KR101840451B1 - Compostion comprising Yukmijihwangtang extract for treatment of dementia - Google Patents

Abstract

The present invention relates to a composition for treating dementia including a dementia treatment agent and Yukmijihwang-tang. According to the present invention, by administering a dementia treatment agent to a subject and administering the Yukmijihwang-tang to the subject, various side effects can be prevented and reduced while remarkably increasing a dementia symptom improvement effect of the dementia treatment agent.

Description

[0001] The present invention relates to a composition for treating dementia,

The present invention provides a composition for treating dementia comprising a dementia treatment agent and a herbicide.

Dementia is a kind of syndrome that causes disability in daily life due to loss of ability of human intellectual ability and social activity due to various diseases. It is pathologically caused by damage and loss of nerve cell , Intensive, language, and cognitive disorders progress gradually over a long period of time and ultimately lead to death. The diseases causing the dementia include Alzheimer's disease, vascular dementia, Parkinson's disease Parkinson ' s disease, Lewy body dementia, Huntington ' s disease, Creutzfeldt-Jacob disease, Pick's disease, and the like.

The highest incidence of these diseases is Alzheimer's disease, which accounts for 50% to 70% of all dementia patients. Alzheimer's disease is classified into sporadic type and familial type depending on the cause. It is known that 80-90% of the patients develop schizophrenia after the age of 65 years. Familility accounts for less than 20% of all, and is caused by mutations in genes such as amyloid precursor protein (APP), presenilin (PS) type 1 and type 2, . Alzheimer's disease is characterized by the accumulation of senile plaques and neurofibrillary tangles on the outside and inside of nerve cells, respectively. The elderly are spherical and generally found in the limbic system or neocortex. Peptides called β-amyloid (Aβ) bind to and deposit with each other to form nuclei, and around the degenerated nerve fiber axons (axons), dendrites (dendrites), activated glue cells (microglia) and astrocytes. Neurofibrillary tangles are substances in neurons that are formed by abnormal phosphorylation of proteins called tau and then bind to each other, and many of them are found in many brain tissues of Alzheimer's disease dementia patients.

The number of patients with dementia, including Alzheimer's disease, is growing steadily due to population aging. As of 2008, about 26 million people have been diagnosed with Alzheimer's disease, and it is estimated that the number of Alzheimer's patients will be more than 100 million by 2050 due to the increase of the elderly population. According to the survey data of Korea Health & About 350,000 people, or about 8.3% of the population, are expected to be demented and about 530,000 in 2015. Despite the low proportion of patients in the total population, dementia is of interest because of the large socio-economic burden of caring for the patient. Accordingly, many studies for the treatment of dementia at the national level have been carried out in advanced countries including the United States.

Meanwhile, Jummi Jiwanghangtang is a typical prescription which is frequently used for kidney disease in Oriental medicine. It is a combination prescription composed of 6 kinds of natural products. It is a combination prescription of 熟地 黄, 山药, (牧 丹 皮), and the tax (澤泻) are included.

Disclosure of Invention Technical Problem [8] The present invention has been made in order to solve the above-mentioned problems in the prior art, and an object of the present invention is to provide a composition for treating dementia using Ji-hui.

However, the technical problem to be solved by the present invention is not limited to the above-mentioned problems, and other matters not mentioned can be clearly understood by those skilled in the art from the following description.

In order to achieve the above object, the present invention provides a pharmaceutical composition for treating dementia comprising a therapeutic agent for dementia and a female herbarium.

In one embodiment of the present invention, the dementia treating agent is donepezil.

In another embodiment of the present invention, the Korean cabbage is characterized in that it contains Sulfur Sulfur, Acanthopanax senticosus, Cornus officinalis, Bacillus subtilis, Mulberry, and Taxa.

In still another embodiment of the present invention, the dementia treatment agent and the yummy herbarium are previously mixed and formulated or separately formulated.

In still another embodiment of the present invention, the dementia treating agent and the yomi jiuangfuang are administered parenterally, orally, locoregionally, or percutaneously.

According to another embodiment of the present invention, the administration of the jerky jiuanghwang is started within 30 minutes to 4 hours after administration of the dementia treatment agent.

The composition for treating dementia containing the active ingredient of the present invention is effective for increasing the efficiency of treatment of dementia and alleviating side effects of the dementia treatment alone.

Fig. 1 is a diagram showing an experimental design of Example 1. Fig.
FIG. 2 is a graph showing the result of observing blood donepezil concentration according to each group in Example 1. FIG.
3 is a view showing an experimental design of the second embodiment.
FIG. 4 is a graph showing the results of examining changes in body weight according to each group according to each group of Example 2. FIG.
FIG. 5 is a photograph showing changes in blood donepezil concentration according to each group in Example 2. FIG.
6 is a diagram showing an experimental design of the third embodiment.
FIG. 7 is a graph showing the results of checking the change in body weight according to each group in Example 3. FIG.
8 is a graph showing the result of checking the change in brain weight according to each group in Example 3. FIG.
9 is a diagram showing the result of comparing brain sizes according to each group in the third embodiment.
FIG. 10 is a graph showing the result of confirming infarct / defect findings according to each group in Example 3. FIG.
11 is a graph showing the results of confirming STAT3 mRNA expression level according to each group in Example 3. Fig.
FIG. 12 is a graph showing the results of confirming the expression level of Pim-1 mRNA according to each group in Example 3. FIG.
13 is a photograph showing a comparison of brains according to each group in Example 3. Fig.
FIG. 14 is a photograph showing a comparison of the expression of cleaved caspase-3 and cleaved PARP in the infarct / defect peripheral cerebral cortex according to each group in Example 3. FIG.
FIG. 15 is a photograph showing a comparison of NT and 4-HNE expression of the infarct / defect peripheral cerebral cortex according to each group in Example 3. FIG.
16 is a diagram showing the experimental design of the fourth embodiment.
17 is a graph showing the result of checking the change in body weight according to each group of Example 4. Fig.
18 is a diagram showing the results of confirming histopathological changes of the lungs according to each group in Example 4. Fig.
FIG. 19 is a graph showing the histopathological changes of spleen according to each group in Example 4. FIG.
FIG. 20 is a diagram showing the results of confirming histopathological changes in liver according to each group in Example 4. FIG.
Fig. 21 is a diagram showing the results of confirming histopathological changes of submandibular glands according to each group in Example 4. Fig.
22 is a view showing the result of confirming histopathological changes on the main body according to each group in Example 4. Fig.

The present inventors have focused on herbal medicines in order to develop a composition capable of alleviating various side effects of administration of a dementia treating agent for treating dementia and further improving the dementia symptom improving effect. Confirming that the dementia symptom improvement effect and the side effect reduction effect are obtained, and the present invention has been completed.

Accordingly, it is an object of the present invention to provide a composition for treating dementia comprising a dementia treatment agent and a herbicide.

As used herein, the term " kokmi jiwanghangtang " means an extract extracted from six medicinal materials. The six medicinal materials include six medicines such as Sulfur Sulfur, Lactobacillus acidus, Cornus syrup, Bacillus subtilis, Mulberry, and Taxa.

In one embodiment of the present invention, the dementia remedy and the Korean herb medicine can be mixed and formulated in advance or separately formulated.

The administration period of the Jummi jiuanghang tang can be performed within 1 minute to 30 minutes after the administration of the dementia treatment agent, preferably within 3 minutes to 8 minutes, and the administration time of 5 minutes after administration of the dementia treatment agent as in the embodiment of the present invention Min, but is not limited thereto.

The therapeutic agent for dementia used in the present invention is donepezil, but is not limited thereto.

The therapeutic agent for dementia and the herb medicine can be administered parenterally, orally, locoregionally, or percutaneously. It is preferable that the Korean cabbage soup is orally administered, but it can be suitably selected by those skilled in the art depending on the condition and the weight of the patient, the degree of disease, the period and the like.

In the present invention, an 'individual' refers to a subject in need of treatment for diseases, and more specifically, a human or non-human primate, mouse, rat, dog, cat, horse, And the like.

In addition, the present invention can provide a composition for treating dementia, which comprises a Korean herbal medicine.

The pharmaceutical composition of the present invention may comprise a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier may include, but is not limited to, physiological saline, polyethylene glycol, ethanol, vegetable oil, and isopropyl myristate.

In one embodiment of the present invention, the preferred dosage of the pharmaceutical composition varies depending on the condition and the weight of the patient, the degree of disease, the drug form, the administration route, and the period, but can be appropriately selected by those skilled in the art. However, it is preferably administered at a daily dose of 0.001 to 300 mg / kg body weight, more preferably 0.01 to 200 mg / kg body weight.

The pharmaceutical composition of the present invention can be administered to mammals such as rats, mice, livestock, humans, and the like in various routes. The method of administration is not limited and can be administered, for example, orally, rectally, or by intravenous, intramuscular, subcutaneous, intrauterine, or intra-cerebroventricular injection.

