4 carbon atoms, It may be any one selected, and still more preferably water. The extraction process may be performed, for example, at 50 ° C to 150 ° C, or 75 ° C to 120 ° C, or 90 ° C to 110 ° C, but is not limited thereto. The extraction time is not particularly limited, but may be 10 minutes to 12 hours, or 30 minutes to 6 hours, or 2 hours to 4 hours.

The extract according to the present invention may be prepared according to a conventional method for producing a plant extract. Specifically, the extract may be a heat extraction method including a hot water extraction method, a cold extraction extraction method, a warm extraction extraction method, an ultrasonic extraction method, An extractor or a fractionator may be used. Two or more kinds of solvents may be used for the fractionation, and the solvent extracts may be sequentially used or mixed according to the polarity of the solvent.

The thus-prepared extract or the fraction obtained by performing the fractionation process may be filtered, concentrated or dried to remove the solvent, and may be subjected to both filtration, concentration and drying. Specifically, the filtration can be performed using a filter paper or a vacuum filter, and the concentration can be reduced by using a vacuum concentrator, for example, a rotary evaporator. The drying can be performed by, for example, freeze drying.

 2. Chondrocyte separation and cell culture

The chondrocytes for the experiment were obtained from the primary culture of the rat, and the progress of the primary culture was as follows. The experimental animals for cartilage collection were euthanized after 5-day-old male Sprague-Dawley rats received from DBL, disinfected with skin, and articular cartilage was collected. The collected cartilage tissue was washed three times with phosphate buffered saline (PBS), and incubated in 1% collagenase, 0.1% Trypsin EDTA and DEME / F12 medium for 1 hour at 37 ° C in a 5% CO ₂ incubator. Separate cartilage tissue more precisely and wash 3 times with PBS, add 1% collagenase and DEME / F12 medium, and incubate for 6 hours at 37 ℃ in 5% CO ₂ incubator. After filtering with 40 uM cell strainer, chondrocyte counts were measured and cultured in DMEM / F12 culture medium containing 10% serum, 1% penicillin-Streptomycin and Ascobic acid.

3. Assessment of cell growth inhibition

After the paper invitation chondrocytes of the frequency divider to ⁵ X 10 5 cells in 24 well culture 24 hours after treatment 24 hours arc leaf extract (WE-LAS) at various concentrations (0.1 ~ 10 mg / ml) , 3 - (4,5 dimethyl-thiazol-2-yl) -2,5-diphenyltetrazolium bromide (MTT) solution. In brief, MTT stock solution (5 mg / mL) was added to mouse spleen cells for 24 hours, then reacted in a 5% CO2 incubator at 37 ° C for 4 hours. Dimethyl sulfoxide (DMSO) And the reaction was observed at 560 nm for living cells.

4. NO assay

Chondrocytes were treated with IL-1b (10 ng / ml) for 1 hour and cultured for 24 hours. After culturing for 24 hours, 5 × 10 ⁵ cells Add 100 ul to a new 96 well plate, add 100 ul / well of Griess reagent, and measure the absorbance at 540 nm.

5. PGE2 ELISA

Chondrocytes were treated with IL-1b (10 ng / ml) for 1 hour and cultured for 24 hours. After culturing for 24 hours, 5 × 10 ⁵ cells 100 μl was subjected to R & D Systems' General ELISA Protocol using an R & D ELISA kit (prostaglandin E2; KGE004B).

6. RT-PCR

Reverse transcription of 1 ㎍ of total RNA was carried out using oligo (dT) 18 primer, dNTP (10 mM), 0.1 M dithiotreitol (DTT) And a buffer solution containing a reverse transcriptase RNase inhibitor was added and the reaction was carried out at 42 캜 for 60 minutes. Each of the cDNAs synthesized above was subjected to polymerase chain reaction (PCR) using the primers described in the following Table 1 and SEQ ID NOS: 1 to 16, using 1 μg of each cDNA, 2.5 units of Taq polymerase (Enzynomics) 1.5 mM dNTP, 1x buffer and 20 pmol of each primer pair were mixed, and the total volume was adjusted to 20 μl with distilled water. Then, PCR was carried out using a PCR machine (SimpliAMP, Applied biosystems) according to the following procedure.

After denaturation at 94 ° C for 5 minutes, the reaction was carried out at 94 ° C for 30 seconds, at 55-65 ° C for 60 seconds, and at 72 ° C for 60 seconds in one cycle for 25-35 times. The final extension 72 < 0 > C for 5 minutes. The product generated by PCR was electrophoresed by adding Staining Star to a 1.5% agarose gel and a specific band was confirmed under UV.

