KR101866553B1 - Compostion comprising Bojungikki-tang extract for treatment of dementia - Google Patents

Abstract

The present invention relates to a composition comprising a therapeutic agent for dementia and bojungikgitang for treatment of dementia. More particularly, the therapeutic agent for dementia is administered to a subject and the bojungikgitang is administered to the subject to remarkably increase a dementia symptom improvement effect of the therapeutic agent for dementia, and at the same time, prevent or reduce various side effects due to the application of the therapeutic agent for dementia.

Description

[0001] The present invention relates to a composition for treating dementia comprising bojungikki-tang extract for treatment of dementia,

The present invention provides a composition for treating dementia comprising a therapeutic agent for dementia and a booster wing.

Prior Art Document Patent Laid-Open Publication No. 10-2012-0038732
Dementia is a kind of syndrome that causes disability in daily life due to loss of ability of human intellectual ability and social activity due to various diseases. It is pathologically caused by damage and loss of nerve cell , Intensive, language, and cognitive disorders progress gradually over a long period of time and ultimately lead to death. The diseases causing the dementia include Alzheimer's disease, vascular dementia, Parkinson's disease Parkinson ' s disease, Lewy body dementia, Huntington ' s disease, Creutzfeldt-Jacob disease, Pick's disease, and the like.

The highest incidence of these diseases is Alzheimer's disease, which accounts for 50% to 70% of all dementia patients. Alzheimer's disease is classified into sporadic type and familial type depending on the cause. It is known that 80-90% of the patients develop schizophrenia after the age of 65 years. Familility accounts for less than 20% of all, and is caused by mutations in genes such as amyloid precursor protein (APP), presenilin (PS) type 1 and type 2, . Alzheimer's disease is characterized by the accumulation of senile plaques and neurofibrillary tangles on the outside and inside of nerve cells, respectively. The elderly are spherical and generally found in the limbic system or neocortex. Peptides called β-amyloid (Aβ) bind to and deposit with each other to form nuclei, and around the degenerated nerve fiber axons (axons), dendrites (dendrites), activated glue cells (microglia) and astrocytes. Neurofibrillary tangles are substances in neurons that are formed by abnormal phosphorylation of proteins called tau and then bind to each other, and many of them are found in many brain tissues of Alzheimer's disease dementia patients.

The number of patients with dementia, including Alzheimer's disease, is growing steadily due to population aging. As of 2008, about 26 million people have been diagnosed with Alzheimer's disease, and it is estimated that the number of Alzheimer's patients will be more than 100 million by 2050 due to the increase of the elderly population. According to the survey data of Korea Health & It is estimated that about 350,000 people, or about 8.3% of the population, will be demented and about 530,000 in 2015. Despite the low proportion of patients in the total population, dementia is of interest because of the large socio-economic burden of caring for the patient. Accordingly, many studies for the treatment of dementia at the national level have been carried out in advanced countries including the United States.

In the meantime, Baojungwangtang is a typical recipe that is frequently used in the relief of fatigue and immunological activity in Oriental medicine. It is a combination prescription composed of 10 kinds of natural products, and is composed of 黄耆, 蒼朮, ginseng, Dangwi, shiwu, vernal, dandelion, licorice, horse riding, and health (dryness).

Disclosure of Invention Technical Problem [8] The present invention has been made to solve the above-mentioned problems in the prior art, and it is an object of the present invention to provide a composition for treating dementia using a boiling water hopper.

However, the technical problem to be solved by the present invention is not limited to the above-mentioned problems, and other matters not mentioned can be clearly understood by those skilled in the art from the following description.

In order to attain the above object, the present invention provides a composition for treating dementia comprising a therapeutic agent for dementia and a booster wing.

In one embodiment of the present invention, the dementia treating agent is donepezil.

In another embodiment of the present invention, the boiled rice hatchery is characterized in that it comprises Huanggia, Creation, Ginseng, Angelica grisea, Rhizoma, Contrast, Dermis, Licorice, Horse riding, and health.

In still another embodiment of the present invention, the dementia treatment agent and the boiled fish excrement are pre-mixed and formulated or separately formulated.

In still another embodiment of the present invention, the dementia treatment agent and the boiled fish excrement are administered parenterally, orally, locoregionally, or percutaneously.

In yet another embodiment of the present invention, the administration of the boar shrimp is started within 5 minutes to 4 hours after administration of the dementia treatment agent.

The composition for treating dementia, which comprises the boiling water hopper provided by the present invention as an active ingredient, is administered in combination with a dementia treatment agent, thereby enhancing the efficiency of dementia treatment and alleviating adverse side effects of the dementia treatment agent alone.

Fig. 1 is a diagram showing an experimental design of Example 1. Fig.
FIG. 2 is a graph showing the result of observing blood donepezil concentration according to each group in Example 1. FIG.
3 is a view showing an experimental design of the second embodiment.
FIG. 4 is a graph showing the results of examining changes in body weight according to each group according to each group of Example 2. FIG.
FIG. 5 is a photograph showing changes in blood donepezil concentration according to each group in Example 2. FIG.
6 is a diagram showing an experimental design of the third embodiment.
FIG. 7 is a graph showing the results of checking the change in body weight according to each group in Example 3. FIG.
8 is a graph showing the result of checking the change in brain weight according to each group in Example 3. FIG.
9 is a diagram showing the result of comparing brain sizes according to each group in the third embodiment.
FIG. 10 is a graph showing the result of confirming infarct / defect findings according to each group in Example 3. FIG.
11 is a graph showing the results of confirming STAT3 mRNA expression level according to each group in Example 3. Fig.
FIG. 12 is a graph showing the results of confirming the expression level of Pim-1 mRNA according to each group in Example 3. FIG.
13 is a photograph showing a comparison of brains according to each group in Example 3. Fig.
FIG. 14 is a photograph showing a comparison of the expression of cleaved caspase-3 and cleaved PARP in the infarct / defect peripheral cerebral cortex according to each group in Example 3. FIG.
FIG. 15 is a photograph showing a comparison of NT and 4-HNE expression of the infarct / defect peripheral cerebral cortex according to each group in Example 3. FIG.
16 is a diagram showing the experimental design of the fourth embodiment.
17 is a graph showing the result of checking the change in body weight according to each group of Example 4. Fig.
18 is a diagram showing the results of confirming histopathological changes of the lungs according to each group in Example 4. Fig.
FIG. 19 is a graph showing the histopathological changes of spleen according to each group in Example 4. FIG.
FIG. 20 is a diagram showing the results of confirming histopathological changes in liver according to each group in Example 4. FIG.
Fig. 21 is a diagram showing the results of confirming histopathological changes of submandibular glands according to each group in Example 4. Fig.
22 is a view showing the result of confirming histopathological changes on the main body according to each group in Example 4. Fig.

The present inventors have focused on herbal medicine materials in order to develop a composition capable of alleviating various side effects of administration of a dementia treatment agent for the treatment of dementia and capable of further improving the dementia symptom improvement effect, Confirming that the dementia symptom improvement effect and the side effect reduction effect are obtained, and the present invention has been completed.

Accordingly, it is an object of the present invention to provide a composition for treating dementia comprising a therapeutic agent for dementia and a boar wing tiger.

As used herein, the term " Bojongwangtangtang " means a combination preparation comprising ten medicaments. The ten medicaments include ten medicaments of Hwanggi, Creation, Ginseng, Angelicae, Sephora, Control, Dermis, Licorice, Horse Riding, and Health.

In one embodiment of the present invention, the dementia treatment agent and the boiled fish excrement can be mixed and formulated in advance or separately formulated.

The administration period of the boiled fish excrement can be performed within 1 minute to 30 minutes after the administration of the dementia treatment agent, preferably within 3 minutes to 8 minutes, and after the administration of the agent for dementia as in the embodiment of the present invention, Min, but is not limited thereto.

The therapeutic agent for dementia used in the present invention is donepezil, but is not limited thereto.

The dementia treatment agent and the boiled fish can be administered parenterally, orally, locoregionally, or percutaneously. The boiled water hopper is preferably orally administered, but may be suitably selected by those skilled in the art depending on the condition and the weight of the patient, the degree of disease, the duration, and the like.

In the present invention, an 'individual' refers to a subject in need of treatment for diseases, and more specifically, a human or non-human primate, mouse, rat, dog, cat, horse, And the like.

In addition, the present invention can provide a composition for treating dementia, which comprises a boiling fish fortification.

The pharmaceutical composition of the present invention may comprise a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier may include, but is not limited to, physiological saline, polyethylene glycol, ethanol, vegetable oil, and isopropyl myristate.

In one embodiment of the present invention, the preferred dosage of the pharmaceutical composition varies depending on the condition and the weight of the patient, the degree of disease, the drug form, the administration route, and the period, but can be appropriately selected by those skilled in the art. However, it is preferably administered at a daily dose of 0.001 to 300 mg / kg body weight, more preferably 0.01 to 200 mg / kg body weight.

The pharmaceutical composition of the present invention can be administered to mammals such as rats, mice, livestock, humans, and the like in various routes. The method of administration is not limited and can be administered, for example, orally, rectally, or by intravenous, intramuscular, subcutaneous, intrauterine, or intra-cerebroventricular injection.

The composition for treating dementia including the boar wax of the present invention can increase the therapeutic effect of dementia and alleviate various side effects that have been caused when the dementia treatment agent is administered alone.

Hereinafter, preferred embodiments of the present invention will be described in order to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the following examples.

[Example]

Example  One. donepezil  Pharmacokinetics pharmacokinetics ) On Boiling  Impact Assessment: Single-dose oral administration within 5 minutes

Donepezil is a representative oral acetylcholinesterase (ACE) inhibitor that is frequently used as a symptom relief and treatment agent for various dementia. However, it has a relatively strong toxicity in preclinical phase, and various side effects, such as gastrointestinal disorders, The use thereof is limited. Therefore, the present inventors evaluated the drug interaction between donepezil and boiled chrysanthemum by evaluating the effect of boiled chrysanthemum on the pharmacokinetics of donepezil using normal male rats. In other words, single dose of donepezil 10 mg / kg was followed by a single oral dose of 100 mg / kg of the group treated within 30 minutes, followed by 30 minutes, 1, 2, 3, 4, 6, 8, After 24 hours, blood donepezil concentrations were measured and noncompartmental pharmacokinetics data (C _max , T _max , AUC, t _1/2 and MRT) were calculated and compared with donepezil 10 mg / kg alone.

The composition of the used boiler is shown in Table 1 below

Herbs Scientific Names / Produce Region Amounts (g) weight% Astragali Radix Astragalus membranaceus Bunge 1.33 16.625 Creation (Atractylodis Rhizoma) Atractylodes lancea DC 1.33 16.625 Ginseng (White ginseng, Ginseng Radix Alba) Panax ginsengca Meyer. 1.33 16.625 Angelicae Gigantis Radix Angelica gigas N. 1.00 12.5 Bupleuri Radix Bupleurum falcatum L. 0.67 8.375 Contrast (Zizyphi Fructus) Zizyphus I have jujuba . inermis (Bunge) Rehder 0.67 8.375 Dipper (Citri Unshii Pericarpium) Citrus unshiu S. Marcov. 0.67 8.375 Licorice (Glycyrrhizae Rhizoma) Glycyrrhiza uralensis Fisch 0.50 6.25 Horseback riding (Cimicifugae Rhizoma) Cimicifuga heracleifolia Kom. 0.33 4.125 Health (Zingiberis Rhizoma Siccus) Zingiber officinale Roscoe 0.17 2.125 Total 10 types 8.00

1.1. Preparation of experimental animals

In this example, male Spf / VAF Outbred Crl: CD [SD] male rats (OrientBio, Seungnam, Korea) were used as experimental animals. 84 male SPF / VAF Outbred Crl: CD [SD] Male rats (OrientBio, Seungnam, Korea) were obtained and after 37 days of purification, the animals of constant weight were selected and classified into two groups (414.30 ± 18.35 g, 382 to 442 g).

- Donepezil 10 mg / kg alone

- Donepezil 10 mg / kg and booster 100 mg / kg within 5 minutes

1.2. Administration and Method of Blood Collection

The donepezil solution was dissolved in sterilized distilled water at a dose of 5 ml / kg, and 10 mg / kg donepezil (Jeil Pharm. Co., Ltd., Youngin, Korea) kg was dissolved in sterile distilled water and administered in the same dose once orally. On the other hand, in donepezil alone group, only single oral administration of sterile distilled water of the same volume was used instead of boiling water (Table 2, Fig. 1).

Approximately 0.5 ml of whole blood from the orbital venous organs was collected with 50 IU of heparin (Sigma-Aldrich, St. Louis, MO, USA) at 30 minutes, 30 minutes, 1, 2, 3, 4, 6, ), And the plasma was separated by centrifugation at 13000 rpm for 10 minutes immediately after collection. The separated plasma was stored at -150 ° C until LC-MS / MS analysis.

Group Sex Dose (mg / kg / day) Animal No. CIM-14-02-15-01 D + BJIKT PK Donepezil + BJIKT, within 5 min Active Male Donepezil (10 mg / kg, orally administration) C01 ~ C05 Active Male Donepezil and BJIKT (10 and 100 mg / kg, orally co-administration) D01 ~ D05

Donepezil serum concentration : Donepezil concentration was measured by LC-MS / MS using the internal standard of Carbamazepine (Sigma-Aldrich, St. Louis, Mo., USA) Chromatographic analysis was performed using Agilent 1100 Series HPLC (Agilent Technologies, Santa Clara, Calif., USA) and column effluent was analyzed using an API 2000 triple-quadruple mass spectrometer (Applied Biosystems, Foster City, CA, USA) .

HPLC conditions

Column: Waters Symmetry 占 C18 (2.1 占 50 mm, 3.5 占 퐉) (Waters Corp., Milford, MA, USA)

Column oven: 30 ° C

Mobile phase: Linear gradient from 2% acetonitrile / 98% DI water (0.1% formic acid) to 98% acetonitrile / 2% DI water (0.1% formic acid)

Flow rate: 0.30 ml / min

Injection Volume: 4.0 μl

LC-MS / MS

Ion source: Turbo Ion Spray (500 < 0 > C)

Polarity: Positive

Carbamazepine (IS) = m / z 237 > 194 (Retention time: 0.78 min), Donepezil = 380 > 91 (Retention time: 0.39 min)

Standard Curve: Analyst 1.4.1, Linear (1 / x, no Iterate)

1.3. Check the result

Donepezil concentration (ng / ml), pharmacokinetic parameters - Cmax, Tmax, AUC, t1 / 2, and plasma concentrations were measured 30 minutes before donepezil administration, 30 minutes after administration, 1, 2, 3, 4, 6, And MRT were compared using a noncompartmental pharmacokinetics data analyzer program (PK solutions 2.0; Summit, Montrose, CO, USA).

1.3.1. Concentration of donepezil in blood

In donepezil alone or in combination with donepezil and boariguan, donepezil was detected in blood from 30 minutes after each administration and was continuously detected until 24 hours after administration. On the other hand, significant changes in plasma donepezil concentrations compared with donepezil 10 mg / kg alone group were not observed during the whole blood collection time in donepezil and booster group (Fig. 2).

In the donepezil group, the plasma donepezil concentrations at 30 minutes, 1, 2, 3, 4, 6, 8 and 24 hours after administration were -6.42, -10.22, and 4.23 , 19.06, 10.45, 6.83, 4.96 and -69.57%, respectively.

1.3.2. Change in Tmax

In the donepezil group, donepezil had a Tmax of 0.70 ± 0.27hr, which was significantly lower than that of donepezil alone (0.80 ± 0.27hr) (Table 3).

Parameters Donepezil (10 mg / kg) Without BJIKT co-administration (Distill water) With BJIKT co-administration
(100 mg / kg) Tmax (hrs) 0.80 + - 0.27 0.70 + - 0.27 Cmax (ng / ml) 154.80 ± 27.78 143.04 ± 46.21 AUC _{0- t} (hr · ng / ml) 632.04 ± 213.33 715.43 + - 223.63 AUC _{0 - inf} (hr · ng / ml) 690.65 + - 214.47 732.02 ± 212.28 t _1/2 (hr) 3.56 ± 1.62 3.36 ± 0.64 MRT _inf (hr) 4.70 ± 1.53 4.50 + - 0.47

1.3.3. Change in Cmax

Serum Cmax of onepezil was 143.80 ± 46.21 ng / ml in donepezil group and 154.80 ± 27.78 ng / ml in donepezil alone group (Table 3).