The composition for treating dementia comprising the present invention can increase the therapeutic effect of the dementia symptom and can alleviate various side effects that have been caused when the dementia treatment agent is administered alone.

Hereinafter, preferred embodiments of the present invention will be described in order to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the following examples.

[Example]

Example  1. Dementia treatment donepezil  ( AriceptTM )and Yomi  Combined effect: Donepezil Pharmacokinetics  (1): administration of single oral administration within 5 minutes to pharmacokinetics

Donepezil is a representative oral acetylcholinesterase (ACE) inhibitor that is frequently used as a symptom relief and treatment agent for various dementia. However, it has a relatively strong toxicity in preclinical phase, and various side effects, such as gastrointestinal disorders, The use thereof is limited. Therefore, the present inventors evaluated the effect of the mutant on the pharmacokinetics of donepezil using normal male rats as a part of the combined use of donepezil and yemmi jiulhangtang to observe the drug interaction between donepezil and yemmi jiulhangtang. That is, a single oral dose of donepezil 10 mg / kg was followed by a single oral administration of 100 mg / kg of Utilized Jiwi Jiul-Huanghang within 5 minutes and 30 minutes before, 30 minutes after, 1, 2, 3, 4, 6, After 24 hours, blood donepezil concentrations were measured and noncompartmental pharmacokinetics data (C _max , T _max , AUC, t _1/2 and MRT) were calculated and compared with donepezil 10 mg / kg alone.

The composition of the used Yumi 황 Huanghang is shown in Table 1 below

Herbs Scientific Names Amounts (g) Rehmanniae Radix Preparat Rehmannia glutinosa I have Liboschitz. purpurea Makino 2 Dioscoreae Rhizoma Dioscorea batatas Decaisne One Corni Fructus Cornus Officinalis Siebold et Zuccarini One Hoelen Poria cocos Wolf One Moutan Cortex Paeonia suffruticosa Andrews One Alismatis Rhizoma Alisma orientale Juzepczuk One Total 6 types 7

1.1. Preparation of experimental animals

In this example, male Spf / VAF Outbred Crl: CD [SD] male rats (OrientBio, Seungnam, Korea) were used as experimental animals. 84 male SPF / VAF Outbred Crl: CD [SD] Male rats (OrientBio, Seungnam, Korea) were obtained and after 37 days of purification, the animals of constant weight were selected and classified into two groups (414.30 ± 18.35 g, 382 to 442 g).

- Donepezil 10 mg / kg alone

- Donepezil 10 mg / kg and Yomi Jiwanghangang 100 mg / kg within 5 minutes

1.2. Administration and Method of Blood Collection

The donepezil was dissolved in sterilized distilled water and was administered once at a dose of 5 ml / kg. The dose of donepezil (100 mg / kg was dissolved in sterile distilled water and administered in the same dose once orally. On the other hand, in donepezil alone group, only single oral administration of sterilized distilled water of the same volume was carried out instead of Yukmi jiulhangang (Table 2, Fig. 1).

Approximately 0.5 ml of whole blood from the orbital venous organs was collected with 50 IU of heparin (Sigma-Aldrich, St. Louis, MO, USA) at 30 minutes, 30 minutes, 1, 2, 3, 4, 6, ), And the plasma was separated by centrifugation at 13000 rpm for 10 minutes immediately after collection. The separated plasma was stored at -150 ° C until LC-MS / MS analysis.

Group Sex Dose (mg / kg / day) Animal No. CIM-14-02-15-02 D + YMJHT PK - Donepezil + YMJHT, within 5 min Active Male Donepezil (10 mg / kg, orally administration) A01 ~ A05 Active Male Donepezil and YMJHT (10 and 100 mg / kg, orally co-administration) B01 to B05

Donepezil serum concentration : Donepezil concentration was measured by LC-MS / MS using the internal standard of Carbamazepine (Sigma-Aldrich, St. Louis, Mo., USA) Chromatographic analysis was performed using Agilent 1100 Series HPLC (Agilent Technologies, Santa Clara, Calif., USA) and column effluent was analyzed using an API 2000 triple-quadruple mass spectrometer (Applied Biosystems, Foster City, CA, USA) .

HPLC conditions

^{Column: Waters Symmetry TM C18 (2.1} × 50 mm, 3.5 μm) (Waters Corp., Milford, MA, USA)

Column oven: 30 ° C

Mobile phase: Linear gradient from 2% acetonitrile / 98% DI water (0.1% formic acid) to 98% acetonitrile / 2% DI water (0.1% formic acid)

Flow rate: 0.30 ml / min

Injection Volume: 4.0 μl

LC-MS / MS

Ion source: Turbo Ion Spray (500 < 0 > C)

Polarity: Positive

Carbamazepine (IS) = m / z 237 > 194 (Retention time: 0.78 min), Donepezil = 380 > 91 (Retention time: 0.39 min)

Standard Curve: Analyst 1.4.1, Linear (1 / x, no Iterate)

1.3. Check the result

Donepezil concentration (ng / ml), pharmacokinetic parameters - Cmax, Tmax, AUC, t1 / 2, and plasma concentrations were measured 30 minutes before donepezil administration, 30 minutes after administration, 1, 2, 3, 4, 6, And MRT were compared using a noncompartmental pharmacokinetics data analyzer program (PK solutions 2.0; Summit, Montrose, CO, USA).

1.3.1. Concentration of donepezil in blood

Donepezil alone or in combination with donepezil and yemmi jiulgangtang started to detect donepezil in the blood from 30 minutes after each administration and was continuously detected until 24 hours after administration. On the other hand, significant changes in plasma donepezil concentrations were not observed during the whole blood collection period compared with donepezil 10 mg / kg alone group (see FIG. 2).

In the donepezil group, the plasma donepezil concentration was 6.96, -12.22, and 7.94, respectively, compared with donepezil 10 mg / kg alone group, which was 30 minutes after administration and 1, 2, 3, 4, 6, 5.97, 28.55, 29.42, 27.52 and 26.67%, respectively.

1.3.2. Change in Tmax

In Donepezil and Yukmi jiwanghong combined group, plasma Tmax of donepezil was 1.20 ± 1.04 hr and 71.43% of donepezil alone was not significantly different compared to 0.70 ± 0.27 hr (Table 3).

Parameters Donepezil (10 mg / kg) Without YMJHT co-administration (Distill water) With YMJHTco-administration
(100 mg / kg) Tmax (hrs) 0.70 + - 0.27 1.20 ± 1.04 Cmax (ng / ml) 148.56 ± 52.09 139.68 ± 35.96 AUC _{0- t} (hr · ng / ml) 615.35 ± 301.34 667.55 + - 233.65 AUC _{0 - inf} (hr · ng / ml) 635.25 ± 288.40 698.57 ± 219.56 t _1/2 (hr) 3.98 ± 1.17 3.22 ± 0.83 MRT _inf (hr) 4.61 + - 0.72 4.52 + - 0.72

1.3.3. Change in Cmax

In Donepezil and Yommi jiorhongtang, the plasma Cmax of Donepezil was 139.68 ± 35.96 ng / ml and the difference was -5.98% compared to 148.56 ± 52.09 ng / ml of donepezil alone (Table 3).

1.3.4. Changes in AUC

The donepezil AUC _{0 -t value} was 667.55 ± 233.65 hr · ng / ml in the donepezil group and 61.35 ± 301.34 hr · ng / ml in the donepezil group, and the AUC _{0 -t} was 8.13% The plasma donepezil AUC _{0 - inf} was also 698.57 ± 219.56 hr · ng / ml in the donepezil and the yomi jiulhongtang group, and 9.97% in the donepezil alone group compared to 635.25 ± 288.40 hr · ng / ml in the donepezil group (Table 3).

1.3.5. t _1/2 Change of

In the donepezil and yemmi jiorhongtang groups, t _1/2 of donepezil was 3.22 ± 0.83 hr, which was significantly lower than that of donepezil alone (3.98 ± 1.17 hr, -19.03%) (Table 3).

1.3.6. MRT _inf Change of

In the donepezil group and donepezil group, donepezil had a significantly lower MRTinf of 4.52 ± 0.72 hr compared to 4.61 ± 0.72 hr of donepezil alone (Table 3).

In Example 1, single-dose combination administration of intramuscular injections of 5 mg / kg / day did not significantly affect the absorption and excretion of donepezil, ie, bioavailability. However, its effectiveness as an effective herbal medicine for vascular dementia In order to evaluate the effect of donepezil on the pharmacokinetics of donepezil after repeated doses of 5 mg /

Example  2. Dementia treatment donepezil  ( Aricept ^TM )and Yomi  Combined effect: Donepezil Pharmacokinetics  (2): repeated oral administration for 7 days at 5-minute intervals, pharmacokinetics

In Example 2, donepezil and yemmi jiwanghang were administered for 5 days or less for 7 days repeatedly orally in order to evaluate the interaction between donepezil and donepezil more clearly than in Example 1. The effects of donepezil on drug power were measured in normal male Rats were used to evaluate drug interactions between donepezil and YMI. Donepezil 10 mg / kg and 100 mg / kg of cow's milk were administered orally repeatedly for 5 days or less for 7 days and 30 minutes before the last 7 donepezil, 30 minutes, 1, 2, 3, 4, 6, 8 And donepezil alone, and noncompartmental pharmacokinetics (PK) data (Cmax, Tmax, AUC, t1 / 2 and MRT) were calculated and compared with donepezil monotherapy group.