Primer sequences for RT-PCR gene The sequence of the primer (5 - 3) Forward Reverse GAPDH TGGTGCTGAGTATGTCGTGGAGTC AGACAACCTGGTCCTCAGTGTAGC IL-1b TCGTGCTGTCTGACCCATGT TGCTCTGCTTGAGAGGTGCT TNF-a CCCAGACCCTCACACTCAGAT TTGTCCCTTGAAGAGAACCTG IL-6 CTCTGGTCTTCTGGAGTTCCGT TGGTCCTTAGCCACTCCTTCTG COX-2 CCCTTCCTCCTGTGGCTGAT CCCAGGTCCTCGCTTCTGAT PPAR-g TGCTGGCCTCCCTGATGAAT CAGTAGCTGCACGTGCTCTG iNOS GCATCGGCAGGATTCAGTGG TAGCCAGCGTACCGGATGAG Aggrecan ACAGTGAGCTCAGGCTTGCCTGTA GTGACATCCTCTACACCTGAAGCA Aggrecanase-1 GGTGCTTTGGCCACCTCAAT ACCACCTCCACAAGTCCTGG Aggrecanase-2 ACACCTGCGTATTTGGGAACCCA GTGTCTGACCAAGAAGTTGCCTGC MMP-3 TCCTACCCATTGCATGGCAGTGAA GCATGAGCCAAGACCATTCCAGG MMP-2 TGACGGCTTCCTCTGGTGTT TAATCCTCGGTGGTGCCACA MMP-9 GGAGGGAAGGCTCTGCTGAT TGGTTCACCCGGTTGTGGAA

7. Western blot

Chondrocyte cells treated with Wako leaf extract (WE-LAS) were washed with PBS and lysed in a solution buffer (50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1% Nonidet P-40, 2 mM EDTA, EGTA, 1 mM NaVO3, 10 mM NaF, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, 25 ㎍ / ㎖ aprotinin, 25 ㎍ / ㎖ leupeptin) was added and dissolved for 30 minutes at 4 째 C and incubated at 4 째 C and 15,000 rpm for 15 minutes The cell membrane components were removed by centrifugation.

Protein concentration was quantitated using Pierce BCA protein assay kit (Thermo Fisher Scientific), and 20 μg of the protein was loaded on a 10% mini-gel SDS-PAGE, denatured and separated by nitrocellulose membrane (BIO-RAD, Richmond, At 350 mA for 1 hour. Blocking of the protein-transferred membrane was carried out at room temperature for 2 hours in TTBS (0.1% Tween 20 + TBS) solution containing 5% skim milk.

Anti-iNOS, Aggrecanase-2, and MMP-3 were purchased from Santa Cruz as primary antibodies, GAPDH was purchased from Abcam, diluted 1: 1000, reacted at room temperature for 2 hours, and washed 5 times with TBS-T . Anti-rabbit IgG (Abcam) conjugated with HRP was diluted 1: 5000 as a secondary antibody, reacted at room temperature for 1 hour, and washed three times with TBS-T. After 30 seconds of reaction with the ECL substrate (amersham Biosciences), the amount of fuming was measured using a chemiluminescence imaging system (Microchemi 4.2, DNR Bio-imaging systems).

8. Gelatin zymography

To investigate MMPs activity, chondrocyte cells were treated with zona pellucida and the conditioned medium was electrophoresed on SDS-PAGE containing 0.2% gelatin, washed with renaturing buffer (2.5% Triton X-100) twice for 30 minutes, The cells were incubated at 37 ^° C for 48 hours in developing buffer containing 50 mmol / L Tris-HCl (pH 7.5), 0.15 mmol / L NaCl, 10 mmol / L CaCl2 and 0.02% Brij35. After the reaction, the gel was stained with 0.25% coomassie brilliant blue solution for 2 hours and decolorized to observe the degree of gelatin degradation.

9. Statistical significance evaluation

Experimental results were expressed as mean standard deviation. The results were analyzed by variance (1 way ANOVA) using Tukey's Multiple Comparison test using GraphPad Prism to analyze the differences. A p-value <0.05 was considered statistically significant.

Ⅱ. Experiment result

1. Cytotoxicity test results of the concentration of WE-LAS

Cell viability was assessed by treatment of chondroitin sulfate (WE-LAS) on chondrocytes isolated from the joints of the rat after 4 days of age. The cytotoxicity test was carried out at a concentration of 0.1 - 10 mg / mL, and the cytotoxicity was observed only at a concentration of 10 mg / ml.