1.3.4. Changes in AUC

In the donepezil group, the donepezil AUC _{0 -t} was 715.43 ± 223.63 hr · ng / ml and the AUC _{0 -t} was 13.19% higher than the donepezil alone group, which was 632.04 ± 213.33 hr · ng / The plasma donepezil AUC _{0 - inf} was also 732.02 ± 212.28 hr · ng / ml in the donepezil group and the group treated with booster wax, and 5.99% in the donepezil group compared with 690.65 ± 214.47 hr · ng / ml in the donepezil alone group (Table 3).

1.3.5. t _1/2 Change of

In the donepezil group, donepezil had a t- _1/2 ratio of 3.36 ± 0.64 hr, which was significantly lower than donepezil alone (3.56 ± 1.62 hr, -5.63%).

1.3.6. MRT _inf Change of

In the donepezil-treated group, donepezil's blood MRT _inf of 4.50 ± 0.47 hr was significantly lower than that of donepezil alone (4.70 ± 1.53 hr, -4.30%) (Table 3).

In Example 1, single-dose combination administration of the booster cocktail within 5 minutes did not significantly affect the absorption and excretion of donepezil, that is, bioavailability. However, the use of the combination therapy as an effective herbal medicine for vascular dementia In order to determine the effect of donepezil on the pharmacokinetics of donepezil after repeated administration of donepezil for a period of 5 minutes or less,

Example  2. Dementia treatment donepezil  ( Aricept ^TM )and Boiling  Combined effect: Donepezil Pharmacokinetics  (2): Evaluation of effects on the pharmacokinetics (2): repeated oral administration for 7 days at 5 minutes intervals

In Example 2, in order to evaluate the interaction between Donepezil and Donepezil for 5 days, Donepezil was administered orally for 7 days in order to evaluate the interaction between Donepezil and Donepezil. Rats to evaluate the drug interaction between donepezil and boiled chrysanthemum. The dose of donepezil 10 mg / kg and the dose of 100 mg / kg was 100 mg / kg for 5 days and 7 days, and 30 minutes before the last 7 doses of donepezil, 30 minutes, 1, 2, 3, 4, 6, 8 And donepezil alone, and noncompartmental pharmacokinetics (PK) data (Cmax, Tmax, AUC, t1 / 2 and MRT) were calculated and compared with donepezil monotherapy group.

2.1. Experimental Method

2.1.1. Experimental animal

A total of 84 SPF / VAF Outbred Crl: CD [SD] male rats (OrientBio, Seungnam, Korea) were obtained. After 11 days of purification, the animals were divided into two groups (247.00 ± 9.94 g, 226 to 257 g).

- donepezil 10 mg / kg single composition administration group

- Donepezil 10 mg / kg and BJIKT 100 mg / kg for 5 min or less

2.1.2. Administration and Method of Blood Collection

Kg of donepezil (Jeil Pharm., Co., Ltd., Youngin, Korea) was dissolved in sterilized distilled water and orally administered at a dose of 5 ml / kg. Sterilized 100 mg / kg of donepezil Dissolved in distilled water, and orally administered at the same dose. Donepezil and booster wax were orally administered once a day for 7 days. In the case of donepezil alone, the same dose of sterilized distilled water was used instead of the booster wax in 5 minutes or less (Table 4, Fig. 3).

Approximately 0.5 ml of whole blood was collected from orbital veins in 50 IU of heparin (Sigma-Aldrich, St. Louis, MO, USA) for 30 min before the last 7 doses of donepezil, 30 min, and 1, 2, 3, 4, 6, Louise, MO, USA), and the plasma was separated by centrifugation at 13,000 rpm for 10 minutes immediately after collection. The separated plasma was stored at -150 ° C until LC / MS / MS analysis.

Group Sex Dose (mg / kg / day) Animal No. CIMI-14-02-15-03 D + BJIKT PK (2) Donepezil + BJIKT, within 5 min Active Male Donepezil (10 mg / kg; oral administration) C01 ~ C05 Active Male Donepezil and BJIKT (10 and 100 mg / kg; oral co-administration) D01 ~ D05

Donepezil serum concentration: Donepezil concentration was measured by LC-MS / MS using the internal standard of Carbamazepine (Sigma-Aldrich, St. Louis, Mo., USA) Chromatographic analysis was performed using Agilent 1100 Series HPLC (Agilent Technologies, Santa Clara, Calif., USA) and column effluent was analyzed using an API 2000 triple-quadruple mass spectrometer (Applied Biosystems, Foster City, CA, USA) .

HPLC conditions

Column: Waters Symmetry ( ^TM) C18 (2.1 x 50 mm, 3.5 m) (Waters Corp., Milford, Mass., USA)

Column oven: 30 ° C

Mobile phase: Linear gradient from 2% acetonitrile / 98% DI water (0.1% formic acid) to 98% acetonitrile / 2% DI water (0.1% formic acid)

Flow rate: 0.30 ml / min

Injection Volume: 4.0 μl

LC-MS / MS

Ion source: Turbo Ion Spray (500 < 0 > C)

Polarity: Positive

Carbamazepine (IS) = m / z 237 > 194 (Retention time: 0.78 min), Donepezil = 380 > 91 (Retention time: 0.39 min)

Standard Curve: Analyst 1.4.1, Linear (1 / x, no Iterate)

2.2. Check the result

Donepezil concentration (ng / ml), pharmacokinetic parameters - Cmax, Tmax, AUC, and plasma concentrations of the plasma were measured 30 minutes before the last 7 donepezil doses, 30 minutes after dosing, 1, 2, 3, 4, 6, t1 / 2 and MRT were compared using noncompartmental pharmacokinetics data analyzer program (PK solutions 2.0; Summit, Montrose, CO, USA).

2.2.1. Change in weight

Donepezil and boiled fish boots Within 5 minutes, the changes in body weight and body weight were not recognized during the experimental period (Table 5, Fig. 4).

Groups Donepezil (10 mg / kg) Without BJIKT co-administration (Distill water) With BJIKT co-administration (100 mg / kg) Body weights At first co-administration [A] 225.20 ± 12.56 223.60 ± 7.89 At last 7 th co-administration [B] 257.60 ± 16.04 256.80 + - 8.64 Body weight gains Experimental periods [B] [A] 32.40 + - 5.03 33.20 ± 2.17

2.2.2. Concentration of donepezil in blood

Donepezil or donepezil and donepezil in the 5 min intravenous group started to detect donepezil in the blood from the 30th minute before the last 7 doses of donepezil and were continuously detected until 24 hours after administration. On the other hand, significant changes in plasma donepezil concentrations were not observed during the whole blood collection period in the donepezil group and donepezil group treated with 7 times repeated oral administration within 5 minutes compared with donepezil alone group (Fig. 5).

Donepezil and donepezil were given 30 minutes after the administration of 7 times orally in 5 minutes and donepezil alone at 1, 2, 3, 4, 6, 8 and 24 hours after administration. 5.02, 11.84, 17.76, 8.53, 31.18, 25.93, 29.04 and -47.09%.

2.2.3. Change in Tmax

The donepezil plasma Tmax was 0.60 ± 0.22 hr and the donepezil dose was significantly lower than that of donepezil alone (16.67%) in the donepezil group and donepezil group Table 6).

Parameters Donepezil (10 mg / kg) Without BJIKT co-administration (Distill water) With BJIKT co-administration
(100 mg / kg) C _max (ng / ml) 0.60 + 0.22 0.70 + - 0.27 T _max (hrs) 234.80 ± 63.79 263.20 ± 61.76 AUC _{0- t} (hr · ng / ml) 877.56 ± 184.71 1124.85 + - 371.28 AUC _{0 - inf} (hr · ng / ml) 931.41 + - 211.23 1152.80 ± 351.93 t _1/2 (hr) 3.06 ± 1.43 2.99 ± 1.14 MRT _inf (hr) 3.88 ± 1.05 3.94 + - 0.77

2.2.4. Change in Cmax

The plasma Cmax of donepezil was 263.20 ± 61.76 ng / ml, which was 7.69% less than that of donepezil alone (243.80 ± 63.79 ng / ml) in the group treated with donepezil and booster (Table 6).

2.2.5. Changes in AUC

The donepezil AUC _0-t and AUC _{0 - inf} were 1124.85 ± 371.28 and 1152.80 ± 351.93 hr · ng / ml, respectively, in the donepezil and booster treatments group, AUC _{0 - t} and AUC _{0 - inf} were 28.18 and 23.77%, respectively, compared to 184.71 and 931.41 ± 211.23 hr · ng / ml, respectively (Table 6).

2.2.6. t _1/2 Change of

The donepezil plasma t _1/2 was 2.99 ± 1.14 hr in donepezil and 3.06 ± 1.43 hr in donepezil alone group, and the difference was -2.28% in donepezil alone group. (Table 6).

2.2.7. MRT _inf Change of

The donepezil serum donor MRT _inf of 3.94 ± 0.77 hr and 3.88 ± 1.05 hr of donepezil alone were significantly lower than those of donepezil and risepezil alone 6).

As a result of Example 2, all of the experimental animals used in this experiment showed normal weight gain within the weight gain range of normal male SD rats of the same week, and donepezil and boiled rice tiger were repeatedly administered for 7 days within 5 minutes No significant changes in body weight and body weight were observed in the treated group compared to the donepezil alone group.

Donepezil is well absorbed during oral administration, has a bioavailability of 100%, and is known to be unaffected by food intake and administration time. Donepezil has a very high protein binding rate of 96%, approximately 75% binds to albumin and the remaining 21% binds to α1-acid glycoprotein. In healthy adults, Tmax is generally known to be 3 to 4 hours orally, and is relatively slowly excreted in the urine and feces through the kidneys and feces, and t1 / 2 is known to be approximately 70 hours. On the other hand, unlike humans, rats are known to have a Tmax of 0.5 to 1 hr and a t1 / 2 of about 1.5 to 2 hours after single oral administration. The results of this Example 2, donepezil alone was observed in the 7-day repeated oral administration group Tmax was 0.60 ± 0.22 hr _{at, Cmax, AUC 0 -t, AUC} 0 - inf, t 1/2 and MRT _inf is respectively 243.80 ± 63.79 ng / ml, 877.56 ± 184.71 hr · ng / ml, 931.41 ± 211.23 hr · ng / ml, 3.06 ± 1.43 hr and 3.88 ± 1.05 hr. The donepezil 10 mg / kg and Bu ikgitang 100 mg / kg to less than 5 minutes in the test group treated 7-day repeated oral donepezil combination of _{Tmax, Cmax, AUC 0 -t,} AUC 0 - _inf a, t _1/2 and MRT _inf Were observed at 0.70 ± 0.27 hr, 263.20 ± 61.76 ng / ml, 1123.85 ± 371.28 hr · ng / ml, 1152.80 ± 351.93 hr · ng / ml, 2.99 ± 1.14 hr and 3.94 ± 0.77 hr, respectively, and donepezil 10 mg / kg alone , Respectively, compared with the group treated with donepezil alone, but not significantly different from those treated with donepezil alone.

Donepezil is easily metabolized into four metabolites in the first pass, two of which are known to be the major active substances, and donepezil is easily metabolized by cytochrome P450 isoenzymes CYP2D6 and CYP3A4, and therefore, drug interactions with these isoenzymes It is known that it can be shown. The repeated oral administration of donepezil 10 mg / kg and 100 mg / kg of saline for 5 days and 7 days in this Example 2 did not significantly affect the oral bioavailability of donepezil as a whole, and the oral administration of donepezil Concomitant administration is expected to provide a new method for treating patients with dementia by using additional pharmacokinetic experiments or toxicity reduction effects.

Example  3. Dementia treatment Donepezil and Boiled rice cake  ( BJIKT ) Combination of  Administration: pMCAO  Effect of Combination of BJIKT on the Improvement of Brain Function in Donepezil in Vascular Dementia Rats

In Example 3, the effects of donepezil on the neuroprotection, cognition, and motor function recovery effects of BJIKT in combination with the results of Examples 1 and 2 were evaluated using pMCAO rats, which are representative stroke and vascular dementia models . BJIKT 400, 200, and 100 mg / kg were dissolved in sterilized distilled water and were orally administered in combination with 10 mg / kg donepezil at intervals of 5 minutes or less every 28 days from 24 hours after induction of pMCAO. The body weight, brain weight, TTC The expression of STAT3 and Pim-1 mRNA, which are known to regulate apoptosis, was examined by real-time RT-PCR. Infarct / defect volume, neurological motor behavior, Histopathological examination of the cerebral atrophy and the number of denatured neurons in the area around the defect (sixth coronal section) revealed that apoptosis index (cleaved caspase-3 and PARP), iNOS-related oxidative stress index (NT) (4-HNE) immunoreactive neurons were observed by ABC-based immunohistochemistry. In addition, changes in the antioxidant defense system (lipid peroxidation - MDA content, GSH content, SOD and CAT activity) in the infarct / defect peripheral cerebral cortex were also observed. In the third embodiment, the limb placing test and the body swing test were measured by neurological exercise test 1 day before pMCAO, 1, 3, 7, 14, 21 and 28 days after pMCAO, Tests were measured after 14 and 28 days of pMCAO, respectively. Experimental results in all BJIKT and donepezil 10 mg / kg co-administered groups within 5 minutes showed that donepezil 10 mg / kg group and BJIKT 400 mg / kg group alone, which are typical oral ACE inhibitors frequently used for symptom relief and treatment of various dementia, Respectively. The dose of donepezil used in this Example 3, 10 mg / kg, was selected based on the results of previous in vivo evaluation of efficacy of the drug, and the dose of BJIKT 400, 200 or 100 mg / Administration was set on the basis of Examples 1 and 2. In Example 3, an appropriate dose of BJIKT (80, 40 or 20 mg / ml concentration) or donepezil (2 mg / ml concentration) was dissolved in sterile distilled water and the dose of 5 ml / kg , And 5 minutes apart (Table 7; Fig. 6).

3.1. Experimental Method

3.1.1. Experimental animal

A total of 150 6 week-old male SPF / VAF Crl: CD1 [SD] rats (OrientBio, Seungnam, Korea) were obtained and after purging for 52 days, 140 pMCAO surgeries were performed. operation. After 24 hours of pMCAO or sham surgery, body weight (sham rats: 495.25 ± 23.43 g, 457.00 to 522.00 g; pMCAO rats: 491.77 ± 14.32 g, 462.00 to 522.00 g), neurokinetic test - body swing test PMCAO rats: 1.98 ± 0.81 ipsilateral swings, 1.00 to 4.00 ipsilateral swings), forelimb placing test (sham rats: 0.50 ± 0.76 scores, 0.00 to 2.00 scores; pMCAO rats (all max scores = 12.00) and hindlimb placing test (sham rats: 0.63 占 .2 scores, 0.00 ~ 1.00 scores; pMCAO rats: all max scores = 6.00). All experimental animals were subjected to overnight cessation (18 hours or more; no negative water fasting) before pMCAO or sham surgery and before the final sacrifice day to reduce individual differences in feed intake (Table 7, Fig. 6).