2.1. Experimental Method

2.1.1. Experimental animal

A total of 84 SPF / VAF Outbred Crl: CD [SD] male rats (OrientBio, Seungnam, Korea) were obtained. After 11 days of purification, the animals were divided into two groups (247.00 ± 11.76 g, 233 to 264 g).

- donepezil 10 mg / kg single composition administration group

- Donepezil 10 mg / kg and YMJHT 100 mg / kg within 5 minutes

2.1.2. Administration and Method of Blood Collection

Kg of donepezil (Jeil Pharm., Co., Ltd., Youngin, Korea) was dissolved in sterilized distilled water and orally administered at 5 ml / kg. Dissolved in distilled water, and orally administered at the same dose. Donepezil and Yemmi jiulhangtang were orally administered once a day for 7 days repeatedly. In the case of donepezil alone, the same amount of sterilized distilled water was used instead of Yummi jiulhangtang for oral administration within 5 minutes instead of Yumi jiwanghang (Table 4, Fig. 3).

Approximately 0.5 ml of whole blood was collected from orbital veins in 50 IU of heparin (Sigma-Aldrich, St. Louis, MO, USA) for 30 min before the last 7 doses of donepezil, 30 min, and 1, 2, 3, 4, 6, Louise, MO, USA), and the plasma was separated by centrifugation at 13,000 rpm for 10 minutes immediately after collection. The separated plasma was stored at -150 ° C until LC / MS / MS analysis.

Group Sex Dose (mg / kg / day) Animal No. CIMI-14-02-15-03 D + YMJHTPK (2) - Donepezil + YMJHT, within 5 min Active Male Donepezil (10 mg / kg; oral administration) A01 ~ A05 Active Male Donepezil and YMJHT (10 and 100 mg / kg; oral co-administration) B01 to B05

Donepezil serum concentration: Donepezil concentration was measured by LC-MS / MS using the internal standard of Carbamazepine (Sigma-Aldrich, St. Louis, Mo., USA) Chromatographic analysis was performed using Agilent 1100 Series HPLC (Agilent Technologies, Santa Clara, Calif., USA) and column effluent was analyzed using an API 2000 triple-quadruple mass spectrometer (Applied Biosystems, Foster City, CA, USA) .

HPLC conditions

Column: Waters Symmetry ( ^TM) C18 (2.1 x 50 mm, 3.5 m) (Waters Corp., Milford, Mass., USA)

Column oven: 30 ° C

Mobile phase: Linear gradient from 2% acetonitrile / 98% DI water (0.1% formic acid) to 98% acetonitrile / 2% DI water (0.1% formic acid)

Flow rate: 0.30 ml / min

Injection Volume: 4.0 μl

LC-MS / MS

Ion source: Turbo Ion Spray (500 < 0 > C)

Polarity: Positive

Carbamazepine (IS) = m / z 237 > 194 (Retention time: 0.78 min), Donepezil = 380 > 91 (Retention time: 0.39 min)

Standard Curve: Analyst 1.4.1, Linear (1 / x, no Iterate)

2.2. Check the result

Donepezil concentration (ng / ml), pharmacokinetic parameters - Cmax, Tmax, AUC, and plasma concentrations of the plasma were measured 30 minutes before the last 7 donepezil doses, 30 minutes after dosing, 1, 2, 3, 4, 6, t1 / 2 and MRT were compared using noncompartmental pharmacokinetics data analyzer program (PK solutions 2.0; Summit, Montrose, CO, USA).

2.2.1. Change in weight

Donepezil and Yukmi jiulhwangjang No significant changes in body weight and body weight were observed during the experimental period compared to the donepezil alone group (Table 5, Fig. 4).

Groups Donepezil (10 mg / kg) Without YMJHT co-administration (Distill water) With YMJHTco-administration (100 mg / kg) Body weights At first co-administration [A] 226.20 ± 9.52 221.80 ± 13.68 At last 7th co-administration [B] 259.40 ± 12.84 253.00 ± 15.56 Body weight gains Experimental periods [B] - [A] 33.20 + - 5.26 31.20 ± 6.94

2.2.2. Concentration of donepezil in blood

Donepezil or donepezil and donepezil in the 5 min group were started to detect donepezil in the blood from 30 minutes before the last 7 doses of donepezil and were continuously detected until 24 hours after administration. On the other hand, significant changes in plasma donepezil concentrations were not observed during the whole blood collection period in donepezil and cetuximab in combination with donepezil alone or in combination with sevoflurane (Figure 5).

Donepezil and donepezil alone were given 30 minutes after administration, 7 days after oral administration, and 1, 2, 3, 4, 6, 8 and 24 hours after administration. -21.73, -23.18, -24.63, -15.89, -14.24, -18.65, -6.10 and -19.70%, respectively.

2.2.3. Change in Tmax

The plasma Tmax of donepezil was 1.10 ± 1.08 hr, which was significantly lower than that of donepezil alone (0.90 ± 0.65 hr, 22.22%) in the group treated with donepezil and yommi Table 6).

Parameters Donepezil (10 mg / kg) Without YMJHT co-administration (Distill water) With YMJHTco-administration
(100 mg / kg) C _max (ng / ml) 0.90 ± 0.65 1.10 ± 1.08 T _max (hrs) 228.80 ± 63.24 174.20 ± 42.56 AUC _{0- t} (hr · ng / ml) 1015.05 ± 349.85 867.78 + - 218.32 AUC _{0 - inf} (hr · ng / ml) 1043.39 ± 327.17 891.27 ± 190.34 t _1/2 (hr) 3.02 ± 0.97 3.61 ± 0.66 MRT _inf (hr) 4.02 ± 0.65 4.53 + - 0.67

2.2.4. Change in Cmax

The plasma Cmax of donepezil was 174.20 ± 42.56 ng / ml and the change of -23.86% compared to 228.80 ± 63.24 ng / ml of donepezil alone in the donepezil and cefoxitin group treated with 7 times repeated oral administration within 5 minutes (Table 6).

2.2.5. Changes in AUC

Serum donepezil AUC _0-t and AUC _{0 - inf} were 867.76 ± 218.32 and 891.27 ± 190.34 hr · ng / ml, respectively, in the donepezil and yommi jiulonghong combined treatment group, AUC _{0 -t} and AUC _{0 - inf} were significantly less than -14.51 and -14.58%, respectively (Table 6), compared with the values of 349.85 and 1043.39 ± 327.17 hr · ng / ml.

2.2.6. t _1/2 Change of

Donepezil plasma t1 / 2 was 3.61 ± 0.66 hr and donepezil alone was not significantly different from 3.02 ± 0.97 hr in donepezil and yommi jiulgangtang group. Table 6).

2.2.7. MRT _inf Change of

The donepezil plasma MRTinf was 4.53 ± 0.67 hr, which was significantly lower than donepezil alone (4.02 ± 0.65 hr, 12.73%) in the group treated with donepezil and yommi ).

As a result of this Example 2, all the experimental animals used in this experiment showed normal weight gain within the weight gain range of normal male SD rats of the same week, and donepezil and Yukmi jiwanghang were repeatedly administered for 7 days No significant changes in body weight and body weight were observed in the treated group compared to the donepezil alone group. Therefore, it was concluded that the repeated administration of donepezil and Yemmi jiwanghang for 5 min within 7 days under the conditions of this experiment did not affect the body weight of rats.

Donepezil is well absorbed during oral administration, has a bioavailability of 100%, and is known to be unaffected by food intake and administration time. Donepezil has a very high protein binding rate of 96%, approximately 75% binds to albumin and the remaining 21% binds to α1-acid glycoprotein. In healthy adults, Tmax is generally known to be 3 to 4 hours orally, and is relatively slowly excreted in the urine and feces through the kidneys and feces, and t1 / 2 is known to be approximately 70 hours. On the other hand, unlike humans, rats are known to have a Tmax of 0.5 to 1 hr and a t1 / 2 of about 1.5 to 2 hours after single oral administration. As a result of Example 2, Tmax was 0.90 ± 0.65 hr in donepezil alone 7 days, and Cmax, AUC0-t, AUC0-inf, t1 / 2 and MRTinf were 228.80 ± 63.24 ng / ml and 1015.05 ± 349.85 hr · ng / ml, 1043.39 ± 327.17 hr · ng / ml, 3.02 ± 0.97 hr and 4.02 ± 0.65 hr, respectively. The donepezil 10 mg / kg and yukmi jihwangtang 100 mg / kg to less than 5 minutes in the test group treated 7-day repeated oral donepezil combination of _{Tmax, Cmax, AUC 0 -t,} AUC 0 - _inf a, t _1/2 and MRT _inf Were observed at 1.10 ± 1.08 hr, 174.20 ± 42.56 ng / ml, 867.76 ± 218.32 hr · ng / ml, 891.27 ± 190.34 hr · ng / ml, 3.61 ± 0.66 hr and 4.53 ± 0.67 hr, respectively, and donepezil 10 mg / kg alone Compared to the control group, 22.22, -23.86, -14.51, -14.58, 19.59 and 12.73%, respectively, but no significant change was observed compared to the donepezil alone group.