2. Inflammation test results of WE-LAS

In order to investigate the effect of WE-LAS treatment on the reduction of inflammatory response in cartilage cells, the effect of IL-1b treatment on cartilage cells was investigated. After 1 hour, IL-1b was treated to induce inflammatory reaction, and the culture solution was used after 24 hours. (A), the nitric oxide (NO) value produced by chondrocytes was confirmed using a Griess reagent. (B) was measured by ELISA for PEG2 secreted by chondrocytes. Thus, the treatment of the leaf blade extract (WE-LAS) showed that the level of NO (NO) and PGE2 decreased by IL-1b in a concentration-dependent manner.

3. Experimental results of inflammatory response factor of Wako leaf extract (WE-LAS)

(NO) is produced by nitric oxide synthases (NOSs). Inducible NOS (iNOS) is regulated by the stimulation of various factors such as inflammatory cytokines. The chondrocytes are treated with WE-LAS (A) IL-1b, TNF-a, IL-6, inflammatory protein COX-2, and anti-inflammatory effects of PPAR -g expression was confirmed by RT-PCR. (B) Expression of iNOS was confirmed by RT-PCR and Western blot. The expression level of IL-1b, TNF-a, IL-6, and COX-2 is decreased in a concentration-dependent manner and the expression of PPAR-g is increased in a concentration-dependent manner. And protein expression in a concentration-dependent manner.

4. Experimental results of arthritis-related factors of Wako leaf extract (WE-LAS)

(ADAMTS-4), Aggrecanase-2 (ADAMTS-5), and MMP-3, which degrade the matrix, and Aggrecan (proteoglycan) The chondrocytes were treated with IL-1b and reacted for 24 hours. One hour later, the RNA and protein were separated (A), and Aggrecan, the substrate component, and the substrate Expression of the enzymes Aggrecanase-1, Aggrecanase-2 and MMP-3 was confirmed by RT-PCR. (B) Expression of Aggrecanase-2 and MMP-3 was confirmed by Western blot. The expression level of Aggrecanase-1, Aggrecanase-2, and MMP-3 mRNA and protein was decreased by WE-LAS in a concentration-dependent manner.

 5. Experimental results of gelatinase activity of Jeonho Leaf Extract (WE-LAS)

MMP-2 and MMP-9 are gelatinases that break down the basement membrane, and inhibit basement membrane degradation of WE-LAS. The expression of MMP-2 and MMP-9 was analyzed by RT-PCR (Western blot analysis). The expression of MMP-2 and MMP-9 was analyzed by RT-PCR Respectively. (B) Chondrocyte cultures were examined for their effect by using gelatin zymography method (WE-LAS). The expression of MMP-2 and MMP-9, which are expressed by IL-1b, decreased in mRNA expression and gelatin degradation of gelatin by concentration of WE-LAS .

The results of the above experiments indicate that iNOS, an enzyme involved in inflammation and tissue damage, COX-2, which is involved in the production of PGE2, which is an inflammation-related factor, is biologically safe, , Inhibit the expression of articular cartilage degeneration inducers such as TNF-α, a proinflammatory cytokine, and inhibit the expression of MMP-2 and MMP-2, the cartilage degenerative enzymes. In addition, the expression of proteoglycan and collagen type II including aggrecan, which is a constituent of articular cartilage, induces the expression of WE-LAS and the treatment and prevention of degenerative and rheumatoid arthritis.

Therefore, it can be manufactured as a composition for prevention and treatment of arthritis and a health functional food containing the extract of Wakoho Leaf (WE-LAS) as an active ingredient, and it will be effective for the treatment and prevention of rheumatoid arthritis and degenerative arthritis do.

The present invention relates to a food composition having a preventive effect on arthritis caused by arthritis by using a composition for the prevention and treatment of arthritis, which comprises, as an active ingredient, a ginseng leaf extract (WE-LAS) derived from Anthriscus sylvestris Hoffmann And thus it is difficult to find the cause of modern illness. Therefore, it is necessary to treat and prevent rheumatoid arthritis and degenerative arthritis which are difficult to be treated effectively, and rely on physical therapy and pain relief, It can help improve health.

Claims (9)

A pharmaceutical composition for the prevention or treatment of degenerative arthritis comprising an effective amount of a hot-water extract (W-LAS) of Isofu leaf.
The pharmaceutical composition for preventing or treating degenerative arthritis according to any one of claims 1 to 3, wherein the hydrolyzate is in an amount of 0.1 to 99.9% by weight.
delete delete delete delete delete delete delete

Images