(1) sham control group: sterile distilled water (5 ml / kg) after stomach operation twice at intervals of 5 minutes Surgical medium Control group

(2) pMCAO control: sterilized distilled water (5 ml / kg) after pMCAO operation 2 times every 5 minutes pMCAO medium control

(3) Donepezil: Donepezil 10 mg / kg and sterile distilled water (5 ml / kg) for 5 minutes after pMCAO operation donepezil 10 mg / kg single administration

(4) BJIKT: sterilized distilled water (5 ml / kg) after pMCAO operation and BJIKT 400 mg / kg every 5 minutes BJIKT 400 mg / kg single composition administration group

(5) DB400: Concomitant administration of donepezil 10 mg / kg and BJIKT 400 mg / kg for 5 minutes after pMCAO surgery

(6) DB200: Concomitant administration of donepezil 10 mg / kg and BJIKT 200 mg / kg for 5 min after pMCAO surgery

(7) DB100: Concomitant administration of donepezil 10 mg / kg and BJIKT 200 mg / kg for 5 minutes after pMCAO operation

Group Surgery Dose (mg / kg / day) Animal No. CIMI-16-02-03 D + BJIKT PD : Effects on pMCAO Rats Control Sham Distilled water 5 ml / kg R01 ~ R08 Control pMCAO Distilled water 5 ml / kg R09 to R16 Reference pMCAO Donepezil single formula ( 10 mg / kg) R17 to R24 Reference pMCAO BJIKT single formula ( 400 mg / kg) R25 to R32 Active pMCAO Donepezil and BJIKT ( 10 and 400 mg / kg) R33 to R40 Active pMCAO Donepezil and BJIKT ( 10 and 200 mg / kg) R41 to R48 Active pMCAO Donepezil and BJIKT ( 10 and 100 mg / kg) R49 to R56

3.1.2. pMCAO surgery

The right proximal MCA was permanently closed to induce focal ischemic infarction of the cerebral cortex. (Hana Pharm. Co., Hwasung, Korea) and 70% isoflurane were administered using a rodent anesthesia device (Surgivet, Waukesha, Wis., USA) and a ventilator (Model 687, Harvard Apparatus, Cambridge, UK) % and systemic inhalation anesthesia with N ₂ O and 28.5% O ₂ gas mixture and maintained under anesthesia with 1 ~ 1.5% isoflurane, enrofloxacin ( 5 mg / kg, Neotril-50 injection, SamU Median Co., Yesan, Korea) the After the intraperitoneal injection, the right temporal skin was cut between the orbit and the external auditory canal to expose the temporalis muscle, and the facial nerve and zygomatic arch were excised, Some were exposed. Subsequently, proximal MCA was exposed through subtemporal craniectomy using a dental drill (Strong 204, Saeshin, Daegu, Korea) and then an electronic coagulator immediately underneath the cerebral vein near the olfactory tract (Change-A TipTM, Aaron Medical Ind. , FL, USA) was used to permanently close the proximal MCA. Sham MCAO exposed the proximal MCA in the same manner as in pMCAO and closed the window without electronic coagulation. The body temperature was maintained constant at 37.0 ± 1 ℃ using a rectal thermometer and a thermal pad after inhalation general anesthesia. Povidone Iodine (BetadineTM, Korea Pharma, Hwasung, Korea) was applied and protected after surgery. The overall mortality rate was 5 %.

3.1.3. drug injection

BJIKT 400, 200, and 100 mg / kg were dissolved in sterilized distilled water and were orally administered in combination with 10 mg / kg donepezil at intervals of less than 5 minutes within 28 days from once every 24 hours after pMCAO induction. (53 mg as donepezil tablet - Silvercept ™ (Myung In Pharm. Co., Ltd., Hwasung, Korea) at an appropriate dose of BJIKT (80, 40 or 20 mg / ml) or donepezil Dissolved or suspended in distilled water and administered in combination with gastric gavage using a metal sonde attached to a 5 ml syringe at a dose of 5 ml / kg, which is a general oral dose of rat, within 5 minutes. BJIKT alone was administered in the same dose (5 ml / kg) sterilized distilled water instead of donepezil at 5 minute intervals. In the case of donepezil alone, BJIKT was administered in the same dose of sterilized distilled water at 5 minute intervals. In the sham and pMCAO control group, only sterile distilled water medium was administered orally twice daily for 28 days at 28-day intervals from 24 hours after pMCAO induction. The dosing dose of donepezil used in Example 3, 10 mg / kg, was compared with the previous in vivo efficacy evaluation [Takasaki et al., 2011; Hu et al., 2012], and the administration of BJIKT doses of 400, 200 or 100 mg / kg and the interval of less than 5 min were set on the basis of Examples 1 and 2 (Table 7 6).

3.1.4. Observations

Through the above method, weights, brain weights, infarct / defect volume through TTC staining, neurological and cognitive athletic behavior tests, mRNA expression in the infarct / defect peripheral cerebral cortex (sixth coronal section) System, histological and immunohistochemical changes were confirmed.

(1) Measurement of body weight: The body weights of all experimental animals were measured after pMCAO 1 day, pMCAO operation day 1, 8, 15, 22, 28 and 29 days.

(2) Neurologic motor behavior test: Forelimb placing test (scores, Max = 12), hindlimb placing test (scores, Max = 6) and body swing test (numbers and percentages of ipsilateral swings) were measured 1 day before pMCAO (base line), pMCAO 1, 3, 7, 14, 21, and 28 days respectively.

(3) Cognitive Exercise Test: Water maze test was measured after 14 and 28 days of pMCAO, respectively. All animals were monitored for changes in cognition and learning ability by measuring the distance and time to reach a water maze tank (150 × 50 cm) escape platform (15 × 30 cm) over 3 trials.

(4) Brain weight and infarct / defect volume: Brain tissues were harvested at the final sacrifice day, and absolute weight and relative weight (% relative weight with respect to body weight) were measured, and brain stainless steel coronal matrix (Harvard apparatus, Holliston, MA Sixteen consecutive 2-mm-thick sections of brain tissue were stained with 2% TTC (Cat No. T8877, Sigma-Aldrich, St. Louis, MO, USA) (ISolution FL ver. 9.1, IMT i-solution Inc., Canada) using the formula of infarct / defect region observed in the infarct / defect region of six cerebral slices × 2 mm (thicknesses) .

(5) Realtime RT-PCR: Expression of STAT3 and Pim-1 mRNA was measured using a CFX96 ™ Real-Time System (Bio-Rad, Hercules, CA, USA) and a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, ) Were used to calculate relative expressions / β-actin mRNA (Table 8)

(6) Antioxidant defense system: lipid peroxidation MDA content, GSH content, SOD and CAT activity were measured using UV / VIS spectrophotometer (OPTIZEN POP, Mecasys, Daejeon, Korea)

(7) Histologic observation: infarct / defect peripheral cerebral cortical atrophy and number of denatured nerve cells

(8) Immunohistochemical observations: Cleaved caspase-3 and PARP, iNOS-related oxidative stress (NT) and lipid peroxidation index (4-HNE)

Target 5 '3' Sequence NCBI accession No.
(Production size) STAT 3 Sense
Antisense GAGGGCCATCCTAAGCACAAAGC
GGACATCGGCAGGTCAATGGTATT NM_012747
(400 bp) Pim-1 Sense
Antisense TGCTCTTGTCCAAGATCAACTCCCT
AGGGAGTTGATCTTGGACAAGAGCA NM_017034
(422 bp) β-actin Sense
Antisense CTGTCGAGTCGCGTCCACCCGCGAG
CTCGCGGGTGGACGCGACTCGACAG NC_000071.6
(341 bp)

Antisera or detection kits Code Source Dilution Primary antisera * Anti-cleaved caspase-3 (Asp175) polyclonal antibody 9661 Cell Signaling Technology Inc., Beverly, MA, USA 1: 400 Anti-cleaved PARP (h215) antibody sc-23461 Santa Cruz Biotechnology, Santa Cruz, CA, USA 1: 100 Anti-4-Hydroxynonenal polyclonal antibody Ab46545 Abcam, Cambridge, UK 1: 200 Anti-Nitrotyrosine polyclonal antibody 06-284 Millipore, Temecula, CA, USA 1: 100 Detection kits Vectastain Elite ABC Kit PK-6200 Vector Lab. Inc., Burlingame, CA, USA 1:50 Peroxidae substrate kit SK-4100 Vector Lab. Inc., Burlingame, CA, USA 1:50

3.2. Experiment result

3.2.1. Changes in body weight and weight gain

In the pMCAO control group, a significant (p <0.01) decrease in body weight was observed after 8 days of pMCAO operation and 7 days after the administration of pMCAO, and the gain in pMCAO operation was also significantly decreased (p <0.01) (P <0.01 or p <0.05) was significantly higher in the donepezil and BJIKT alone groups than in the pMCAO control group at 28 and 29 days of pMCAO operation, respectively. (P < 0.01) < / RTI &gt; In addition, a significant (p <0.01 or p <0.05) increase in body weight compared to pMCAO control group was observed in the combination of donepezil 10 mg / kg and BJIKT 400, 200 and 100 mg / (p <0.01) increased compared to pMCAO control group. (P <0.01 or p <0.05) significantly increased (p <0.01 or p <0.05) compared to donepezil 10 mg / kg alone and the BJIKT 400, 200 and 100 mg / , 28 and 28 days after the start of treatment, significant increases (p &lt; 0.01) in the amount of body weight gain for 29 days of pMCAO surgery were recognized, respectively, depending on the dose of BJIKT combination administration (Table 10;

In the pMCAO control group, the weight gain at the final sacrifice day (body weight at the final sacrifice day) was -97.30% as compared with the sham control group, but donepezil 10 mg / kg and BJIKT 400 mg / kg alone Compared with the pMCAO control group, the concentrations of donepezil 10 mg / kg and BJIKT 400, 200 or 100 mg / kg administered within 5 minutes showed a change of 1112.50, 893.75, 2562.50, 2262.50 and 1931.25%, respectively.

Periods

Groups Body weights (g) Weight gains
[BA]  1 day before pMCAO The day of pMCAO [A] Sacrifice [B] Controls Sham 505.13 + - 22.13 485.13 + - 22.36 559.25 + - 27.16  74.13 ± 6.13 pMCAO 506.00 ± 11.31 486.25 ± 12.76 488.25 ± 12.38a  2.00 ± 1.69a Single formula treated Donepezil 506.25 ± 18.23 486.38 ± 17.55 510.63 ± 12.18 ac  24.25 ± 6.14 ac BJIKT 505.63 + - 11.30 486.25 + 14.91 506.13 ± 12.89ad  19.88 ± 5.57 ac Donepezil 10 mg / kg and BJIKT co-administration 400 mg / kg 505.88 +/- 13.54 484.75 ± 14.34 538.00 ± 13.53bce 53.25 ± 8.00 ace 200 mg / kg 506.13 ± 15.99 485.50 ± 18.69 532.75 ± 19.48 47.25 ± 7.52ace 100 mg / kg 506.75 ± 12.43 487.63 + - 13.37 528.25 ± 8.65acf 40.63 ± 7.33

3.3.2. Neurological behavioral test - Forelimb placing test

Neurological behavioral behavior test after 24 hours of pMCAO surgery - Only the test animals with the forelimb placing test score of Max (= 12) were selected. Therefore, the increase of the forelimb placing test score in the pMCAO control group was significant (p <0.01) (P <0.01 or p <0.05) in the donepezil and BJIKT alone groups compared to the pMCAO control group, respectively. The decrease of the forelimb placing test score was significantly higher in the pMCAO group than in the pMCAO group (P <0.01). However, a decrease in the forelimb placing test score was observed in 7 days after pMCAO treatment in the combination of donepezil 10 mg / kg and BJIKT 400 mg / kg within 5 minutes (p <0.01 or p <0.05) compared with pMCAO control group in combination with donepezil 10 mg / kg and BJIKT 200 and 100 mg / kg within 5 min. Since it started to recognize. Particularly, the decrease in the forelimb placing test score was significantly (p <0.01) higher in donepezil 10 mg / kg and BJIKT 400, 200 and 100 mg / kg in 5 min compared to donepezil 10 mg / , 14 and 14 days after the administration of BJIKT (Table 11).

Groups
After pMCAO Controls Single formula treated Donepezil 10 mg / kg and BJIKT co-administration Sham pMCAO Donepezil BJIKT 400 mg / kg 200 mg / kg 100 mg / kg Day -1 0.63 + 0.74 0.75 + 0.71 0.63 + - 0.52 0.63 + 0.74 0.75 + 0.71 0.63 + 0.74 0.63 + 0.74 Day 1 0.50 + - 0.76 12.00 ± 0.00 ^e 12.00 ± 0.00 ^e 12.00 ± 0.00 ^e 12.00 ± 0.00 ^e 12.00 ± 0.00 ^e 12.00 ± 0.00 ^e Day 3 0.63 + 0.74 10.63 ± 0.92 ^a 10.50 + 0.76 ^a 10.75 ± 0.89 ^a 10.38 ± 0.74 ^a 10.25 + 1.04 ^a 10.13 ± 1.46 ^a Day 7 0.88 ± 0.83 9.88 ± 0.64 ^a 9.50 + 0.76 ^a 9.63 ± 0.74 ^a 8.13 ± 1.25 ^usd 8.88 + 0.83 ^ac 9.13 ± 1.25 ^usd Day 14 0.75 + 0.71 9.63 ± 0.52 ^a 8.50 ± 0.53 ^ab 8.75 + 0.46 ^ac 6.25 ± 1.16 ^usd 7.13 ± 0.64 ^usd 7.38 ± 0.92 ^usd Day 21 0.75 + 0.89 9.13 ± 0.83 ^a 7.38 ± 0.74 ^ab 8.13 ± 0.83 ^ac 4.50 ± 0.93 ^usd 5.50 ± 0.93 ^usd 6.13 ± 0.64 ^usd Day 28 0.63 + 0.74 8.25 ± 1.28 ^a 6.50 ± 0.53 ^ab 6.88 ± 0.83 ^ab 2.25 ± 0.46 ^usd 3.13 ± 0.64 ^usd 4.50 ± 0.93 ^usd

Forelimb placing test scores at 1, 3, 7, 14, 21, and 28 days after pMCAO control in the pMCAO control group were 2300.00, 1600.00, 1028.57, 1183.33, 1116.67 and 1220.00%, respectively, compared with the sham control group.

After 1, 3, 7, 14, 21 and 28 days of donepezil 10 mg / kg single-composition administration, the forelimb placing test score was 0.00, -1.18, -3.80, -11.69, -19.18 and -21.21 %, Respectively.

The forelimb placing test scores were 0.00, 1.18, -2.53, -9.09, -10.96, and -16.67%, respectively, after pMCAO surgery on days 1, 3, 7, 14, 21 and 28 of the BJIKT 400 mg / Respectively.

Forelimb placing test scores were 0.00, -2.35, and -17.72, respectively, after pMCAO surgery on days 1, 3, 7, 14, 21, and 28 of Donepezil 10 mg / kg and BJIKT 400 mg / -35.06, -50.68 and -72.73%, respectively.

Forelimb placing test scores were 0.00, -3.53, -10.13, and -4.0, respectively, after pMCAO surgery on days 1, 3, 7, 14, 21 and 28 of Donepezil 10 mg / kg and BJIKT 200 mg / -25.97, -39.73 and -62.12%, respectively.

The forelimb placing test scores were 0.00, -4.71, -7.59, and -7.59, respectively, on the 1, 3, 7, 14, 21, and 28 days after pMCAO operation in the donepezil 10 mg / kg and BJIKT 100 mg / -23.38, -32.88 and -45.45%, respectively.

3.2.3. Neurological behavioral testing - Hindlimb placing test

Neurological behavioral behavior test after 24 hours of pMCAO surgery The hindlimb placing test score was significantly higher in the pMCAO control group than in the sham control group (p <0.01) (P <0.01 or p <0.05) in the donepezil and BJIKT alone groups compared to the pMCAO control group, but the decrease in the hindlimb placing test score was not statistically significant (P <0.01), but the decrease in hindlimb placing test score was significantly higher in the group treated with donepezil 10 mg / kg and BJIKT 400 and 200 mg / kg within 5 minutes than in the control group (P <0.01 or p <0.05) compared with pMCAO control group in combination with donepezil 10 mg / kg and BJIKT 100 mg / kg within 5 min. It began to be recognized after 14 days of drinking. Particularly, there was a significant (p <0.01 or p <0.05) decrease in the hindlimb placing test score in donepezil 10 mg / kg and BJIKT 400, 200 and 100 mg / Were started to be recognized in a dose-dependent manner in combination with BJIKT after 7, 7, and 14 days of pMCAO operation (Table 12).