Donepezil is easily metabolized into four metabolites in the first pass, two of which are known to be the major active substances, and donepezil is easily metabolized by cytochrome P450 isoenzymes CYP2D6 and CYP3A4, and therefore, drug interactions with these isoenzymes It is known that it can be shown. In Example 1, it was observed that the administration of single dose of 5 mg / kg donepezil did not significantly affect the overall oral bioavailability of donepezil. In Example 1, 10 mg / kg of donepezil and 100 mg / In the present study, the oral bioavailability of donepezil was significantly lower than that of donepezil, and the oral administration of donepezil did not significantly affect the oral bioavailability of donepezil. It is anticipated that it will be possible to provide a treatment method for both oriental and oriental oriental herbs.

Example  3. Dementia treatment Donepezil and Yomi Jiu Huang Tang  ( YMJHT ) Combination of  Administration: pMCAO  Effect of Combined Administration of YMJHT on the Improvement of Brain Function in Donepezil in Rat Vascular Dementia Rats

In Example 3, based on the results of Examples 1 and 2, the effect of donepezil on neuroprotection, cognition, and motor function recovery according to the combination of YMJHT was evaluated using pMCAO rats, a typical stroke and vascular dementia model . YMJHT 400, 200 and 100 mg / kg were dissolved in sterilized distilled water and administered orally with 10 mg / kg donepezil at intervals of 5 minutes within 28 days from once daily for 24 hours after induction of pMCAO. The body weight, brain weight, TTC The expression of STAT3 and Pim-1 mRNA, which are known to regulate apoptosis, was examined by real-time RT-PCR. Infarct / defect volume, neurological motor behavior, Histopathological examination of the cerebral atrophy and the number of denatured neurons in the area around the defect (sixth coronal section) revealed that apoptosis index (cleaved caspase-3 and PARP), iNOS-related oxidative stress index (NT) (4-HNE) immunoreactive neurons were observed by ABC-based immunohistochemistry. In addition, changes in the antioxidant defense system (lipid peroxidation - MDA content, GSH content, SOD and CAT activity) in the infarct / defect peripheral cerebral cortex were also observed. In the third embodiment, the limb placing test and the body swing test were measured by neurological exercise test 1 day before pMCAO, 1, 3, 7, 14, 21 and 28 days after pMCAO, Tests were measured after 14 and 28 days of pMCAO, respectively. Experimental results in all YMJHT and donepezil 10 mg / kg doses within 5 minutes showed that donepezil 10 mg / kg group and YMJHT 400 mg / kg group alone, which are typical oral ACE inhibitors frequently used for symptom relief and treatment of various dementia, Respectively. The dose of donepezil used in Example 3, 10 mg / kg, was selected based on the results of previous in vivo evaluation of efficacy of the drug, and the dose of 400, 200 or 100 mg / kg of YMJHT, Administration was set on the basis of Examples 1 and 2. In Example 3, an appropriate dose of YMJHT (80, 40 or 20 mg / ml concentration) or donepezil (2 mg / ml concentration) was dissolved in sterile distilled water and a dose of 5 ml / kg, , And 5 minutes apart (Table 7; Fig. 6).

3.1. Experimental Method

3.1.1. Experimental animal

A total of 150 6 week-old male SPF / VAF Crl: CD1 [SD] rats (OrientBio, Seungnam, Korea) were obtained and after purging for 52 days, 140 pMCAO surgeries were performed. operation. After 24 hours of pMCAO or sham surgery, body weight (sham rats: 493.63 ± 15.79 g, 472.00 to 513.00 g; pMCAO rats: 487.10 ± 13.81 g, 465.00 to 509.00 g) Rats: 14.00 ± 1.07 ipsilateral (to right) swings, 13.00 ~ 16.00 ipsilateral swings; 1.94 ± 0.78 ipsilateral swings, 1.00 to 3.00 ipsilateral swings: 1.98 ± 0.81 ipsilateral swings, 1.00 to 4.00 ipsilateral swings), forelimb placing test all max scores = 12.00) and hindlimb placing test (sham rats: 0.75 占 .71 scores, 0.00 to 2.00 scores; pMCAO rats: all max scores = 6.00) As a standard, 8 mice per group were used in this experiment. All experimental animals were subjected to overnight cessation (18 hours or more; no negative water fasting) before pMCAO or sham surgery and before the final sacrifice day to reduce individual differences in feed intake (Table 7, Fig. 6).

(1) sham control group: sterile distilled water (5 ml / kg) after stomach operation twice at intervals of 5 minutes Surgical medium Control group

(2) pMCAO control: sterilized distilled water (5 ml / kg) after pMCAO operation 2 times every 5 minutes pMCAO medium control

(3) Donepezil: Donepezil 10 mg / kg and sterile distilled water (5 ml / kg) for 5 minutes after pMCAO operation donepezil 10 mg / kg single administration

(4) YMJHT: After sterilized distilled water (5 ml / kg) and YMJHT 400 mg / kg every 5 minutes after pMCAO operation, YMJHT 400 mg / kg alone

(5) DB400: Concomitant administration of donepezil 10 mg / kg and YMJHT 400 mg / kg for 5 minutes after pMCAO surgery

(6) DB200: Concomitant administration of donepezil 10 mg / kg and YMJHT 200 mg / kg for 5 minutes after pMCAO surgery

(7) DB100: Concomitant administration of donepezil 10 mg / kg and YMJHT 200 mg / kg for 5 minutes after pMCAO surgery

Group Surgery Dose (mg / kg / day) Animal No. CIMI-16-02-03 D + YMJHTPD : Effects on pMCAO Rats Control Sham Distilled water 5 ml / kg R01 ~ R08 Control pMCAO Distilled water 5 ml / kg R09 to R16 Reference pMCAO Donepezil single formula ( 10 mg / kg) R17 to R24 Reference pMCAO YMJHT single formula ( 400 mg / kg) R25 to R32 Active pMCAO Donepezil and YMJHT ( 10 and 400 mg / kg) R33 to R40 Active pMCAO Donepezil and YMJHT ( 10 and 200 mg / kg) R41 to R48 Active pMCAO Donepezil and YMJHT ( 10 and 100 mg / kg) R49 to R56

3.1.2. pMCAO surgery

The right proximal MCA was permanently closed to induce focal ischemic infarction of the cerebral cortex. (Hana Pharm. Co., Hwasung, Korea) and 70% isoflurane were administered using a rodent anesthesia device (Surgivet, Waukesha, Wis., USA) and a ventilator (Model 687, Harvard Apparatus, Cambridge, UK) % and systemic inhalation anesthesia with N ₂ O and 28.5% O ₂ gas mixture and maintained under anesthesia with 1 ~ 1.5% isoflurane, enrofloxacin ( 5 mg / kg, Neotril-50 injection, SamU Median Co., Yesan, Korea) the After the intraperitoneal injection, the right temporal skin was cut between the orbit and the external auditory canal to expose the temporalis muscle, and the facial nerve and zygomatic arch were excised, Some were exposed. Subsequently, proximal MCA was exposed through subtemporal craniectomy using a dental drill (Strong 204, Saeshin, Daegu, Korea) and then an electronic coagulator immediately underneath the cerebral vein near the olfactory tract (Change-A TipTM, Aaron Medical Ind. , FL, USA) was used to permanently close the proximal MCA. Sham MCAO exposed the proximal MCA in the same manner as in pMCAO and closed the window without electronic coagulation. The body temperature was maintained constant at 37.0 ± 1 ℃ using a rectal thermometer and a thermal pad after inhalation general anesthesia. Povidone Iodine (BetadineTM, Korea Pharma, Hwasung, Korea) was applied and protected after surgery. The overall mortality rate was 5 %.