Groups
After pMCAO Controls Single formula treated Donepezil 10 mg / kg and BJIKT co-administration Sham pMCAO Donepezil BJIKT 400 mg / kg 200 mg / kg 100 mg / kg Day -1 0.38 + - 0.52 0.38 + - 0.52 0.25 + - 0.46 0.38 + - 0.52 0.38 + - 0.52 0.50 ± 0.53 0.38 + - 0.52 Day 1 0.63 + - 0.52 6.00 ± 0.00 ^f 6.00 ± 0.00 ^f 6.00 ± 0.00 ^f 6.00 ± 0.00 ^f 6.00 ± 0.00 ^f 6.00 ± 0.00 ^f Day 3 0.50 ± 0.53 5.63 ± 0.52 ^a 5.38 + 0.74 ^a 5.75 + 0.46 ^a 5.25 ± 0.46 ^a 5.13 + 0.83 ^a 5.25 ± 0.71 ^a Day 7 0.63 + 0.74 5.25 ± 0.46 ^a 5.00 ± 0.53 ^a 5.13 + 0.64 ^a 3.88 ± 0.35 ^usd 4.13 ± 0.64 ^usd 4.75 ± 0.89 ^a Day 14 0.63 + - 0.52 4.88 ± 0.64 ^a 3.88 ± 0.64 ^ab 4.00 0.76 ^ab 2.88 ± 0.64 ^usd 3.00 ± 0.76 ^usd 3.13 ± 0.35 ^abe Day 21 0.50 ± 0.53 4.63 ± 0.74 ^f 3.38 ± 0.52 ^fg 3.75 ± 0.71 ^fh 2.38 ± 0.52 ^fgi 2.50 ± 0.53 ^fgj 2.88 ± 0.35 ^fg Day 28 0.63 + - 0.52 4.38 ± 0.52 ^a 3.25 ± 0.71 ^ab 3.50 + 0.76 ^ac 1.63 ± 0.52 ^usd 2.00 ± 0.76 ^usd 2.38 ± 0.74 ^abe

Forelimb placing test scores at 1, 3, 7, 14, 21, and 28 days after pMCAO control in the pMCAO control group were 860.00, 1025.00, 740.00, 680.00, 825.00 and 600.00%, respectively, compared to the sham control group.

The hindlimb placing test scores were 0.00, -4.44, -4.76, -20.51, -27.03 and -25.71, respectively, when compared with the pMCAO control group after 1, 3, 7, 14, 21 and 28 days of pMCAO operation in the donepezil 10 mg / %, Respectively.

The hindlimb placing test scores were 0.00, 2.22, -2.38, -17.95, -18.92, and -20.00%, respectively, after pMCAO surgery on days 1, 3, 7, 14, 21 and 28 of BJIKT 400 mg / Respectively.

The hindlimb placing test score was 0.00, -6.67, -26.19, and 0.61, respectively, on the 1, 3, 7, 14, 21, and 28 days after pMCAO operation in donepezil 10 mg / kg and BJIKT 400 mg / -41.03, -48.65 and -62.86%, respectively.

The hindlimb placing test scores were 0.00, -8.89, and -21.43, respectively, after pMCAO surgery on days 1, 3, 7, 14, 21, and 28 of Donepezil 10 mg / kg and BJIKT 200 mg / -38.46, -45.95 and -54.29%, respectively.

The hindlimb placing test scores were 0.00, -6.67, -9.52, and -0.67, respectively, on the 1, 3, 7, 14, 21, and 28 days after pMCAO operation in donepezil 10 mg / kg and BJIKT 100 mg / -35.90, -37.84 and -45.71%, respectively.

3.2.4. Neurological Exercise Test - Body swing test

Neurological Exercise Behavior after 24 hours of pMCAO surgery - Body swing test was used to select only those animals with similar body swing counts to the ipsilateral side (right side). Therefore, pMCAO control group was significantly higher than sham control group (p <0.01 (P <0.05). However, the number of body swings and the rate of decrease in the number of body swings to the right side were recognized after pMCAO surgery on days 1, 3, 7, 14, 21 and 28, (P <0.001), but the number of body swings and the rate of body swing began to be recognized after 14 days of pMCAO surgery, and that of donepezil 10 mg / kg and BJIKT 400, 200 and 100 mg / Or p <0.05). The increase in the number and proportion of body swings to the right side began to be recognized after 7 days of pMCAO surgery. Particularly, there was a significant (p <0.01 or p <0.05) increase in the number of body swings to the right side compared with the administration of donepezil 10 mg / kg alone and donepezil 10 mg / kg and BJIKT 400, 200 and 100 mg / And increase in the ratio began to be recognized in a dose-dependent manner in combination with BJIKT starting from 7 days after pMCAO surgery (Tables 13 and 14).

Groups
After pMCAO Controls Single formula treated Donepezil 10 mg / kg and BJIKT co-administration Sham pMCAO Donepezil BJIKT 400 mg / kg 200 mg / kg 100 mg / kg Day -1  15.38 ± 1.06  15.50 + - 0.93  15.75 + 1.04  15.50 ± 1.20  15.50 + - 1.07  15.50 ± 1.20  15.75 + 1.04 Day 1  13.38 + - 0.74 1.88 ± 0.83 ^a 1.88 ± 0.83 ^a 1.75 + 0.89 ^a 2.13 + 0.64 ^a 2.13 + - 0.99 ^a 2.13 + 0.83 ^a Day 3  13.75 + 0.71 2.25 ± 0.71 ^a 2.38 ± 0.74 ^a 2.13 + 0.64 ^a 2.38 ± 0.74 ^a 2.63 ± 0.92 ^a 2.75 ± 1.39 ^a Day 7  14.38 ± 0.92 3.00 ± 0.53 ^a 3.13 + 0.64 ^a 3.13 ± 0.35 ^a 5.88 ± 1.25 ^usd 4.75 ± 1.28 ^usd 4.13 ± 0.99 ^ace Day 14  14.88 ± 0.83 3.38 ± 0.74 ^f 6.25 ± 1.16 ^fg 4.63 ± 0.52 ^fg 9.13 ± 1.46 ^fgh 8.13 ± 0.64 ^fgh 7.75 ± 0.71 ^fgi Day 21  14.88 ± 0.83 3.75 ± 0.89 ^f 7.75 ± 1.28 ^fg 5.63 + - 0.74 ^fg 10.13 ± 1.74 ^fgi 9.75 + 0.71 ^fgh 9.38 ± 1.19 ^fgi Day 28  15.25 + 0.89 4.63 ± 1.30 ^a 8.88 ± 1.46 ^ab 6.25 ± 0.89 ^ab 12.88 ± 1.36 ^usd 12.00 ± 0.93 ^usd 10.50 ± 0.76 ^usd

Groups
After pMCAO Controls Single formula treated Donepezil 10 mg / kg and BJIKT co-administration Sham pMCAO Donepezil BJIKT 400 mg / kg 200 mg / kg 100 mg / kg Day -1 51.25 + - 3.54 51.67 ± 3.09 52.50 ± 3.45 51.67 ± 3.98 51.67 ± 3.56 51.67 ± 3.98 52.50 ± 3.45 Day 1 44.58 + - 2.48 6.25 ± 2.78a 6.25 ± 2.78a 5.83 ± 2.95a 7.08 ± 2.14a 7.08 ± 3.30a 7.08 ± 2.78a Day 3 45.83 + - 2.36 7.50 + - 2.36a 7.92 + - 2.48a 7.08 ± 2.14a 7.92 + - 2.48a 8.75 + - 3.05 a 9.17 + - 4.63a Day 7 47.92 + - 3.05 10.00 ± 1.78a 10.42 ± 2.14 a 10.42 + 1.18a 19.58 + 4.15abd 15.83 ± 4.27abd 13.75 ± 3.30ace Day 14 49.58 ± 2.78 11.25 + 2.48f 20.83 ± 3.88fg 15.42 ± 1.73fg 30.42 + - 4.86fgh 27.08 + - 2.14fgh 25.83 ± 2.36fgi Day 21 49.58 ± 2.78 12.50 + 2.95f 25.83 + - 4.27fg 18.75 ± 2.48fg 33.75 ± 5.76fgi 32.50 ± 2.36fgh 31.25 ± 3.96fgi Day 28 50.83 + - 2.95 15.42 + - 4.34a 29.58 ± 4.86ab 20.83 ± 2.95ab 42.92 + 4.52abd 36.67 ± 3.09abd 35.00 + 2.52abd

The number and proportion of body swings to the right after 1, 3, 7, 14, 21, and 28 days of pMCAO control in the pMCAO control group were -85.98, -83.64, -79.13, -77.31, -74.79, and -69.67% Respectively.

The number and proportion of body swings to the right after 1, 3, 7, 14, 21, and 28 days of pMCAO operation in the donepezil 10 mg / kg single composition administration group were 0.00, 5.56, 4.17, 85.19, 106.67, and 91.89% Respectively.

The number and proportion of body swings to the right after 1, 3, 7, 14, 21, and 28 days of pMCAO operation in the BJIKT 400 mg / kg single composition administration group were -6.67, -5.56, 4.17, 37.04, 35.14%, respectively.

The number and proportion of body swings on the right side after 1, 3, 7, 14, 21, and 28 days of pMCAO operation in donepezil 10 mg / kg and BJIKT 400 mg / kg within 5 min were 13.33, 5.56, 95.83, 170.37, 170.00 and 178.38%, respectively.

The number and proportion of body swings on the right side after 1, 3, 7, 14, 21, and 28 days of pMCAO operation in donepezil 10 mg / kg and BJIKT 200 mg / kg 5 min group were 13.33, 16.67, 58.33, 140.74, 160.00 and 137.84%, respectively.

The number and proportion of body swings on the right side after 1, 3, 7, 14, 21, and 28 days of pMCAO operation in donepezil 10 mg / kg and BJIKT 100 mg / kg within 5 min were 13.33, 22.22, 37.50, 129.63, 150.00 and 127.03%, respectively.

3.2.5. Cognitive athletic behavior test - Water maze test

In the Sham control group, the travel distance and time from the water maze tank to the escape platform were significantly reduced at each trial, but the pMCAO control group showed a significant (p <0.01) increase in distance traveled to the escape platform pMCAO 14 days trial 2 and 3, and pMCAO 28 days, and the increase in reach time to the escape platform was confirmed in all trials of 14 and 28 days of pMCAO, Lt; / RTI &gt; (P <0.01 or p <0.05) compared with pMCAO control group in the experimental group treated with donepezil 10 mg / kg alone, the decrease in the travel distance to the escape platform was found to be 14 days after pMCAO and 28 days after pMCAO Significant (p <0.01 or p <0.05) reductions in travel time to escape platform were recognized in all trials except for trial 1 after 14 days of pMCAO, respectively. Particularly, there was a significant (p <0.01 or p <0.05) shift to the escape platform in donepezil 10 mg / kg and BJIKT 400, 200 and 100 mg / (P <0.01 or p <0.05) reduction in migration time to the escape platform was observed in pMCAO 14 and 28 days after challenge in all trials after trial 3 and pMCAO 14 days after pMCAO 14 days, (Table 15 and 16), respectively.

Groups
After pMCAO Controls Single formula treated Donepezil 10 mg / kg and BJIKT co-administration Sham pMCAO Donepezil BJIKT 400 mg / kg 200 mg / kg 100 mg / kg Day 14 Trial 1 1527.5 ± 125.9 1531.5 ± 90.6 1534.8 ± 136.6 1532.8 ± 126.6 1529.8 + 137.3 1529.1 + - 135.9 1526.9 ± 119.6 Trial 2 1116.3 ± 153.5 1487.3 ± 86.0 g 1339.4 + - 66.5 g 1364.8 ± 101.2 g 1283.8 + - 107.7i 1334.5 + - 154.0 hj 1336.0 ± 101.3hi Trial 3  595.9 ± 112.7 1381.9 ± 74.2a 1177.3 ± 115.2 ac 1229.9 ± 100.7 ac  914.4 ± 109.0 1002.4 ± 157.6 1040.6 ± 101.9 acf Mean 1079.8 ± 108.2 1467.0 ± 78.3a 1350.5 ± 101.6ad 1375.8 ± 105.7a 1242.6 ± 115.0 ac 1288.7 ± 144.2 ac 1301.2 ± 103.3 ac Day 28 Trial 1 1054.9 ± 133.4 1493.1 ± 68.1a 1344.1 ± 108.7 ac 1359.8 ± 64.9 ac 1154.1 ± 81.6 bce 1200.1 ± 78.9ace 1211.9 ± 75.8 Trial 2  479.1 + - 76.7 1446.0 + - 77.7a 1118.0 ± 83.1 ac 1168.6 ± 45.7 ac  830.5 ± 78.7  906.6 ± 46.5ace  981.6 ± 34.1ace Trial 3  339.1 ± 58.5 1387.9 ± 87.1a  913.8 ± 79.6 ac  980.9 ± 57.7 ac  438.5 ± 79.1  497.5 ± 30.3ace  683.9 ± 57.2 Mean  624.4 + - 84.7 1442.3 ± 72.0a 1125.5 ± 87.4 ac 1169.8 + 49.0ac  807.7 ± 77.4ace  868.1 ± 47.9  959.1 ± 47.8

Groups
After pMCAO Controls Single formula treated Donepezil 10 mg / kg and BJIKT co-administration Sham pMCAO Donepezil BJIKT 400 mg / kg 200 mg / kg 100 mg / kg Day 14 Trial 1 123.50 ± 13.49 172.13 + - 10.60a 159.75 ± 19.48a 167.63 ± 15.35a 164.63 ± 10.06a 164.88 占 13.36a 166.25 + - 15.68a Trial 2 93.00 ± 16.02 164.50 ± 9.74a 143.25 ± 15.01ab 148.68 +/- 10.80ab 113.88 + - 8.08abc 123.00 ± 9.40abc 129.38 + - 8.14abd Trial 3 58.25 + - 10.79 149.75 ± 12.28a 105.88 ± 17.89ab 120.75 + - 11.46ab  78.00 ± 9.71abc  79.63 ± 12.94abc 88.00 ± 9.07abc Mean 91.58 ± 13.29 162.13 + - 10.27e 136.29 ± 17.07 ee 145.67 ± 11.94eg 118.83 + - 6.60 122.50 ± 11.63ef 127.88 ± 10.03ef Day 28 Trial 1 89.75 + - 4.50 162.38 ± 10.62e 139.75 ± 17.44eg 148.13 ± 9.58eg 106.25 ± 9.45efh 117.50 ± 8.30ef 121.63 + - 8.55 Trial 2 58.00 ± 10.47 153.25 + - 12.86a 115.38 ± 9.53ab 123.50 ± 8.35ab 75.63 + - 10.03abc 91.38 ± 6.97abc 97.00 ± 11.39abc Trial 3 35.00 ± 8.00 144.00 ± 10.85a  90.13 ± 12.11ab 102.50 ± 9.74ab 51.38 ± 10.32abc 57.13 ± 10.06abc 76.38 + - 8.18abc Mean 60.92 + - 6.64 153.21 ± 11.09a 115.08 ± 12.17ab 124.71 ± 8.83ab 77.75 ± 9.28abc 88.67 + - 7.25abc 98.33 ± 8.98abc

In the pMCAO control group, the travel distance to the trial 1, 2, 3 and trial average platform of the trial 1, 2, 3 and trial after 14 days of pMCAO operation and 28 days after pMCAO operation were 0.26, 33.28, The change of the travel time to the escape platform of 39.37, 76.88, 157.08, 77.02, 80.92, 164.22, 311.43 and 151.50% was shown to be 131.91, 35.85, 41.55, 201.80, 309.25 and 131.00% respectively.

In the case of Donepezil 10 mg / kg single composition, the distance to the trial 1, 2, 3 and trial average after 14 days of pMCAO operation, to the trial 1, 2, 3 and trial average platform 28 days after pMCAO operation, -9.97, -14.81, -7.95, -9.95, -22.68, -34.18, and -21.97%, respectively, and -7.19, -12.92, -29.30, -15.93, -13.93, -24.71, 37.41 and -24.88%, respectively.

In the case of the BJIKT 400 mg / kg single composition administration, the travel distance to the trial 1, 2, 3 and trial average after 14 days of pMCAO operation, to the trial 1, 2, 3 and trial average platform 28 days after pMCAO operation, -9.65, -19.37, -10.15, -8.78, -19.41, and -18.90%, respectively, 28.82 and -18.60%, respectively.

Trial 1, 2, 3 and trial averages after 14 days of pMCAO operation, 28 days after pMCAO operation, and 1, 2, 3 and trial average escape platforms of donepezil 10 mg / kg and BJIKT 400 mg / -13.71, -33.83, -15.30, -22.70, -42.57, -68.40 and -44.00%, respectively, compared with the pMCAO control group, and the shift distance to the control group was -4.36, -30.78, -47.91, 26.70, -34.57, -50.65, -64.32 and -49.25%, respectively.