3.1.3. drug injection

YMJHT 400, 200 and 100 mg / kg were dissolved in sterilized distilled water and were orally administered orally with donepezil 10 mg / kg every other day for 28 days within 28 days from 24 hours after pMCAO induction. (53 mg as donepezil tablet - Silvercept ™ (Myung In Pharm. Co., Ltd., Hwasung, Korea) at an appropriate dose of YMJHT (80, 40 or 20 mg / ml) or donepezil Dissolved or suspended in distilled water and administered in combination with gastric gavage using a metal sonde attached to a 5 ml syringe at a dose of 5 ml / kg, which is a general oral dose of rat, within 5 minutes. In the case of YMJHT alone, the same dosage (5 ml / kg) of sterile distilled water was used instead of donepezil in 5 min intervals. In the case of donepezil alone, YMJHT was administered in the same dose of sterilized distilled water every 5 minutes. In the sham and pMCAO control group, only sterile distilled water medium was administered orally twice daily for 28 days at 28-day intervals from 24 hours after pMCAO induction. The dosing dose of donepezil used in Example 3, 10 mg / kg, was compared with the previous in vivo efficacy evaluation [Takasaki et al., 2011; Hu et al., 2012], and the administration of YMJHT, 400, 200 or 100 mg / kg, and the interval of less than 5 minutes were set on the basis of Examples 1 and 2 6).

3.1.4. Observations

Through the above method, weights, brain weights, infarct / defect volume through TTC staining, neurological and cognitive athletic behavior tests, mRNA expression in the infarct / defect peripheral cerebral cortex (sixth coronal section) System, histological and immunohistochemical changes were confirmed.

(1) Measurement of body weight: The body weights of all experimental animals were measured after pMCAO 1 day, pMCAO operation day 1, 8, 15, 22, 28 and 29 days.

(2) Neurologic motor behavior test: Forelimb placing test (scores, Max = 12), hindlimb placing test (scores, Max = 6) and body swing test (numbers and percentages of ipsilateral swings) were measured 1 day before pMCAO (base line), pMCAO 1, 3, 7, 14, 21, and 28 days respectively.

(3) Cognitive Exercise Test: Water maze test was measured after 14 and 28 days of pMCAO, respectively. All animals were monitored for changes in cognition and learning ability by measuring the distance and time to reach a water maze tank (150 × 50 cm) escape platform (15 × 30 cm) over 3 trials.

(4) Brain weight and infarct / defect volume: Brain tissues were harvested at the final sacrifice day, and absolute weight and relative weight (% relative weight with respect to body weight) were measured, and brain stainless steel coronal matrix (Harvard apparatus, Holliston, MA Sixteen consecutive 2-mm-thick sections of brain tissue were stained with 2% TTC (Cat No. T8877, Sigma-Aldrich, St. Louis, MO, USA) (ISolution FL ver. 9.1, IMT i-solution Inc., Canada) using the formula of infarct / defect region observed in the infarct / defect region of six cerebral slices × 2 mm (thicknesses) .

(5) Realtime RT-PCR: Expression of STAT3 and Pim-1 mRNA was measured using a CFX96 ™ Real-Time System (Bio-Rad, Hercules, CA, USA) and a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, ) Were used to calculate relative expressions / β-actin mRNA (Table 8)

(6) Antioxidant defense system: lipid peroxidation MDA content, GSH content, SOD and CAT activity were measured using UV / VIS spectrophotometer (OPTIZEN POP, Mecasys, Daejeon, Korea)

(7) Histologic observation: infarct / defect peripheral cerebral cortical atrophy and number of denatured nerve cells

(8) Immunohistochemical observations: Cleaved caspase-3 and PARP, iNOS-related oxidative stress (NT) and lipid peroxidation index (4-HNE)

Target 5'-3 ' Sequence NCBI accession No.
(Production size) STAT 3 Sense
Antisense GAGGGCCATCCTAAGCACAAAGC
GGACATCGGCAGGTCAATGGTATT NM_012747
(400 bp) Pim-1 Sense
Antisense TGCTCTTGTCCAAGATCAACTCCCT
AGGGAGTTGATCTTGGACAAGAGCA NM_017034
(422 bp) β-actin Sense
Antisense CTGTCGAGTCGCGTCCACCCGCGAG
CTCGCGGGTGGACGCGACTCGACAG NC_000071.6
(341 bp)

Antisera or detection kits Code Source Dilution Primary antisera * Anti-cleaved caspase-3 (Asp175) polyclonal antibody 9661 Cell Signaling Technology Inc., Beverly, MA, USA 1: 400 Anti-cleaved PARP (h215) antibody sc-23461 Santa Cruz Biotechnology, Santa Cruz, CA, USA 1: 100 Anti-4-Hydroxynonenal polyclonal antibody Ab46545 Abcam, Cambridge, UK 1: 200 Anti-Nitrotyrosine polyclonal antibody 06-284 Millipore, Temecula, CA, USA 1: 100 Detection kits Vectastain Elite ABC Kit PK-6200 Vector Lab. Inc., Burlingame, CA, USA 1:50 Peroxidae substrate kit SK-4100 Vector Lab. Inc., Burlingame, CA, USA 1:50

3.2. Experiment result

3.2.1. Changes in body weight and weight gain

In the pMCAO control group, a significant (p <0.01) decrease in body weight was observed after 8 days of pMCAO operation and 7 days after the administration of pMCAO, and the gain in pMCAO operation was also significantly decreased (p <0.01) (P <0.01 or p <0.05) was significantly increased in the donepezil and YMJHT groups than in the pMCAO control group. The increase in body weight of pMCAO after 22 and 28 days of pMCAO operation, (P <0.01), respectively. In addition, significant increases (p <0.01) in body weight gain compared to the pMCAO control group in the combination treatment with donepezil 10 mg / kg and YMJHT 400, 200 and 100 mg / kg within 5 minutes were recognized from 15, 15 and 22 days after pMCAO operation (P <0.001), and the pMCAO aggravation for 29 days was also significantly (p <0.01) higher than the pMCAO control group. (P <0.01 or p <0.05) was significantly higher than that of donepezil 10 mg / kg alone (p <0.01 or p <0.05) in the combination of donepezil 10 mg / kg and YMJHT 400, 200 and 100 mg / , 28 and 28 days after the start of the pMCAO procedure, significant increases (p &lt; 0.01) of pMCAO Surgery 29 days of body weight gain were recognized, respectively, depending on the dose of YMJHT combination (Table 10;

The pMCAO control group showed a -98.14% change in the weight gain of the pMCAO control group compared to the sham control group, but donepezil 10 mg / kg and YMJHT 400 mg / kg alone In the group administered with donepezil 10 mg / kg and YMJHT 400, 200 or 100 mg / kg within 5 min, the change was 1433.33, 900.00, 3608.33, 2708.33 and 2241.67%, respectively, compared with the pMCAO control group.

Periods

Groups Body weights (g) Weight gains
[BA] 1 day before pMCAO The day of pMCAO [A] Sacrifice [B] Controls Sham 502.50 ± 14.59 481.63 + - 15.49 562.25 ± 21.52 80.63 8.02 pMCAO 502.13 ± 12.94 481.75 ± 13.85 483.25 ± 13.79 ^a 1.50 ± 2.88 ^e Single formula treated Donepezil 503.00 ± 17.00 481.88 + - 16.36 504.88 ± 14.02 ^ab 23.00 ± 5.66 ^f YMJHT 502.88 ± 10.51 482.25 + - 11.31 497.25 ± 9.38 ^ac 15.00 ± 7.27 ^f Donepezil 10 mg / kg and YMJHTco-administration 400 mg / kg 503.13 + - 14.80 483.13 + - 15.15 538.75 ± 11.63 ^abd 55.63 ± 5.83 ^efg 200 mg / kg 501.75 ± 13.22 482.38 ± 13.20 524.50 ± 10.17 ^abd 42.13 + - 8.76 ^eFg 100 mg / kg 502.00 ± 13.62 480.88 +/- 16.01 516.00 ± 12.26 ^ab 35.13 + - 11.70 ^eh

3.3.2. Neurological behavioral test - Forelimb placing test

Neurological behavioral behavior test after 24 hours of pMCAO surgery - Only the test animals with the forelimb placing test score of Max (= 12) were selected. Therefore, the increase of the forelimb placing test score in the pMCAO control group was significant (p <0.01) (P <0.01 or p <0.05) was significantly lower in the donepezil and YMJHT group than in the pMCAO control group (p <0.01 or p <0.05) (P <0.01). However, there was no statistically significant difference (p <0.01) between the donepezil 10 mg / kg and YMJHT 400, 200 and 100 mg / Respectively. Particularly, the donepezil 10 mg / kg and YMJHT 400, 200 and 100 mg / kg groups within 5 minutes showed a significant decrease (p <0.01 or p <0.05) in the forelimb placing test score Were started to be recognized in a dose-dependent manner in combination with YMJHT starting from 14, 14 and 21 days after pMCAO surgery (Table 11).

Groups
After pMCAO Controls Single formula treated Donepezil 10 mg / kg and YMJHTco-administration Sham pMCAO Donepezil YMJHT 400 mg / kg 200 mg / kg 100 mg / kg Day -1 0.63 + 0.74 0.75 + 0.71 0.63 + 0.74 0.63 ± 0.92 0.75 + 0.89 0.85 ± 0.71 0.75 + 0.89 Day 1 0.88 ± 0.83 12.00 ± 0.00 ^f 12.00 ± 0.00 ^f 12.00 ± 0.00 ^f 12.00 ± 0.00 ^f 12.00 ± 0.00 ^f 12.00 ± 0.00 ^f Day 3 0.75 + 0.71 11.38 ± 0.52 ^a 11.13 ± 0.64 ^a 11.13 ± 0.64 ^a 11.00 + 0.76 ^a 11.25 + 0.71 ^a 11.25 + 0.71 ^a Day 7 0.63 + 0.74 10.13 ± 0.64 ^a 10.38 ± 0.52 ^a 10.00 ± 0.76 ^a 9.63 ± 1.06 ^a 9.88 ± 0.83 ^a 9.75 + 1.04 ^a Day 14 0.50 + - 0.76 9.75 + 0.71 ^a 8.50 ± 0.53 ^ab 8.75 + 0.89 ^ac 6.38 ± 1.19 ^usd 7.50 ± 1.07 ^abe 7.75 ± 0.71 ^ab Day 21 0.63 + 0.74 9.25 + 0.89 ^a 7.75 ± 0.71 ^ab 8.13 ± 0.64 ^ab 4.50 ± 0.76 ^usd 6.50 ± 0.53 ^usd 6.75 ± 0.71 ^usd Day 28 0.50 ± 0.53 8.63 ± 0.92 ^a 6.88 ± 0.64 ^ab 7.38 ± 0.74 ^ab 3.38 ± 0.92 ^usd 5.00 ± 0.76 ^usd 5.50 ± 0.53 ^usd

Forelimb placing test scores after 1, 3, 7, 14, 21, and 28 days of pMCAO control in the pMCAO control group were 1271.43, 1416.67, 1520.00, 1850.00, 1380.00, and 1625.00%, respectively, compared with the sham control group.

The forelimb placing test score was 0.00, -2.20, 2.47, -12.82, -16.22, and -20.29%, respectively, on the 1, 3, 7, 14, 21 and 28 days after pMCAO operation in Donepezil 10 mg / Respectively.

The forelimb placing test score on the 1, 3, 7, 14, 21 and 28 days after pMCAO operation in the YMJHT 400 mg / kg single composition administration group was 0.00, -2.20, -1.23, -10.26, -12.16 and -14.149 %, Respectively.

The forelimb placing test score was 0.00, -3.30, -4.94, and 0.39, respectively, compared with the pMCAO control group after 1, 3, 7, 14, 21 and 28 days of pMCAO operation in the combination of Donepezil 10 mg / kg and YMJHT 400 mg / -34.62, -51.35 and -60.87%, respectively.

The forelimb placing test scores were 0.00, -1.10, -2.47, and 0.40, respectively, on the 1, 3, 7, 14, 21, and 28 days after pMCAO operation in the donepezil 10 mg / kg and YMJHT 200 mg / -23.06, -29.73 and -42.03%, respectively.

The forelimb placing test score was 0.00, -1.10, -3.70, and 0.70, respectively, on the 1, 3, 7, 14, 21, and 28 days after pMCAO operation in donepezil 10 mg / kg and YMJHT 100 mg / -20.51, -27.03 and -36.23%, respectively.

3.2.3. Neurological behavioral testing - Hindlimb placing test

Neurological behavioral behavior test after 24 hours of pMCAO surgery The hindlimb placing test score was significantly higher in the pMCAO control group than in the sham control group (p <0.01) (P <0.001). However, there was no significant difference in the hindlimb placing test score between donepezil and YMJHT treated groups compared to pMCAO control group after pMCAO surgery on days 1, 3, 7, 14, 21 and 28 (P <0.01). The decrease in the hindlimb placing test score was significantly higher in the donepezil 10 mg / kg and YMJHT 400, 200 and 100 mg / kg groups than in the pMCAO control group . Particularly, there was a significant (p <0.01 or p <0.05) decrease in hindlimb placing test score in donepezil 10 mg / kg and YMJHT 400, 200 and 100 mg / Were started to be admitted to each dose-dependent dose of YMJHT after 14 days of pMCAO surgery (Table 12).

Groups
After pMCAO Controls Single formula treated Donepezil 10 mg / kg and YMJHTco-administration Sham pMCAO Donepezil YMJHT 400 mg / kg 200 mg / kg 100 mg / kg Day -1 0.38 + - 0.52 0.25 + - 0.46 0.38 + - 0.52 0.50 ± 0.53 0.38 + - 0.52 0.38 + - 0.52 0.25 + - 0.46 Day 1 0.75 + 0.71 6.00 ± 0.00 ^e 6.00 ± 0.00 ^e 6.00 ± 0.00 ^e 6.00 ± 0.00 ^e 6.00 ± 0.00 ^e 6.00 ± 0.00 ^e Day 3 0.63 + 0.74 5.75 + 0.46 ^a 5.63 ± 0.52 ^a 5.63 ± 0.52 ^a 5.63 ± 0.52 ^a 5.50 +/- 0.76 ^a 5.63 ± 0.74 ^a Day 7 0.50 + - 0.76 5.38 ± 0.52 ^a 5.25 ± 0.46 ^a 5.25 ± 0.46 ^a 4.88 ± 0.64 ^a 5.00 ± 0.76 ^a 4.88 ± 0.64 ^a Day 14 0.63 + - 0.52 5.13 + 0.83 ^a 4.13 ± 0.35 ^ab 4.13 ± 0.64 ^ab 3.00 ± 0.53 ^abc 3.38 ± 0.52 ^usd 3.50 ± 0535 ^usd Day 21 0.50 ± 0.53 4.88 ± 0.64 ^a 3.38 ± 0.52 ^ab 3.63 ± 0.52 ^ab 2.25 ± 0.46 ^abc 2.63 ± 0.52 ^abc 2.75 ± 0.46 ^usd Day 28 0.38 + - 0.52 4.38 ± 0.52 ^a 3.13 ± 0.64 ^ab 3.38 ± 0.52 ^ab 1.50 ± 0.53 ^abc 2.13 ± 0.64 ^abc 2.25 ± 0.71 ^usd

The pancreatic pMCAO control group showed changes in the forelimb placing test scores after 1, 3, 7, 14, 21, and 28 days compared with the sham control group at 700.00, 820.00, 975.00, 720.00, 875.00 and 1066.67%, respectively.

The hindlimb placing test score on days 1, 3, 7, 14, 21, and 28 of donepezil 10 mg / kg single-composition administration group was 0.00, -2.17, -2.33, -19.51, -30.77 and -28.57 %, Respectively.

The hindlimb placing test scores on days 1, 3, 7, 14, 21, and 28 of pMCAO surgery in the group treated with YMJHT 400 mg / kg alone were 0.00, -2.17, -2.33, -19.51, -25.64 and -22.86 %, Respectively.

The hindlimb placing test score on the 1, 3, 7, 14, 21 and 28 days after pMCAO surgery in donepezil 10 mg / kg and YMJHT 400 mg / kg within 5 min group was 0.00, -2.17, -9.30, -41.46, -53.85 and -65.71%, respectively.

The hindlimb placing test scores were 0.00, -4.35, and -6.98, respectively, after pMCAO surgery on days 1, 3, 7, 14, 21, and 28 of Donepezil 10 mg / kg and YMJHT 200 mg / -34.15, -46.15 and -51.43%, respectively.

The hindlimb placing test scores were 0.00, -2.17, -9.30, and -0.17, respectively, compared with the pMCAO control group after 1, 3, 7, 14, 21, and 28 days of pMCAO operation in donepezil 10 mg / kg and YMJHT 100 mg / -31.71, -43.59 and -48.57%, respectively.

3.2.4. Neurological Exercise Test - Body swing test

Neurological Exercise Behavior after 24 hours of pMCAO Surgery (p <0.01) was significantly higher in the pMCAO control group than in the sham control group, because only the number of body swings was similarly decreased in the body swing test (right side) (P <0.01 or p <0.05) in the donepezil and YMJHT alone groups compared to the pMCAO control group, although the number of body swings to the right and the ratio decreased after 1, 3, 7, 14, ), The increase in the number of body swings and the rate of increase in the number of body swings to the right began to be recognized from 14 days after the operation of pMCAO, and significantly increased in the donepezil 10 mg / kg and YMJHT 400, 200 and 100 mg / p <0.01). The increase in the number and ratio of body swings to the right side began to be recognized after 14 days of pMCAO surgery. In particular, the number of body swings to the right (p <0.01 or p <0.05) was significantly higher in donepezil 10 mg / kg and YMJHT 400, 200 and 100 mg / And an increase in the ratio began to be recognized in a dose-dependent manner in combination with YMJHT starting from 14 days after pMCAO surgery (Tables 13 and 14).