Trial 1, 2, 3 and trial averages after 14 days of pMCAO operation, 28 days after pMCAO operation, and 1, 2, 3 and trial average escape platforms of donepezil 10 mg / kg and BJIKT 200 mg / -10.130, -27.46, -12.16, -19.62, -37.30, -64.15 and -39.81%, respectively, compared with the pMCAO control group, and the movement distances to -4.21, -25.23, -46.83, 24.44, -27.64, -40.38, -60.33, and -42.13%, respectively.

Trial 1, 2, 3 and trial averages after 14 days of pMCAO operation, 28 days after pMCAO operation and 1, 2, 3, and trial average escape platforms of donepezil 10 mg / kg and BJIKT 100 mg / -21.20, -24.69, -11.31, -18.84, -32.11, -50.73, and -33.50%, respectively, compared with the pMCAO control group, and -3.41, -21.35, -41.24, 21.13, -25.10, -36.70, -46.96 and -35.82%, respectively.

3.2.6. Change in brain weight

In the pMCAO control group, there was a significant (p <0.01) decrease in brain absolute and relative weight with respect to the atrophy and deficit of the peripheral pMCAO surgery area compared to the sham control group. However, all the experimental materials including the BJIKT 400 mg / (P < 0.01) in brain compared with pMCAO control group, respectively. In particular, the increase in brain weight was significantly (p <0.01 or p <0.05) higher in donepezil 10 mg / kg and BJIKT 400, 200 and 100 mg / (Figs. 8, 9 and 13).

The absolute absolute brain weights were -28.38% in the pMCAO control group compared to the sham control group, but donepezil 10 mg / kg and BJIKT 400 mg / kg alone group, donepezil 10 mg / kg and BJIKT 400, 200 or 100 mg / kg in 5 min group showed 16.76, 13.78, 35.68, 32.86 and 28.52%, respectively, in comparison with pMCAO control group.

In the pMCAO control group, the relative weight of the brain was -18.07% as compared with the sham control group, but donepezil 10 mg / kg and BJIKT 400 mg / kg alone group administration group, donepezil 10 mg / kg and BJIKT 400, 200 or 100 mg / kg in the group treated with 5 min or less, 11.69, 9.73, 23.12, 21.76 and 18.70%, respectively, as compared with the control group of pMCAO.

3.2.7. Infarct / defect volume changes

In the pMCAO control group, an infarct / defect volume characterized by a localized defect of the right cerebral cortex with pMCAO surgery was recognized and an increase in infarct / defect volume was observed (p <0.01) as compared with the sham control group. On the other hand, the decrease in cerebral cortical infarct / defect volume was significantly (p <0.01 or p <0.05) significantly higher in all experimental groups, including donepezil 10 mg / kg and BJIKT 400 mg / . In particular, the decrease in the infarct / defect volume of donepezil 10 mg / kg and the dose of BJIKT 400, 200 and 100 mg / kg within 5 min was significantly (p <0.01) lower than that of donepezil 10 mg / Respectively (Fig. 9 and 10).

Donepezil 10 mg / kg and BJIKT 400 mg / kg alone group, donepezil 10 mg / kg and BJIKT 400, 200 or 400 mg / kg, respectively, showed a change in cerebral cortical infarct / defect volume of 780.65% In the group treated with 100 mg / kg for 5 minutes or less, the change was -41.60, -27.66, -71.90, -62.44 and -58.53%, respectively, in comparison with the pMCAO control group.

3.2.8. Infarct / defect peripheral cerebral cortex (sixth coronal section) STAT3  And Pin -One mRNA  Change in expression

In the pMCAO control group, STAT and Pim-1 mRNA expression in the infarct / defect peripheral cerebral cortex was significantly decreased (p <0.01) compared to the sham control group. However, donepezil 10 mg / kg and BJIKT 200 mg / kg within 5 min In both experimental and control groups, STAT and Pim-1 mRNA expression was significantly increased in the infarct / defect peripheral cerebral cortex compared to the pMCAO control group (p <0.01). Particularly, there was statistically significant (p <0.01) statistical significance between donepezil 10 mg / kg and BJIKT 400, 200 and 100 mg / kg within 5 min compared with donepezil 10 mg / Increased expression of Pim-1 mRNA was recognized in a dose-dependent manner in combination with BJIKT (Figs. 11 and 12).

The expression of STAT3 mRNA in the peripheral cerebral cortex of the infarct / defect periphery was -60.62% as compared with the sham control group in the pMCAO control group. However, donepezil 10 mg / kg and BJIKT 400 mg / kg alone group administration group, donepezil 10 mg / kg and BJIKT In the group treated with 400, 200 or 100 mg / kg for 5 minutes or less, the changes were 57.94, 27.58, 108.79, 98.79 and 84.55%, respectively, compared with the pMCAO control group.

In the pMCAO control group, the expression of infarct / defect peripheral cerebral cortical Pim-1 mRNA was -64.09% as compared with the sham control group. However, donepezil 10 mg / kg and BJIKT 400 mg / kg and BJIKT 400, 200 or 100 mg / kg, respectively, compared with the pMCAO control group, the change was 56.94, 31.60, 141.32, 127.08 and 106.25%, respectively.

3.2.9. Infarct / defect Peripheral cortex (sixth coronal section) Changes in antioxidant defense system

3.2.9.1. Changes in lipid peroxidation

In the pMCAO control group, an increase in the MDA content indicating lipid peroxidation (p <0.01) was observed in the cerebral cortex of the infarct / defect area compared to the sham control group. However, in combination with donepezil 10 mg / kg and BJIKT 100 mg / (P <0.01) of MDA content in the peripheral cerebral cortical tissues were significantly (p <0.01) lower than those of the pMCAO control group. In particular, the concentration of MDA in the infarct / defect peripheral cerebral cortex of donepezil 10 mg / kg and BJIKT 400, 200 and 100 mg / kg within 5 min was significantly (p <0.01) (Table 17), respectively.

In the pMCAO control group, the amount of MDA in the periphery of the infarct / defect peripheral area was 336.48% as compared with that in the sham control group. However, donepezil 10 mg / kg and BJIKT 400 mg / kg single composition administration group, donepezil 10 mg / kg and BJIKT 400, 200, or 100 mg / kg in the 5 min or less group, -35.97, -35.11, -62.00, -58.10, and -50.75%, respectively, as compared with the pMCAO control group.

Index (Unit)
Groups Malondialdehyde
(nM / g tissue) Glutathione
(nM / mg protein) Catalase
(U / mg protein) SOD
(U / mg protein) Controls Sham 3.36 ± 1.46 16.01 + - 2.62 3.81 ± 0.98 190.75 ± 17.81 pMCAO 14.64 ± 3.39 ^d 3.15 ± 0.84 ^d 1.04 ± 0.25 ^d 72.88 +/- 10.76 ^a Single formula treated Donepezil 9.38 ± 1.14 ^df 5.59 + - 1.23 ^df 2.35 + - 0.42 ^df 120.63 ± 17.58 ^ab BJIKT 9.50 + - 1.37 ^df 5.40 ± 1.35 ^df 2.24 ± 0.50 ^df 133.00 ± 20.40 ^ab Donepezil 10 mg / kg and BJIKT co-administration 400 mg / kg 5.57 ± 1.28 ^efg 11.00 ± 1.60 ^dfg 4.38 ± 0.50 ^eFg 169.13 ± 11.74 ^abc 200 mg / kg 6.14 ± 1.22 ^dfg 10.16 ± 1.07 ^dfg 4.11 + -0.61 ^dfg 150.25 ± 12.70 ^abc 100 mg / kg 7.21 ± 0.79 ^dfg 8.90 ± 0.69 ^dfg 3.48 0.33 ^dfg 142.75 ± 10.08 ^abc

3.2.9.2. Changes in endogenous antioxidant GSH content

In the pMCAO control group, a significant decrease in GSH content (p <0.01) was observed in the cerebral cortex of the infarct / defect peripheral than in the sham control group. However, in the experimental group treated with donepezil 10 mg / Significant (p <0.01) increase in GSH content in the infarct / defect peripheral cerebral cortex was found, respectively. Particularly, there was a significant (p <0.01) significant (p <0.01) increase in the GSH content in the peripheral cerebral cortical tissue of donepezil 10 mg / kg and BJIKT 400, 200 and 100 mg / (Table 17).

The concentration of GSH in the peripheral cerebral cortex of the infarct / defect peripheral area was -80.35% as compared with that of the sham control group. However, donepezil 10 mg / kg and BJIKT 400 mg / kg alone group, donepezil 10 mg / kg and BJIKT 400 , 200, or 100 mg / kg, respectively, compared with the control group, 77.67, 71.51, 249.50, 222.84 and 182.84%, respectively.

3.2.9.3. Changes in endogenous antioxidant enzyme CAT activity

In the pMCAO control group, a significant (p <0.01) decrease in CAT activity was observed in the infarct / defect peripheral cerebral cortex compared to the sham control group. However, in all experimental groups, including the BJIKT 400 mg / kg single composition administration group, Significant (p <0.01) infarct / defect CAT activity in periportal cerebral cortex was increased, respectively. In particular, there was a significant (p <0.01) significant (p <0.01) CAT activity in the peripheral cerebral cortical tissue compared with the single-dose donepezil 10 mg / kg administration group in combination with donepezil 10 mg / kg and BJIKT 400, 200 and 100 mg / (Table 17).

In the pMCAO control group, there was a change of -82.08% compared to the sham control group. However, donepezil 10 mg / kg and BJIKT 400 mg / kg alone group, donepezil 10 mg / kg and BJIKT 400 , And 200 or 100 mg / kg, respectively, compared to the control group, 125.21, 115.01, 321.01, 294.60 and 233.73%, respectively.

3.2.9.4. Changes in endogenous antioxidant enzyme SOD activity

In the pMCAO control group, a significant (p <0.01) decrease in SOD activity was observed in the cerebral cortex of the infarct / defect peripheral than in the sham control group. However, all of the groups including donepezil 10 mg / kg and BJIKT 400 mg / In the experimental group, SOD activity in infarct / defect peripheral cerebral cortex was significantly increased (p <0.01) compared to pMCAO control group. In particular, there was a significant (p <0.01) significant (p <0.01) increase in SOD activity in the peripheral cerebral cortex of donepezil 10 mg / kg and BJIKT 400, 200 and 100 mg / (Table 17).

In the pMCAO control group, there was a change of -61.80% compared to the sham control group. However, donepezil 10 mg / kg and BJIKT 400 mg / kg alone group, donepezil 10 mg / kg and BJIKT 400 , 200, or 100 mg / kg, respectively, compared with the pMCAO control group, the change was 65.52, 82.50, 132.08, 106.17 and 95.88%, respectively.

3.2.10.1. Histopathological changes of the infarct / defect peripheral cerebral cortex (sixth coronal section)

In the pMCAO control group, a significant increase in the number of immunoreactive neurons in the right cerebral cortex, the atrophy of the right cerebral cortex, cleaved caspase-3 and PARP (apoptotic indicator), NT and 4-HNE (iNOS-related oxidative stress and lipid peroxidation index) However, in all experimental groups, including donepezil 10 mg / kg and BJIKT 200 mg / kg for 5 min, the pMCAO control group showed significant pMCAO cortical atrophy, denatured neuronal cells, cleaved caspase-3, cleaved PARP , NT and 4-HNE immunoreactive neurons were observed. In particular, in combination with donepezil 10 mg / kg and BJIKT 400, 200 and 100 mg / kg within 5 min, there was a marked decrease in cerebral cortical atrophy as well as cleaved caspase-3, cleaved Numerous decreases in PARP, NT and 4-HNE immunoreactive neurons were observed in a dose-dependent manner in combination with BJIKT (Table 18; FIGS. 13-15).

Groups
Item (Unit) Controls Single formula treated Donepezil 10 mg / kg and BJIKT co-administration Sham pMCAO Donepezil BJIKT 400 mg / kg 200 mg / kg 100 mg / kg Atrophy% 4.15 ± 2.90 61.63 + - 11.14a 40.90 ± 6.81 ac 48.03 ± 3.92 11.23 ± 3.98 bcd 16.77 ± 5.25 acd 28.86 + - 4.91 acd Neuronal cell numbers (cells / 1000 neuronal cells) DE 24.75 ± 14.02 786.75 ± 119.93f 619.75 ± 72.68fh 639.75 ± 80.34fh 114.75 ± 25.24 fgi 290.13 + - 79.93fgi 454.48 ± 69.13fgi Caspase-3 36.25 + 14.96 674.88 + - 104.58a 488.88 ± 88.80ac 510.25 ± 74.58 ac 151.88 ± 38.25 acd 263.50 ± 101.37 acd 316.25 ± 101.27 acd PARP 33.63 + - 15.45 748.00 ± 84.89f 490.13 + - 78.07 fg 514.03 + - 81.96fg 132.38 ± 38.66fgi 210.38 ± 50.03fgi 328.25 ± 78.57fgi NT 33.13 + - 18.03 510.63 + - 74.38f 370.38 ± 57.07 fh 357.63 ± 87.69fg  87.88 ± 21.02 fgi 155.50 ± 36.48fgi 259.00 ± 68.17fgi 4-HNE 103.00 ± 28.43 720.63 + - 107.13f 498.63 ± 55.80 fg 550.88 ± 73.06fg 208.63 ± 56.36fgi 316.38 ± 46.04fgi 367.25 ± 65.90 fgi

3.2.10.2. Changes of right cortical atrophy% in pMCAO surgery

In the pMCAO control group, there was a significant increase (p <0.01) in the percentage of right atrophy of the cerebral cortex, which was the pMCAO surgical site, compared with the sham control group. However, all experiments including the combination administration of donepezil 10 mg / kg and BJIKT 100 mg / In the substance-treated group, a decrease in the percentage of induced cerebral cortical atrophy was recognized (p <0.01), respectively, as compared to the pMCAO control group. In particular, the combination of donepezil 10 mg / kg and BJIKT 400, 200 and 100 mg / kg within 5 min was significantly (p <0.01) significantly lower than that of donepezil 10 mg / kg alone (p <0.01) (Table 18; FIG. 13), respectively. &Lt; tb &gt; &lt; TABLE &gt;

In the pMCAO control group, the percentage of atrophy of the right cerebral cortex was 1385.45% compared to the sham control group. However, donepezil 10 mg / kg and BJIKT 400 mg / kg alone group, donepezil 10 mg / kg and BJIKT In the group treated with 400, 200 or 100 mg / kg for 5 minutes or less, the changes were -33.51, -22.07, -81.77, -72.79 and -53.18%, respectively, as compared with the pMCAO control group.

3.2.10.2. Numerical changes of denatured neurons

In the pMCAO control group, there was a significant increase (p <0.01) in the right cortical neurons in the right cerebral cortex, which was significant (p <0.01) compared to the sham control group. However, in all experimental groups including donepezil 10 mg / (P < 0.01 or p < 0.05), respectively. In contrast, in the donepezil 10 mg / kg and BJIKT 400, 200 and 100 mg / kg co-administration groups, there was a significant (p <0.01) (Table 18; FIG. 13), respectively.

In the pMCAO control group, the number of modified neurons in the right cerebral cortex, which was the area of pMCAO surgery, was 3078.79% as compared with the sham control group, but donepezil 10 mg / kg and BJIKT 400 mg / kg alone group administration group, donepezil 10 mg / kg And BJIKT 400, 200 or 100 mg / kg for 5 min or less, showed -21.23, -18.68, -85.41, -63.12 and -42.25%, respectively, as compared with the pMCAO control group.

3.2.10.3. Numerical changes of Cleaved caspase-3 immunoreactive cells

In the pMCAO control group, the number of cleaved caspase-3 immunoreactive cells in the right cerebral cortex was significantly increased (p <0.01) compared to the sham control group. However, all the experimental materials including the BJIKT 400 mg / (P <0.01) cleaved caspase-3 immunoreactive cells compared to the pMCAO control group, respectively. Especially, the dose of donepezil 10 mg / kg and the dose of BJIKT 400, 200 and 100 mg / kg within 5 min was significantly higher than that of donepezil 10 mg / kg alone (p <0.01). The cleaved caspase in the right cerebral cortex -3 immunoreactivity cells were observed in a dose-dependent manner in combination with BJIKT (Table 18; Fig. 14).

The number of cleaved caspase-3 immunoreactive cells in the right cerebral cortex, which is the site of pMCAO, was 1761.72% higher in the pMCAO control group than in the sham control group. However, donepezil 10 mg / kg and BJIKT 400 mg / In the group treated with donepezil 10 mg / kg and BJIKT 400, 200 or 100 mg / kg within 5 min, the changes were -27.56, -24.39, -77.50, -60.96 and -53.14%, respectively, compared with the pMCAO control group.