Groups
After pMCAO Controls Single formula treated Donepezil 10 mg / kg and YMJHTco-administration Sham pMCAO Donepezil YMJHT 400 mg / kg 200 mg / kg 100 mg / kg Day -1 15.25 + 1.67 15.13 + - 1.46 15.25 + - 1.04 15.50 ± 1.60 15.25 + - 2.12 15.25 + 1.16 15.38 ± 0.92 Day 1 14.00 ± 1.07 1.88 ± 0.83 ^a 1.88 ± 0.83 ^a 2.00 0.93 ^a 2.00 ± 0.76 ^a 2.13 + 0.64 ^a 1.75 + 0.89 ^a Day 3 14.63 ± 1.30 2.25 ± 0.89 ^a 2.50 ± 0.76 ^a 2.75 ± 1.16 ^a 2.63 ± 0.92 ^a 2.63 ± 0.92 ^a 2.75 ± 1.28 ^a Day 7 15.38 ± 1.41 3.50 ± 1.20 ^a 3.88 ± 0.99 ^a 3.63 ± 0.92 ^a 3.88 ± 0.99 ^a 3.63 ± 0.52 ^a 3.63 ± 1.41 ^a Day 14 15.50 ± 1.20 3.75 ± 1.28 ^a 6.13 ± 0.99 ^ab 5.25 + 1.04 ^ac 9.13 ± 1.36 ^usd 8.13 ± 1.13 ^abd 7.50 ± 0.93 ^usd Day 21 15.38 ± 1.30 4.38 ± 1.30 ^a 8.50 ± 1.07 ^ab 6.75 ± 1.04 ^ab 11.38 ± 1.30 ^usd 10.38 ± 1.39 ^usd 9.75 + 0.89 ^abe Day 28 15.38 1.51 5.13 ± 1.25 ^a 9.75 ± 1.39 ^ab 8.00 ± 1.31 ^ab 13.25 ± 1.04 ^usd 11.88 ± 0.83 ^abd 11.38 ± 0.92 ^usd

Groups
After pMCAO Controls Single formula treated Donepezil 10 mg / kg and YMJHTco-administration Sham pMCAO Donepezil YMJHT 400 mg / kg 200 mg / kg 100 mg / kg Day -1 50.83 + - 5.56 50.42 + - 4.86 50.83 + - 3.45 51.67 + - 5.35 50.83 + - 7.07 50.83 + - 3.88 51.25 + - 3.05 Day 1 46.67 ± 3.56 6.25 ± 2.78 ^a 6.25 ± 2.78 ^a 6.67 ± 3.09 ^a 6.67 ± 2.52 ^a 7.08 ± 2.14 ^a 5.83 ± 2.95 ^a Day 3 48.75 ± 4.34 7.50 2.95 ^a 8.33 + - 2.52 ^a 9.17 ± 3.88 ^a 8.75 ± 3.05 ^a 8.75 ± 3.05 ^a 9.17 ± 4.27 ^a Day 7 51.25 + - 4.69 11.67 ± 3.98 ^a 12.92 ± 3.30 ^a 12.08 + - 3.05 ^a 12.92 ± 3.30 ^a 12.08 + 1.73 ^a 12.08 + 4.69 ^a Day 14 51.67 ± 3.98 12.50 + - 4.27 ^a 20.42 ± 3.30 ^ab 17.50 + 3.45 ^ac 30.42 ± 4.52 ^usd 27.08 ± 3.75 ^usd 25.00 ± 3.09 ^usd Day 21 51.25 + - 4.34 14.58 + - 4.34 ^a 28.33 ± 3.56 ^ab 22.50 ± 3.45 ^ab 37.92 ± 4.34 ^abd 34.58 ± 4.34 ^usd 32.50 ± 2.95 ^abe Day 28 51.25 + 5.02 17.08 + - 4.15 ^a 32.50 ± 4.63 ^ab 26.67 ± 4.36 ^ab 44.17 ± 3.45 ^abd 39.58 ± 2.78 ^usd 37.92 ± 3.05 ^abd

The number and proportion of body swings to the right after 1, 3, 7, 14, 21, and 28 days of pMCAO control in the pMCAO control group were -86.61, -84.62, -77.24, -75.81, -71.54, and -66.67% Respectively.

The number and proportion of body swings on the right side after 1, 3, 7, 14, 21, and 28 days of pMCAO operation in the donepezil 10 mg / kg single composition administration group were 0.00, 11.11, 10.71, 63.33, 94.29 and 90.24% Respectively.

The number and proportion of body swings to the right after 1, 3, 7, 14, 21, and 28 days of pMCAO operation in the YMJHT 400 mg / kg single composition administration group were 6.67, 22.22, 3.57, 40.00, 54.29, and 56.10% Respectively.

The number and proportion of body swings on the right side after 1, 3, 7, 14, 21, and 28 days of pMCAO operation in donepezil 10 mg / kg and YMJHT 400 mg / kg within 5 min were 6.67, 16.67, 10.71, 143.33, 160.00 and 158.54%, respectively.

The number and proportion of body swings on the right side after 1, 3, 7, 14, 21, and 28 days of pMCAO operation in donepezil 10 mg / kg and YMJHT 200 mg / kg 5 min group were 13.33, 16.67, 3.57, 116.67, 137.14 and 131.71%, respectively.

The number and proportion of body swings on the right side after 1, 3, 7, 14, 21 and 28 days of pMCAO operation in donepezil 10 mg / kg and YMJHT 100 mg / kg within 5 min were -6.67 and 22.22 , 3.57, 100.00, 122.86 and 121.95%, respectively.

3.2.5. Cognitive athletic behavior test - Water maze test

In the Sham control group, the travel distance and time from the water maze tank to the escape platform were significantly reduced at each trial, but the pMCAO control group showed a significant (p <0.01) increase in distance traveled to the escape platform pMCAO 14 days trial 2 and 3, and pMCAO 28 days, and the increase in reach time to the escape platform was confirmed in all trials of 14 and 28 days of pMCAO, Lt; / RTI &gt; On the other hand, in all experimental groups including donepezil 10 mg / kg alone group, the decrease in travel distance to the escape platform was significantly (p <0.01) lower than that of pMCAO control group after 14 days of pMCAO trial 2 and 3 and all trials (P <0.01) decrease in the time to move to the escape platform was recognized in all trials except for trial 1 after 14 days of pMCAO. Particularly, in the group treated with donepezil 10 mg / kg and YMJHT 400 and 200 mg / kg within 5 minutes, the decrease in the travel distance to the escape platform was significant (p <0.01 or p <0.05) After 14 days of pMCAO, trial 2 and 3 and pMCAO 28 days later, all trials were treated with YMJHT dose-dependently, and a significant (p <0.01) decrease in migration time to escape platform was observed in all trials after 14 and 28 days of pMCAO YMJHT dose-dependently. In addition, the decrease in the travel distance to the escape platform of donepezil 10 mg / kg and YMJHT 100 mg / kg within 5 min was significantly (p <0.01) lower than that of donepezil 10 mg / And a significant (p <0.01) decrease in migration time to the escape platform was observed in all trials after pMCAO 14 and 28 days, respectively (Tables 15 and 16).

Groups
After pMCAO Controls Single formula treated Donepezil 10 mg / kg and YMJHTco-administration Sham pMCAO Donepezil YMJHT 400 mg / kg 200 mg / kg 100 mg / kg Day 14 Trial 1 1522.0 + - 80.6 1523.3 ± 113.2 1532.3 + - 81.0 1521.1 ± 131.9 1521.5 ± 80.0 1532.3 + - 85.8 1525.9 + - 76.0 Trial 2 1061.5 + - 66.9 1480.6 ± 105.3 ^a 1304.9 ± 63.9 ^ab 1321.0 ± 134.2 ^ab 1188.9 ± 95.4 ^abe 1209.4 ± 59.3 ^abe 1236.9 ± 46.0 ^ab Trial 3 603.4 + - 107.2 1330.6 ± 100.1 ^a 1084.4 ± 52.8 ^ab 1196.4 ± 109.5 ^ab 818.6 ± 64.3 ^abd 957.9 ± 98.7 ^abd 1005.3 ± 52.7 ^ab Mean 1062.3 ± 72.6 1444.8 ± 105.3 ^a 1307.2 ± 53.1 ^ab 1346.2 + - 115.4 ^ac 1176.3 ± 68.8 ^abd 1233.2 ± 68.8 ^ab 1256.0 ± 45.8 ^ab Day 28 Trial 1 865.1 + - 78.5 1436.3 ± 87.0 ^a 1294.1 ± 63.5 ^ab 1315.8 ± 106.4 ^ab 989.5 ± 64.2 ^abd 1103.9 ± 87.8 ^abd 1156.1 ± 46.5 ^abd Trial 2 580.3 ± 49.5 1383.3 ± 83.4 ^a 1088.8 ± 51.5 ^ab 1181.1 ± 68.7 ^ab 830.5 ± 78.7 ^abd 921.1 ± 65.4 ^abd 980.6 ± 61.3 ^abd Trial 3 357.8 ± 47.0 1291.3 ± 74.5 ^a 900.4 ± 56.4 ^ab 1003.9 ± 61.5 ^ab 553.3 ± 65.3 ^abd 639.6 ± 54.8 ^abd 771.1 ± 76.7 ^abd Mean 601.0 + - 52.0 1370.3 ± 78.9 ^a 1094.4 ± 51.3 ^ab 1166.9 ± 67.4 ^ab 791.1 ± 51.4 ^abd 888.2 ± 67.3 ^abd 969.3 ± 59.0 ^abd