3.2.10.4. Numerical changes of cleaved PARP immunoreactive cells

In the pMCAO control group, there was a significant increase in cleaved PARP immunoreactive cells in the right cerebral cortex (p <0.01) compared to the sham control group. However, donepezil 10 mg / kg and BJIKT 400 mg / (P <0.01) cleaved PARP immunoreactive cells compared to the pMCAO control group, respectively. Particularly, in the group treated with donepezil 10 mg / kg and BJIKT 400, 200 and 100 mg / kg within 5 min, the number of cleaved PARP in the right cerebral cortex, which is a significant (p <0.01) Numerical reduction of immune response cells was recognized in a dose-dependent manner in combination with BJIKT (Table 18; FIG. 14).

The number of cleaved PARP-immunoreactive cells in the right cerebral cortex, which was the site of pMCAO, was 2124.54% in the pMCAO control group compared to the sham control group. However, donepezil 10 mg / kg and BJIKT 400 mg / mg / kg and BJIKT 400, 200 or 100 mg / kg for 5 min, showed -34.48, -31.20, -82.30, -71.88, and -56.12%, respectively, as compared with the pMCAO control group.

3.2.10.5. Numerical changes of NT-immunoreactive cells

In the pMCAO control group, the number of NT immunoreactive cells in the right cerebral cortex, which is a pMCAO surgical site, was significantly increased (p <0.01) compared to the sham control group. However, donepezil 10 mg / kg and BJIKT 200 mg / (P <0.01), respectively, compared to pMCAO control group. In particular, the dose of donepezil 10 mg / kg and BJIKT 400, 200 and 100 mg / kg within 5 minutes was significantly higher than that of donepezil 10 mg / kg alone (p <0.01) A decrease in the number of reactive cells was recognized in a dose-dependent manner in combination with BJIKT (Table 18; Fig. 15).

The number of NT immunoreactive cells in the right cerebral cortex, which is the area of pMCAO surgery, showed 1441.51% change in the pMCAO control group compared to the sham control group. However, donepezil 10 mg / kg and BJIKT 400 mg / / kg and BJIKT 400, 200 or 100 mg / kg for 5 min compared with the pMCAO control group showed -27.47, -29.96, -82.79, -69.55 and -49.28%, respectively.

3.2.10.6. Numerical changes of 4-HNE immunoreactive cells

In the pMCAO control group, the number of 4-HNE immunoreactive cells in the right cerebral cortex, which is a pMCAO surgical site, was significantly increased (p <0.01) compared to the sham control group. Combination of donepezil 10 mg / kg and BJIKT 200 mg / The number of 4-HNE-immunoreactive cells was significantly decreased (p <0.01) compared to pMCAO control group in all experimental groups. In particular, in the combination of donepezil 10 mg / kg and BJIKT 400, 200 and 100 mg / kg within 5 min, pancreatic intraepithelial neoplasia (pMCAO) in the right cerebral cortex was significantly (p <0.01) A decrease in the number of HNE-immunoreactive cells was observed in a dose-dependent manner in combination with BJIKT (Table 18; FIG. 15).

The number of 4-HNE-immunoreactive cells in the right cerebral cortex, which is the site of pMCAO, was 599.64% higher in the pMCAO control group than in the sham control group. However, donepezil 10 mg / kg and BJIKT 400 mg / -23.56, -71.05, -56.10 and -49.04%, respectively, in the group treated with 10 mg / kg and BJIKT 400, 200 or 100 mg / kg within 5 minutes compared to the pMCAO control group.

As a result of the third embodiment, significant reduction in body weight and body weight, decrease in brain weight, neurological and cognitive motor behavioral disturbance-increase in limb placing test score, decrease in the number of body swings and ratio in the right side, (6th coronal section), cerebral cortical atrophy, metacarpal neuron, cleaved caspase-3 (6th coronal section), and the movement distance and time to escape platform And increased expression of PARP (apoptosis indicator), nitrotyrosine and 4-HNE (iNOS-related oxidative stress and lipid peroxidation index) immunoreactive neurons and decreased STAT3 and Pim-1 mRNA expression and MDA GSH content, SOD and CAT activity. In other words, pMCAO surgery resulted in vascular dementia accompanied by cerebral cortical damage, such as degeneration of nerve cells and increase of apoptosis due to depletion of a remarkable antioxidant defense system, neurological and cognitive behavioral disorders. In addition, these pMCAO-induced weight and brain weight loss, neurological and cognitive motor behavioral disturbances, degeneration of cerebral cortical neurons around the infarct / defect, apoptosis, oxidative stress, and depletion of the antioxidant defense system resulted in donepezil 10 mg / kg and BJIKT 400 The effects of donepezil 10 mg / kg and BJIKT 400, 200 and 100 mg / kg alone were significantly inhibited by the combined administration of donepezil 10 mg / kg and BJIKT 400, 200 and 100 mg / kg In the 5 min group, the increase in the neuroprotective, cognitive and motor function recovery effects was more dependent on the dose of BJIKT when compared to the dose of donepezil 10 mg / kg alone. Thus, as in Examples 1 and 2, the concomitant administration of BJIKT at intervals of less than 5 minutes, at least under the conditions of the present experiment, did not affect the bioavailability of donepezil but did not affect the bioavailability of donepezil The effect of the combination of donepezil and BJIKT on the neuroprotection, cognitive and motor function recovery effect of pMCAO on synergistic effects of neuroprotection, It is expected to provide a very useful new treatment method. Overall, the BJIKT 400 mg / kg single composition showed relatively lower neuroprotective, cognitive and motor function recovery effects in the pMCAO rat model than the single composition of donepezil 10 mg / kg.

As ischemic brain damage due to pMCAO surgery progresses, cognitive and motor disturbances are caused, resulting in a significant weight loss due to lower feed intake. In Example 3, a significant decrease in body weight was also observed in the pMCAO control group as compared with the sham control group at 8 days after the pMCAO operation and at 7 days after the start of the pMCAO operation, and the gain in the pMCAO operation was also significantly decreased at 29 days. In the BJIKT alone group, significant increase in body weight was observed on days 28 and 29 of pMCAO operation compared with that of pMCAO control, and the gain in pMCAO operation on 29 days was also significantly higher than that of pMCAO control group. In addition, the increase in body weight of donepezil 10 mg / kg and BJIKT 400, 200 and 100 mg / kg within 5 min was significantly higher than that of pMCAO control, Compared with the control group. In particular, significant increases in body weight gain were observed at 22, 28, and 28 days after pMCAO surgery compared to donepezil 10 mg / kg alone and BJIKT 400, 200 and 100 mg / kg within 5 minutes , The increase in body weight for 29 days of pMCAO surgery was significantly (p <0.05) dependent on BJIKT dose. These results suggest that concomitant administration of BJIKT at intervals of less than 5 minutes, at least under the conditions of Example 3, is one of the direct proofs that synergistically significantly increase the inhibitory activity of donepezil on cognitive and behavioral disorders associated with pMCAO.

TTC reacts with dehydrogenase in tissues and is observed to be red in normal tissues. In ischemic injured tissues, dehydrogenase disappears and is stained white, so it is often used to observe irreversible ischemic brain injury. In pMCAO, irreversible severe ischemic brain injury is induced, and over time, cyst formation by local necrosis of neuronal cells of the cerebral cortex is induced, and eventually the cortical and subcortical region of the cerebral cortex ) And associated cerebral atrophy and brain weight loss. In Example 3, infarct / defect findings, cortical atrophy, and brain weight associated with cerebral cortical defect were recognized in the pMCAO control group at the final autopsy 29 days after pMCAO, There was a significant decrease in brain weight, a decrease in cerebral cortical infarct / defect volume, and a decrease in cerebral weight in the right shunt cerebral cortex and a decrease in cerebral cortical infarct / defect volume compared with the sham control group. However, all of the experimental groups including the BJIKT 400 mg / Showed a significant increase in brain weight compared with the pMCAO control group, histopathological pMCAO surgery, right atrophy of the cerebral cortex and decreased cerebral cortical infarct / defect volume, respectively. Particularly, in combination with donepezil 10 mg / kg and BJIKT 400, 200 and 100 mg / kg within 5 min, significant increase in brain weight,% of cortical atrophy, and cerebral cortical infarct / Decreased volume of the defect volume was found to be dependent on dose of BJIKT. These results are clear and direct evidence that the neuroprotective effect of donepezil is synergistically significantly increased by the combined administration of BJIKT at intervals of less than 5 minutes, at least under the conditions of this Example 3. [

To date, most studies have focused on only the infarct size changes caused by ischemic brain injury and have evaluated the drug efficacy. However, despite the significant reduction in infarct size in the MCAO model, Are often observed [Jaspers et al., 1990; Yamaguchi et al., 1995], and some drugs known to have no effect on some infarct volumes have been reported to significantly reduce cognitive and behavioral disturbances caused by ischemic brain injury [Kawamata et al., 1996; Squire and Zola, 1996], there is a need to clarify the relationship between infarct volume and cognitive and behavioral disorders. Therefore, the need for appropriate neurological and cognitive athletic behaviors is needed to correct these correlations. De Ryck et al. The limb placing test of [1989] is a representative neurological exercise behavioral test that grades forelimb and hindlimb placement abnormalities. In addition, the body swing test is also frequently used as a neurological behavioral test [Borlongan and Sanberg, 1995]. In normal animals, body swing to the left and right is approximately 5: 5, whereas in animals with ischemic brain injury, Of body swings are significantly reduced [Roof et al., 2001; Menniti et al., 2009; Kim et al., 2016]. In addition, Morris [1984] 's water maze test is the most commonly used cognitive athletic behavior test. The cognitive behavioral disturbance significantly increases the travel distance and time to the escape platform, Distance and time are significantly suppressed [Roof et al. 2001; Kim et al., 2016]. In Example 3, in the pMCAO control group, an increase in the neurological and cognitive motor behavioral disturbances, ie, an increase in the limb placing test score, a decrease in the number of body swings and the ratio to the right, However, there was no significant difference in the range of movement distance and time between the two groups. However, neurological and cognitive motor behavioral disturbances due to pMCAO were observed in donepezil 10 mg / kg and BJIKT 400 mg / kg alone , donepezil 10 mg / kg and BJIKT 400, 200 and 100 mg / kg within 5 minutes, and especially donepezil 10 mg / kg and BJIKT 400, 200 and 100 mg / kg within 5 minutes Showed a significant increase in cognitive and motor function recovery effects compared to the dose of donepezil 10 mg / kg alone, depending on the dose of BJIKT. These results are once again judged to be one of the clearest evidence that synergistic and cognitive and motor function recovery effects of donepezil on pMCAO are synergistically markedly increased, at least under the conditions of this Example 3, by the concomitant administration of BJIKT at intervals of less than 5 minutes.

Free radicals produced in cells by cell metabolism or exogenous stimulation increase production as age increases and react with various biomolecule in brain tissue resulting in neurodegeneration and cognitive impairment. In the cerebral hemorrhage disorder, energy stored in nerve cells is depleted, resulting in a variety of acute metabolic disorders such as impaired iron homeostasis, massive release of nerve excitotoxic amino acids and formation of free radicals, and superoxide anion, hydroxyl radical and hydrogen peroxide And the formation of ROS, resulting in a typical secondary ischemic brain injury. These ROSs are normally removed by the endogenous antioxidative enzymes SOD and CAT, but severe brain damage such as stroke is formed in a large amount of ROS that can not be removed by endogenous antioxidant enzymes, resulting in exhaustion of the antioxidant defense system, Resulting in cognitive dysfunction due to nerve damage. Lipid peroxidation is an autocatalytic reaction that causes oxidative destruction of cell membranes. Various toxic substances formed by lipid peroxidation cause damage to surrounding tissues, and oxidative stress is important in brain damage. GSH is a typical endogenous antioxidant, and is known to control tissue injury by removing ROS at a relatively low concentration in cells. SOD is also an endogenous antioxidant enzyme, which acts as a part of the cell's enzyme defense system in brain tissue. CAT is also a typical endogenous antioxidant enzyme that converts toxic hydrogen peroxide (H ₂ O ₂ ) to harmless water (H ₂ O) . Therefore, the decrease of the activity of antioxidative enzymes, SOD and CAT, and the decrease of endogenous antioxidant, GSH, together with the increase of lipid peroxidation and ROS in brain tissues, indicate failure of compensatory action due to oxidative stress caused by brain injury. NT is a product of tyrosine nitration mediated by reactive nitrogen species such as peroxynitrite anion and nitrogen dioxide. It is well known that expression in degenerated brain tissue is increased and is currently used as an NO - related oxidative stress marker. 4-HNE is an α, β-unsaturated hydroxyalkenal formed by the lipid peroxidation of cells and is attracting attention as the cause of liver injury, chronic inflammation, neurodegenerative disease, adult respiratory distress syndrome, arteriosclerosis, diabetes and various carcinomas. Degeneration is also known to be involved. In Example 3, in the pMCAO control group, the lipid peroxidation (MDA content), NT and 4-HNE immunoreactive neurons were increased in the sixth coronal section in the infarct / defect peripheral cerebral cortex (SHC) And CAT activity, respectively. However, all of the experimental groups, including donepezil 10 mg / kg and BJIKT 100 mg / kg within 5 min, showed significant inhibition of lipid peroxidation and antioxidant defense system . Particularly, in the combination of donepezil 10 mg / kg and BJIKT 400, 200 and 100 mg / kg within 5 min, significant lipid peroxidation inhibition and antioxidant defense system activity compared to donepezil 10 mg / Respectively, in a dose-dependent manner in combination with BJIKT in cortical tissues. These results demonstrate that the synergistic effect of synergistic protection against neuroprotection, cognition, and motor function through activation of the antioxidant defense system of donepezil against pMCAO by synergistic administration of BJIKT at intervals of less than 5 minutes at least under the conditions of Example 3 It is judged to be reliable evidence.

Histopathological analysis of Example 3 demonstrated similar results to previous pMCAO rat experiments [Lee et al., 2012a; Kim et al., 2016]. In the pMCAO control group, the cerebral cortical atrophy% and the peripheral area of the infarct / defect (sixth coronal section) were increased, but the histopathological cerebral atrophy and numerical increase of the denatured neurons were observed in donepezil 10 mg / kg and BJIKT 400 mg / kg alone, and donepezil 10 mg / kg and BJIKT 400, 200 and 100 mg / kg within 5 minutes. Particularly, in the group treated with donepezil 10 mg / kg and BJIKT 400, 200 and 100 mg / kg within 5 min, significant decrease in the cerebral cortical% and the number of denatured neurons were observed in the infarct / BJIKT combination dose-dependently in cerebral cortical tissues, respectively. These results are again judged at least as direct evidence that the concomitant administration of BJIKT at intervals of less than 5 minutes, synergistically significantly increases the histopathological cortical neuroprotective effect of donepezil on pMCAO under the conditions of this Example 3 at least.

STAT3 is one of the transcription factors encoded in human STAT3 gene. The interaction of cytokine-IL-6, oncostatin M, and leukemia inhibitory factor of interleukin (IL) -6 with gp130 receptors on JAK2 activity (PSTAT3), and phosphorylated STAT3 reacts with some tyrosine kinase receptors, such as the epidermal growth factor receptor and c-MET, and the c-src non-receptor tyrosine kinase, 12/15-lipoxygenase It also reacts with ROS. Mutations in the STAT3 gene are known to cause hyperimmunoglobulin E syndrome, which results in impaired bone and tooth development, and the structural activity of STAT3 is associated with a very poor prognosis. Currently, STAT3 is known to be effective for promoting cell proliferation through strong anti-apoptotic activity, and is being used as an anti-apoptosis indicator. pSTAT3 is an indicator of the activation of STAT3, which moves into the nucleus of the cell and promotes gene transcription, so that the expression of various proteins is regulated by pSTAT. Pim-1 is one of serine / threonine kinase protooncogene genes involved in cell cycle, apoptosis, transcription activity, and signal transduction. STAT3 activates the genetic transcription of Pim-1 and regulates the expression of bcl-2 protein. Increased expression of pim-1 increases transcription of bcl-2 protein, inhibits caspase-3 activity, and ultimately inhibits apoptosis of cells. Therefore, it has been accepted that a drug that increases the expression of STAT3 gene and the expression of Pim-1 mRNA associated therewith has a cytoprotective effect by inhibiting apoptosis of cells, and inhibits apoptosis of neurons even in the case of ischemic brain injury such as stroke It is known to be able to. Caspase-3 and PARP are the most important factors involved in apoptosis. The increase of cleaved caspase-3 and PARP immunoreactivity in the cerebral cortex is due to apoptosis and related neuronal damage, and the caspase-3 and PARP expression in the cerebral cortex during pMCAO Is also well known. Therefore, the combination of donepezil 10 mg / kg and BJIKT 400 mg / kg alone, donepezil 10 mg / kg, and BJIKT 400, 200 and 100 mg / Increased expression of STAT3 and Pim-1 mRNA in the tissues and associated cleaved caspase-3 and PARP-immunoreactive neurons decreased the inhibition of apoptosis of the cerebral cortex neurons by pMCAO via regulation of STAT3 expression, This is a direct evidence of the effect of promoting motor function recovery. Particularly, in combination with donepezil 10 mg / kg and BJIKT 400, 200 and 100 mg / kg within 5 min, there was a significant increase in STAT3 and Pim-1 mRNA expression and cleaved caspase-3 and PARP Numerical reduction of immunoreactive neurons was dose - dependent in infarct / defect peripheral cerebral cortex with BJIKT. These results demonstrate that the synergistic effect of donepezil's neuroprotective effect and related cognitive and motor function recovery through modulation of STAT3 expression in pMCAO by at least the combination of BJIKT at intervals of less than 5 minutes under the conditions of this Example 3 As a result.

As shown above, the combined administration of donepezil 10 mg / kg and BJIKT 400, 200 and 100 mg / kg within 5 min significantly inhibited the neuroprotective, cognitive and motor function recovery effects of donepezil on pMCAO through STAT3 regulation Respectively. Concomitant administration of BJIKT within a 5-minute interval significantly increased the neuroprotective, cognitive and motor function recovery effects of pancreatic acute myocardial infarction through control of donepezil's STAT3 on the basis of antioxidative effects without affecting the bioavailability of donepezil Therefore, it is anticipated that it will provide a new therapeutic method which is very useful for the treatment and treatment of bilateral amblyopia in patients with vascular dementia.

Example  4. Dementia treatment Donepezil  ( AriceptTM )and Boiling  Conjugated administration experiment: Boiling  donepezil toxicity reduction effect

In Example 4, the donepezil toxicity alleviation effect of the boats was evaluated using a mouse.

4.1. Experimental Method

4.1.1. Isolation of experimental animals and groups

In Example 4, male ICR mice (Male ICR mice) were used. SPF / VAF Outbred CrljOri: CD1 [ICR] Male mice (OrientBio, Seungnam, Korea) were perfused for 8 days and then weighed 7 mice per group based on body weight (mean 34.30 ± 1.52 g, 31.00 ~ 37.00 g) (Table 19, Fig. 16).

Total 6 groups (including medium control group); Seven grains per group (total 42 used)

(G3M) donepezil 20 mg / kg, and 400 mg / kg intravenous doses within 5 min. (G0M) Medium control group, (G1M) Donepezil 20 mg / kg alone group, (G2M) , Donepezil 20 mg / kg (G4M), and gonadotropin 200 mg / kg in 5 min interval (G5M) Donepezil 20 mg / kg and booster 100 mg /

Group Sex Dose (mg / kg) Animal No. CIMI-16-02-03 D + BJIKT TX : Mouse single oral dose toxicity test Control Male Distilled water 10 ml / kg M01 ~ M07 Reference Male Donepezil single formula ( 20 mg / kg) M08 ~ M14 Reference Male BJIKT single formula ( 400 mg / kg) M15 to M21 Active Male Donepezil and BJIKT ( 20 and 400 mg / kg) M22 to M28 Active Male Donepezil and BJIKT ( 20 and 200 mg / kg) M29 to M35 Active Male Donepezil and BJIKT ( 20 and 100 mg / kg) M36 to M42

4.1.2. Experimental purpose and method of administration

Oral gavage (oral gavage) was used to administer single oral doses at intervals of less than 5 minutes at a dose of 10 ml / kg, using sterile distilled water as a solvent. A 400, 200, or 100 mg / mg / kg administered mice were administered a single dose using a syringe attached to a 1 ml syringe at intervals of less than 5 minutes. In the single administration group, only the same volume of sterilized distilled water was administered to the mice, Only sterile distilled water was administered twice every 5 minutes.

The dose of donepezil was set at 20 mg / kg, which is lower than the 45.2 mg / kg of half-lethal dose (LD50) of male mice known in the literature. The dosing dose of donepezil was 400, 200 or 100 mg / Concomitant administration was set based on the results of Examples 1 and 2. In this Example 3, an appropriate dose of booster cocktail (40, 20 or 10 mg / ml concentration) or donepezil (2 mg / ml concentration) was dissolved in sterile distilled water to give a dose of 10 ml / kg . All surviving experimental animals were subjected to a final autopsy 14 days after administration (Table 19; Fig. 16).

The observation period was 14 days and the clinical symptoms, weight change, autopsy findings, long term weight, hematology (14 items; Table 20) and blood chemistry (20 items; Table 21) The pancreas can be divided into two parts: the cerebrum, the cerebellum and the soft tissue, the heart, the thymus, the lung, the testes, the epididymis, the kidney, the adrenal glands, the liver, the pancreas, Respectively.

Hematology Items Units Methods Abbreviations Full name 1. RBC Red blood cell count M / L Laser optical (Flow cytometry) 2. HGB Hemoglobin concentration g / dl Cyanmethemoglobin method 3. HCT Hematocrit % Calculated from Item 1 and 4 4. MCV Mean corpuscular volume fL Laser optical (Flow cytometry) 5. MCH Mean corpuscular hemoglobin pg Calculated from Item 1 and 2 6. MCHC Mean corpuscular hemoglobin concentration g / dL Calculated from Item 2 and 3 7. PLT Platelet count K / μL Laser optical (Flow cytometry) 8. RET Reticulocyte count ea / 1000 Laser optical with cytochemical reaction 9. WBC White blood cell count K / μL Laser optical with cytochemical reaction Differential counts of white blood cells 10. NEU% Percentages of neutrophils % Perox optical with chemical reaction 11. LYM% Percentages of lymphocytes % Perox optical with chemical reaction 12. MON% Percentages of monocytes % Perox optical with chemical reaction 13. EOS% Percentages of eosinophils % Perox optical with chemical reaction 14. BAS% Percentages of basophils % Perox optical with chemical reaction

Hematology Items Units Methods Abbreviations Full name 1. AST Aspartate aminotransferase IU / L UV-Rate method 2. ALT Alanine aminotransferase IU / L UV-Rate method 3. ALP Alkaline phosphatase IU / L P-NPP method 4. BUN Blood urea nitrogen mg / dL Urease-UV method 5. CRE Creatinine mg / dL Jaffe method 6. GLU Glucose mg / dL Enzyme method 7. CHO Total cholesterol mg / dL Enzyme method 8. PRO Total protein g / dL Biuret method 9. CPK Creatine phosphokinase IU / L UV-Rate method 10. ALB Albumin g / dL BCG method 11. BIL Total bilirubin mg / dL Jendrassik-cleghorn method 12. Globulin Globulin g / dL Calculated from Item 8 and 10 13. A / G Albumin / globulin ratio Ratio Calculated from Item 10 and 12 14. IP Inorganic phosphorus mg / dL UV method 15. Ca Calcium mg / dL OCPC method 16. TG Triglyceride mg / dL Enzyme method 17. LDH Lactate dehydrogenase IU / L UV-Rate method 18. Na Sodium mmol / L Electrode method 19. K Potassium mmol / L Electrode method 20. Cl Chloride mmol / L Electrode method

4.2. Experiment result

4.2.1. Mortality check

In the present study, 5 (5/7; 71.43%) and 2 (2/7) of donepezil 20 mg / kg alone group, donepezil 20 mg / kg and 400, 200 and 100 mg / 7, 28.57%), 3 (3/7; 42.86%) and 5 (5/7; 71.43%) of deaths were confined within one hour after the end of the study. On the other hand, the deaths associated with administration of the vehicle control group and the 400 mg / kg single-composition administration group were not observed during the 14-day experimental period, and a final autopsy was performed on all the experimental animals (7/7; 100% (Table 22).

Groups Day after treatment Total * 0 ^a One 2 3 4 5 6 7 8 9 10 11 12 13 Vehicle control Distilled water 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0/7 (0%) Donepezil single 20 mg / kg 5 0 0 0 0 0 0 0 0 0 0 0 0 0 5/7 (71.43%) BJIKT single 400 mg / kg 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0/7 (0%) Donepezil 20 mg / kg and BJIKT co-treated 400 mg / kg 2 0 0 0 0 0 0 0 0 0 0 0 0 0 2/7 (28.57%) 200 mg / kg 3 0 0 0 0 0 0 0 0 0 0 0 0 0 3/7 (42.86%) 100 mg / kg 5 0 0 0 0 0 0 0 0 0 0 0 0 0 5/7 (71.43%)

4.2.2. Identify clinical symptoms

Significant [3+] progression and ataxia findings were observed in all experimental animals (7/7; 100%) in Donepezil 20 mg / kg single composition administration group, 200 or 100 mg / kg for 5 min or less, significantly reduced to mild [1+] or moderate [2+]. In conclusion, the results of the present study indicate that donepezil (20 mg / kg) and donepezil (400 mg / kg) were effective in all experimental animals (7/7; 100% Three patients (3/7; 42.86%) were admitted with mild progression and ataxia in the 200 mg / kg group treated within 5 min, and moderate progression and ataxia were observed in 4 patients (4/7; 57.14%) , moderate progression and ataxia were observed in all the experimental animals in 7 cases (7/7; 100%) in the combination administration of donepezil 20 mg / kg and 100 mg / kg intravenous injection within 5 minutes. On the other hand, no significant clinical symptoms were observed during the 14-day observation period in the vehicle control group and the 400 mg / kg single-composition administration group, and all the surviving experimental animals recovered to normal within 6 hours after the administration (Table 23).

Groups Normal appearance Clinical signs: Tremor and loss of locomotion Slight [1+] Moderate [2+] Severe [3+] Vehicle control Distilled water 7/7 (100%) 0/7 (0%) 0/7 (0%) 0/7 (0%) Donepezil single 20 mg / kg 0/7 (0%) 0/7 (0%) 0/7 (0%) 7/7 (100%) BJIKT single 400 mg / kg 7/7 (100%) 0/7 (0%) 0/7 (0%) 0/7 (0%) Donepezil 20 mg / kg and BJIKT co-treated 400 mg / kg 0/7 (0%) 7/7 (100%) 0/7 (0%) 0/7 (0%) 200 mg / kg 0/7 (0%) 3/7 (42.86%) 4/7 (587.14) 0/7 (0%) 100 mg / kg 0/7 (0%) 0/7 (0%) 7/7 (100%) 0/7 (0%)

4.2.3. Changes in body weight and weight gain

Changes in body weight and body weight gain compared to the vehicle control group were not observed in all experimental groups, including donepezil 20 mg / kg alone, and significant changes in body weight and body weight compared to donepezil 20 mg / kg alone All donepezil 20 mg / kg and three doses of booster wax 400, 200, or 100 mg / kg were not admitted throughout the experimental period in the 5 min interval group (Table 24; Figure 17).

Groups Intervals Day 0 * ~ Day 7 Day 7 ~ Day 14 Day 0 ~ Day 14 ** Vehicle control Distilled water 7.73 ± 0.78 2.14 ± 0.64 4.40 ± 1.35 Donepezil single 20 mg / kg 6.85 ± 1.48 2.90 + - 0.85 3.50 ± 0.57 BJIKT single 400 mg / kg 6.77 ± 1.99 2.06 ± 0.53 3.69 ± 2.65 Donepezil 20 mg / kg and BJIKT co-treated 400 mg / kg 7.18 ± 0.91 2.18 ± 0.54 4.06 ± 1.61 200 mg / kg 7.43 ± 0.64 2.33 + - 0.74 4.63 ± 1.26 100 mg / kg 6.90 ± 1.70 2.40 0.71 3.70 ± 0.85

4.2.4. Change in long-term weight

Significant changes in organ weights compared to vehicle control groups were not observed in all experimental groups, including donepezil 20 mg / kg alone, and significant changes in organ weight compared to donepezil 20 mg / kg alone were observed in all donepezil 20 mg / kg and in the group of 400, 200, or 100 mg / kg intravenous doses within 5 minutes (Table 25 and 26).

delete

Groups Principal organs Lung Heart Thymus Kidney L Adrenal G L Spleen Vehicle control 0.544 + 0.035 0.475 + 0.041 0.128 + 0.037 0.895 + 0.090 0.012 ± 0.006 0.270 + 0.055 Donepezil single 20 mg / kg 0.547 + 0.034 0.464 + 0.010 0.137 + 0.014 0.890 + 0.071 0.010 0.010 0.292 ± 0.009 BJIKT single 400 mg / kg 0.541 + 0.029 0.464 + 0.029 0.140 + 0.042 0.881 + 0.129 0.010 ± 0.003 0.312 + 0.045 Donepezil 20 mg / kg and BJIKT co-treated 400 mg / kg 0.527 ± 0.053 0.450 + 0.035 0.138 + 0.034 0.843 + - 0.054 0.015 + 0.014 0.272 ± 0.053 200 mg / kg 0.529 + 0.019 0.452 + 0.032 0.135 + 0.026 0.807 ± 0.101 0.009 0.006 0.274 + 0.061 100 mg / kg 0.544 + 0.017 0.436 + 0.029 0.148 ± 0.051 0.816 + 0.115 0.021 0.017 0.241 + 0.027 Groups Testis L Liver Pancreas S Brain Epididymis L LN L Vehicle control 0.330 0.051 4.551 + - 0.382 0.561 + 0.069 1.441 + - 0.107 0.125 + 0.020 0.007 ± 0.005 Donepezil single 20 mg / kg 0.323 + 0.005 4.395 + 0.232 0.573 + 0.015 1.416 + 0.037 0.134 ± 0.006 0.008 ± 0.007 BJIKT single 400 mg / kg 0.322 + 0.043 4.190 + 0.415 0.562 + 0.062 1.468 + 0.131 0.121 + - 0.012 0.007 ± 0.004 Donepezil 20 mg / kg and BJIKT co-treated 400 mg / kg 0.331 + 0.035 4.116 + 0.684 0.603 + 0.101 1.475 + 0.147 0.129 ± 0.002 0.006 0.003 200 mg / kg 0.315 + 0.035 4.291 + - 0.335 0.539 + 0.082 1.395 + 0.079 0.127 + 0.013 0.010 0.005 100 mg / kg 0.302 + 0.064 4.224 + 0.423 0.572 + 0.119 1.467 ± 0.002 0.113 + 0.015 0.006 ± 0.000

4.2.5. Hematological change

As a result of 14 hematologic tests, significant hematologic changes compared to vehicle control were not observed in all experimental groups including donepezil 20 mg / kg monoclonal administration group and significant blood compared to donepezil 20 mg / The changes were not observed in all doses of donepezil 20 mg / kg and 400 mg / kg, 200 or 100 mg / kg in 5 min interval (Table 27).

Groups Hematological Items: Red Blood Cells RBC HGB HCT MCV MCH MCHC PLT RET Vehicle control 8.49 + - 0.58 18.70 + - 0.61 40.74 + 0.93 48.10 ± 2.47 22.04 0.90 45.83 + - 0.83 864.57 ± 81.97 0.23 ± 0.08 Donepezil single 20 mg / kg 8.45 ± 0.07 18.95 ± 0.35 41.20 ± 1.56 48.70 +/- 1.41 22.35 + 0.21 45.95 ± 0.92 850.00 ± 138.59 0.30 0.28 BJIKT single 400 mg / kg 8.49 + - 0.60 18.71 ± 0.68 40.70 ± 1.56 47.99 + 2.03 22.03 + - 0.85 45.96 + 1.14 861.43 + - 131.11 0.24 + 0.13 Donepezil 20 mg / kg and BJIKT co-treated 400 mg / kg 8.58 ± 0.67 18.80 + - 0.75 40.82 ± 0.83 47.68 ± 2.99 21.90 ± 0.97 46.02 ± 1.13 835.80 + - 71.01 0.24 0.09 200 mg / kg 8.39 + - 0.46 18.58 ± 0.75 40.73 + - 0.92 48.58 ± 1.62 22.13 + - 0.51 45.55 + 0.87 838.25 + - 66.94 0.28 ± 0.17 100 mg / kg 8.55 0.75 19.00 + - 0.42 41.15 ± 0.64 48.25 + - 3.46 22.25 + 1.48 46.10 ± 0.28 891.50 ± 13.44 0.25 0.21 Groups Hematological Items: White Blood Cells WBC NEU (%) LYM (%) MONO (%) EOS (%) BASO (%) Vehicle control 4.93 + - 0.68 9.56 ± 1.13 85.19 ± 1.65 3.07 ± 0.55 0.30 + 0.14 0.63 + 0.44 Donepezil single 20 mg / kg 4.75 0.49  9.65 + - 0.46 85.45 + 0.35 2.80 + - 0.42 0.25 0.21 0.85 0.35 BJIKT single 400 mg / kg 4.98 ± 0.65  9.86 ± 0.94 85.33 + - 1.10 2.89 + - 0.76 0.26 ± 0.10 0.61 + - 0.33 Donepezil 20 mg / kg and BJIKT co-treated 400 mg / kg 4.91 ± 0.83  9.97 + - 2.44 85.66 ± 2.60 2.96 + 0.18 0.26 ± 0.11 0.70 + - 0.16 200 mg / kg 4.95 ± 0.36  9.54 + - 0.47 85.40 ± 0.82 3.23 + - 0.68 0.28 ± 0.17 0.73 + 0.17 100 mg / kg 4.91 + 0.14  10.12 ± 1.65 85.45 + 0.35 3.10 ± 0.57 0.35 + 0.21 0.70 + 0.14

4.2.6. Blood biochemical change

Twenty blood biochemical tests showed that significant blood biochemical changes were not observed in all experimental groups, including donepezil 20 mg / kg alone, compared with vehicle control, and donepezil 20 mg / kg alone , Significant blood biochemical changes were not observed in all doses of donepezil 20 mg / kg and intravenous infusion of 400, 200 or 100 mg / kg within 5 minutes (Table 28).

Groups Serum Biochemical Items AST ALT ALP BUN CRE GLU CHO Vehicle control 65.64 ± 12.53 23.71 + - 3.70 68.86 +/- 12.67 16.63 ± 1.60 0.37 + 0.11 92.57 + - 11.37  141.00 ± 28.61 Donepezil single 20 mg / kg 67.85 7.57 24.50 + 4.67 70.50 ± 12.02 16.35 ± 1.34 0.35 + 0.21 96.50 ± 6.36  137.50 7.78 BJIKT single 400 mg / kg 62.74 + - 11.94 23.87 ± 4.04 66.71 + - 12.85 16.64 ± 1.24 0.39 + 0.13 94.43 ± 9.29  142.86 ± 23.96 Donepezil 20 mg / kg and BJIKT co-treated 400 mg / kg 63.50 ± 14.85 23.46 ± 2.32 68.40 ± 9.50 16.63 + - 1.35 0.34 0.11 95.40 ± 11.50  148.60 ± 20.51 200 mg / kg 64.48 ± 11.19 23.08 ± 1.88 64.25 + - 16.11 16.18 ± 1.91 0.33 + 0.13 95.72 ± 18.47  145.25 ± 20.92 100 mg / kg 64.50 + - 24.75 23.00 ± 2.83  72.00 ± 22.63  17.25 + - 0.35 0.40 0.28 93.50 ± 10.61  141.50 ± 55.86 Groups PRO CPK BIL ALB Globulin A / G TG Vehicle control 4.77 ± 0.48 159.86 ± 70.13 0.11 + 0.04 3.20 ± 0.46 1.57 + - 0.44 2.24 ± 0.93 158.86 ± 17.08 Donepezil single 20 mg / kg 4.90 + - 0.42 164.00 ± 52.33 0.10 0.00 3.30 ± 0.28 1.60 + 0.14 2.06 ± 0.01 157.00 ± 35.36 BJIKT single 400 mg / kg  4.79 ± 0.42 166.43 + - 54.77 0.13 ± 0.05 3.13 ± 0.39 1.66 ± 0.59 2.21 ± 1.15 159.71 ± 15.60 Donepezil 20 mg / kg and BJIKT co-treated 400 mg / kg 4.94 + - 0.60 188.40 ± 41.88 0.12 + 0.04 3.18 ± 0.22 1.75 + - 0.68 2.24 ± 1.49 161.00 ± 20.59 200 mg / kg 4.68 ± 0.41 158.25 + - 50.33 0.13 ± 0.05 3.15 + 0.34 1.53 + - 0.67 2.49 ± 1.42 159.50 ± 23.98 100 mg / kg 4.85 ± 0.21 174.00 ± 59.40 0.15 + 0.07 3.25 ± 0.21 1.60 ± 0.00 2.03 ± 0.13 155.00 ± 9.90 Groups LDH (x 10 ² ) Ca P Na K Cl Vehicle control 14.32 ± 3.58 11.26 ± 0.32 10.90 ± 0.27 141.71 ± 1.25 10.19 ± 0.20 114.29 ± 1.11 Donepezil single 20 mg / kg 15.87 + - 4.03 11.35 ± 0.78 10.95 ± 0.64 141.50 ± 2.12 10.15 + 0.07 114.50 + - 0.71 BJIKT single 400 mg / kg 14.80 ± 3.51 11.24 + - 0.42 10.87 ± 0.40 141.86 + 1.35 10.20 ± 0.12 114.43 ± 1.40 Donepezil 20 mg / kg and BJIKT co-treated 400 mg / kg 15.29 + - 4.44 11.18 ± 0.48 10.80 0.47 141.20 ± 1.30 10.22 + - 0.15 114.20 ± 1.30 200 mg / kg 13.89 + - 4.40 11.28 ± 0.51 10.93 ± 0.51 141.75 ± 1.71 10.18 ± 0.10 114.00 ± 0.82 100 mg / kg 13.75 + 1.03 11.20 ± 0.14 10.85 ± 0.21 141.50 ± 0.71 10.20 ± 0.00 114.50 + - 0.71

4.2.7. Autopsy findings

There was no significant gross autopsy findings in all deaths confined to the dosing day in the Donepezil alone or in combination with the 5-min dosing regimen. Mild pulmonary hyperemia, thrombocytopenia, spleen atrophy or enlargement, sublingual lymph node enlargement Significant gross autopsy findings were not observed in all study groups except for the media control group (Table 29).

Groups Vehicle control Donepezil
Single BJIKT
Single Donepezil 20 mg / kg and BJIKT co-administration 20 mg / kg 400 mg / kg 400 mg / kg 200 mg / kg 100 mg / kg Lung
Normal
Congestion 1+
6/7
1/7
1/2
1/2
6/7
1/7
4/5
1/5
4/4
0/4
1/2
1/2 Thymus
Normal
Atrophy 1+
6/7
1/7
2/2
0/2
6/7
1/7
5/5
0/5
4/4
0/4
2/2
0/2 Spleen
Normal
Atrophy 1+
HT ^† 1+
5/7
1/7
1/7
2/2
0/2
0/2
4/7
1/7
2/7
4/5
0/5
1/5
3/4
0/4
1/4
2/2
0/2
0/2 Lymph node ^a)
Normal
HT 1+
6/7
1/7
2/2
0/2
5/7
2/7
5/5
0/5
3/4
1/4
2/2
0/2 Others
Normal
7/7
2/2
7/7
5/5
4/4
2/2

4.2.8. Histopathological observation

(Fig. 18), splenic red lymphocyte subsets (Fig. 21), supranuclear lymphocytic infiltration (Fig. 19) 22) were sporadically observed in all experimental groups, including the vehicle control group, but significant histopathological findings were not observed in surviving experimental animals in all experimental groups (Table 30)

Groups Vehicle control Donepezil
Single BJIKT
Single
400 mg / kg Donepezil 20 mg / kg and BJIKT co-administration 20 mg / kg 400 mg / kg 200 mg / kg 100 mg / kg Lung
Normal
CG ^† 1+
6/7
1/7
1/2
1/2
6/7
1/7
4/5
1/5
4/4
0/4
1/2
1/2 Spleen
Normal
wDE ^† 1+
rHP ^† 1+
5/7
1/7
1/7
2/2
0/2
0/2
4/7
1/7
1/7
3/5
0/5
2/5
3/4
0/4
1/4
2/2
0/2
0/2 Liver
Normal
IF ^† 1+
6/7
1/7
1/2
1/2
7/7
0/7
4/5
1/5
4/4
0/4
2/2
0/2 Lymph node ^a)
Normal
dHP ^† 1+
6/7
1/7
2/2
0/2
5/7
2/7
5/5
0/5
3/4
1/4
2/2
0/2 Fundus
Normal
CY ^† 1+
5/7
2/7
2/2
0/2
6/7
1/7
3/5
2/5
4/4
0/4
2/2
0/2 Others
Normal
7/7
2/2
7/7
5/5
4/4
2/2

In this Example 4, 5 cases (5/7; 71.43%) of deaths were confined within 1 hour after administration of donepezil 20 mg / kg alone, and severe progression and ataxia were observed in all experimental animals (7/7; 100%), respectively. In the donepezil 20 mg / kg group and the 100 mg / kg group, 5 cases (5/7; 71.43%) were observed in the same dose group as donepezil 20 mg / kg alone, but the mortality due to donepezil (2/7; 28.57%) and 3 (3/7; 42.86%), respectively, and the degree of progression and ataxia were also significantly decreased by the combination of 400 and 200 mg / 200 and 100 mg / kg for 5 min or less, respectively. In conclusion, the results of the present study indicate that donepezil (20 mg / kg) and donepezil (400 mg / kg) were effective in all experimental animals (7/7; 100% Three patients (3/7; 42.86%) were admitted with mild progression and ataxia in the 200 mg / kg group treated within 5 min, and moderate progression and ataxia were observed in 4 patients (4/7; 57.14%) , moderate progression and ataxia were observed in all the experimental animals in 7 cases (7/7; 100%) in the combination administration of donepezil 20 mg / kg and 100 mg / kg intravenous injection within 5 minutes. On the other hand, weight, hematological and blood biochemical changes, gross autopsy, and histopathological findings associated with donepezil or booster doses compared with vehicle control groups were not observed in surviving experimental animals in all treatment groups, and survival of donepezil 20 mg / kg of the single dose composition, donepezil 20 mg / kg, and 400, 200, and 100 mg / kg of the treated group, the progression and ataxia remained normal within 6 hours after the end of the treatment. Therefore, as a result of Examples 1 and 2, it was observed that the administration of 5% or less of donepezil did not affect the bioavailability of the donepezil. Therefore, , It was concluded that donepezil significantly reduced neuropathy and mortality due to ACE inhibition of donepezil on the basis of immune control and antioxidant effect of boiled chrysanthemum without affecting the bioavailability of donepezil. It is anticipated that the combined use of Bohungwangtang can provide a new treatment method which is very useful for the treatment and treatment of bilobar.

In the medium control group used in Example 4, the donepezil and the group treated with the booster wax alone, the mice of the group treated with all three doses of the booster 400, 200 or 100 mg / kg and donepezil 20 mg / kg within 5 minutes, Kg body weight and weight gain, respectively. Significant changes in body weight and body weight were not observed in all experimental groups, including donepezil 20 mg / kg alone, and donepezil 20 mg / kg alone Changes in body weight and body weight gain compared with the control group were not observed in all donepezil 20 mg / kg and three dose groups of 400, 200, or 100 mg / Therefore, the combined administration of donepezil 20 mg / kg and 400 mg / kg of booster wax, 100, 200 or 400 mg / kg of donepezil, and donepezil 20 mg / kg of 5 minutes or less had a significant effect on weight and body weight of normal mice .

Following the oral administration of donepezil 20 mg / ml single composition in Example 4, a significantly higher mortality (5/7; 71.43%) than the LD 50 of 45 mg / kg in donepezil male mice previously known was recognized The effects of stress on the fasting and concomitant administration are considered to be significant. On the other hand, in donepezil 20 mg / kg and 100 mg / kg group, 5 cases (5/7; 71.43%) of donepezil treated with donepezil 20 mg / (2/7; 28.57%) and 3 (3/7; 42.86%) by administration of 200 mg / kg for 5 minutes or less, We conclude that donepezil is a direct evidence of a significant reduction in mortality from ACE inhibition. On the other hand, the deaths associated with the administration of the vehicle control alone and the 400 mg / kg single dose of booster wax were not observed during the experimental period of 14 days.

Donepezil major clinical symptoms are known as neuropathy, progression and ataxia due to ACE inhibition. In the result of Example 4, severe progression and ataxia were observed in all experimental animals (7 mg / kg body weight) in donepezil 20 mg / / 7; 100%), but the degree of progression and ataxia by these donepezil was dose-dependently dose-dependently administered by intravenous administration of 400, 200, and 100 mg / . In conclusion, the results of the present study indicate that donepezil (20 mg / kg) and donepezil (400 mg / kg) were effective in all experimental animals (7/7; 100% Three patients (3/7; 42.86%) were admitted with mild progression and ataxia in the 200 mg / kg group treated within 5 min, and moderate progression and ataxia were observed in 4 patients (4/7; 57.14%) , moderate progression and ataxia were observed in all the experimental animals in 7 cases (7/7; 100%) in the combination administration of donepezil 20 mg / kg and 100 mg / kg intravenous injection within 5 minutes. These results are clear evidence that the neuropathy due to ACE inhibition of donepezil is markedly reduced by the combined administration of at least the baitengyangtang under the conditions of this Example 4. [ On the other hand, significant clinical symptoms were not observed during the 14-day observation period in the vehicle control group and the 400 mg / kg single composition administration group, and all surviving experimental animals recovered to normal within 6 hours after the administration.

Significant hematological and blood biochemical changes compared to vehicle control groups were not observed in all experimental groups, including donepezil 20 mg / kg alone, and donepezil 20 mg / kg alone, Biochemical changes were not observed in all doses of donepezil 20 mg / kg and intravenous infusion of 400, 200 or 100 mg / kg within 5 min

On the other hand, slight pulmonary congestion, thrombocytopenia, spleen atrophy or enlargement, sublingual lymph node enlargement and mild pulmonary congestion observed during histopathological examination, enlarged spleen red watershed lymphocytes or white water quality lymphocytes, , Diffuse lymphocytic enlargement of lymph node, and localized cystic formation of the supratentorial region were observed sporadically in all experimental groups including the control group, and it was considered to be an accidental lesion rather than a toxic symptom due to administration of donepezil or boar vaccine. These symptoms were normal These findings are rarely seen in mice.

Therefore, intravenous administration of 400, 200, or 100 mg / kg of intravenous bolus injection was observed to suppress neuropathy and death through donepezil ACE inhibition through immune control and antioxidative effects . Therefore, at least the combined administration of 5 mg / kg or more of the boiling water of 100 mg / kg or more under the condition of the present Example 4 does not affect the bioavailability of donepezil but the immune control and the antioxidant effect, We conclude that the combination of donepezil and booster wax in patients with vascular dementia can provide a novel treatment modality that is very useful in the treatment and management of both herbal medicine.

It will be understood by those skilled in the art that the foregoing description of the present invention is for illustrative purposes only and that those of ordinary skill in the art can readily understand that various changes and modifications may be made without departing from the spirit or essential characteristics of the present invention. will be. It is therefore to be understood that the above-described embodiments are illustrative in all aspects and not restrictive.

Claims (6)

A pharmaceutical composition for the treatment of dementia comprising donepezil and a boiled fish excrement, wherein the boiled excrement is composed of hwanggi, kiwon, ginseng, Angelica gigas, rhinoceros, contrast, dermis, licorice, horse riding, A pharmaceutical composition.
delete delete The method according to claim 1,
Wherein the donepezil and the boiling water are pre-mixed and formulated or separately formulated.
The method according to claim 1,
Characterized in that the donepezil and the boiling water bath are administered parenterally, orally, locoregionally, or percutaneously.
The method according to claim 1,
The pharmaceutical composition according to claim 1, wherein the administration of the boar shaku is started within 1 minute to 30 minutes after administration of Donepezil.

Images