Groups
After pMCAO Controls Single formula treated Donepezil 10 mg / kg and YMJHTco-administration Sham pMCAO Donepezil YMJHT 400 mg / kg 200 mg / kg 100 mg / kg Day 14 Trial 1 132.25 + - 10.47 172.75 + - 12.04 ^a 172.38 ± 10.58 ^a 170.38 ± 11.26 ^a 170.13 + - 9.60 ^a 170.25 + 8.88 ^a 171.75 ± 7.83 ^a Trial 2 101.38 ± 11.82 167.50 ± 11.06 ^a 152.13 7.81 ^ac 153.38 +/- 10.77 ^ac 113.88 ± 8.08 ^bce 121.25 ± 9.38 ^ace 132.50 ± 10.70 ^ace Trial 3 60.13 + - 10.86 151.00 ± 10.42 ^a 124.63 + - 6.25 ^ac 132.13 + - 11.14 ^ac 78.00 ± 9.71 ^ace 89.50 ± 8.77 ^ace 103.25 ± 11.25 ^ace Mean 97.92 ± 10.93 163.75 ± 11.00 ^a 149.71 ± 7.64 ^ac 151.96 ± 10.86 ^ad 120.67 ± 8.21 ^aces 127.00 ± 8.67 ^ace 135.83 ± 9.62 ^aces Day 28 Trial 1 90.00 ± 10.31 155.75 ± 12.07 ^a 135.50 + - 6.50 ^ac 139.63 + - 10.13 ^ac 106.25 ± 9.45 ^aces 112.00 ± 8.94 ^ace 123.88 + 7.61 ^acf Trial 2 61.25 + - 8.81 148.13 ± 9.99 ^a 116.50 ± 8.90 ^ac 125.38 + 10.93 ^ac 75.63 ± 10.03 ^aces 90.25 ± 10.29 ^acce 100.88 ± 6.17 ^ace Trial 3 32.38 ± 9.74 137.75 ± 11.13 ^a 94.00 ± 10.57 ^ac 107.63 + - 8.16 ^ac 51.38 ± 10.32 ^aces 62.00 + 8.67 ^ace 77.38 ± 8.16 ^ace Mean 61.21 + - 9.46 147.21 +/- 10.80 ^a 115.33 + - 8.44 ^ac 124.21 + 9.22 ^ac 77.75 ± 9.28 ^aces 88.08 ± 9.15 ^aces 100.71 ± 6.00 ^ace

In the pMCAO control group, the travel distance to the trial 1, 2, 3, and trial average platform was found to be 0.08, 39.48, 120.53, 36.01, 66.02, 138.39, 260.94 and 127.98%, respectively, and the movement time was changed to 30.62, 65.23, 151.14, 67.23, 73.06, 141.84, 325.48 and 140.50% escape platform, respectively.

In the case of Donepezil 10 mg / kg single composition, the distance to the trial 1, 2, 3 and trial average after 14 days of pMCAO operation, to the trial 1, 2, 3 and trial average platform 28 days after pMCAO operation, -18.15, -9.53, -9.90, -21.29, -30.27 and -20.13%, respectively, and the values of -0.22, -9.18, -17.47, -8.58, -13.00, -21.35, And 31.76 and -21.65%, respectively.

In the case of the YMJHT 400 mg / kg single composition administration group, the travel distance to the trial 1, 2, 3 and trial average after 14 days of pMCAO operation, to the trial 1, 2, 3 and trial average platform after 28 days of pMCAO operation, -10.48, -10.09, -6.83, -8.39, -14.61, -22.26 and -14.84%, respectively, and -1.37, -8.43, -12.50, -7.20, -10.35, -15.36, -21.87 and -15.62%, respectively.

Trial 1, 2, 3 and trial averages after 14 days of pMCAO operation, 28 days after pMCAO operation, and 1, 2, 3 and trial average escape platform of donepezil 10 mg / kg and YMJHT 400 mg / -38.98, -18.58, -31.11, -39.96, -57.15, and -42.27%, respectively, compared with the pMCAO control group, and the shift distance to the control group was -1.52, -32.01, -48.34, 26.31, -31.78, -48.95, -62.70, and -47.18%, respectively.

Trial 1, 2, 3 and trial averages after 14 days of pMCAO operation, 28 days after pMCAO operation, and 1, 2, 3 and trial average escape platforms of donepezil 10 mg / kg and YMJHT 200 mg / -18.32, -28.01, -14.65, -23.14, -33.41, -50.46 and -35.18%, respectively, compared with the pMCAO control group, and the shift distance from the control group was -1.45, -27.61, -40.73, -22.44 , -28.09, -39.07, -54.99, and -40.16%, respectively.

Trial 1, 2, 3 and trial averages after 14 days of pMCAO operation, 28 days after pMCAO operation, and 1, 2, 3 and trial average escape platforms of donepezil 10 mg / kg and YMJHT 100 mg / -16.60, -24.45, -13.07, -19.50, -29.11, -40.28 and -29.26%, respectively, compared with the pMCAO control group, and -0.58, -20.90, -31.62, -17.05 , -20.47, -31.90, -43.83, and -31.59%, respectively.

3.2.6. Change in brain weight

In the pMCAO control group, there was a significant (p <0.01) decrease in brain absolute and relative weight with respect to the atrophy and deficit of the peripheral pMCAO surgery area compared to the sham control group. However, all the experimental materials including the YMJHT 400 mg / (P < 0.01 or p < 0.05), respectively, as compared with the pMCAO control group. In particular, the increase in brain weight was significantly (p <0.01 or p <0.05) higher in donepezil 10 mg / kg and YMJHT 400, 200 and 100 mg / (Figs. 8, 9 and 13).

The absolute absolute brain weights were -28.79% in the pMCAO control group compared to the sham control group, but donepezil 10 mg / kg and YMJHT 400 mg / kg alone, donepezil 10 mg / kg and YMJHT 400, 200 or 100 mg / kg in the group treated with 5 min or less, respectively, as compared with the control group, 15.87, 10.94, 32.02, 28.00 and 24.07%, respectively.

In the pMCAO control group, the relative weight of the brain was -17.29% compared to the sham control group. However, donepezil 10 mg / kg and YMJHT 400 mg / kg alone group, donepezil 10 mg / kg and YMJHT 400, 200 or 100 mg / kg in the group treated with 5 min or less, 10.94, 7.80, 18.38, 17.93 and 16.16%, respectively, as compared with the pMCAO control group.

3.2.7. Infarct / defect volume changes

In the pMCAO control group, an infarct / defect volume characterized by a localized defect of the right cerebral cortex with pMCAO surgery was recognized and an increase in infarct / defect volume was observed (p <0.01) as compared with the sham control group. On the other hand, decrease in cerebral cortical infarct / defect volume was found to be significant (p <0.01) in all experimental groups including donepezil 10 mg / kg and YMJHT 400 mg / kg within 5 min compared with pMCAO control group. In particular, the decrease in infarct / defect volume (p <0.01 or p <0.05) was significantly (p <0.01 or p <0.05) higher in donepezil 10 mg / kg and YMJHT 400, 200 and 100 mg / (Fig. 9 and Fig. 10), respectively. &Lt; tb &gt; &lt; TABLE &gt;

Donepezil 10 mg / kg and YMJHT 400 mg / kg alone group, donepezil 10 mg / kg and YMJHT 400, 200 or 400 mg / kg, respectively, showed a change in the cerebral cortical infarct / defect volume in the pMCAO control group compared to the sham control group In the group treated with 100 mg / kg for 5 min or less, the change was -43.30, -32.50, -74.26, -61.02 and -55.83%, respectively, compared to the pMCAO control group.

3.2.8. Infarct / defect peripheral cerebral cortex (sixth coronal section) STAT3  And Pin -One mRNA  Change in expression

In the pMCAO control group, the expression of STAT and Pim-1 mRNA in the infarct / defect peripheral cerebral cortex was significantly decreased (p <0.01) compared to the sham control group. However, donepezil 10 mg / kg and YMJHT 200 mg / kg within 5 min In both experimental and control groups, STAT and Pim-1 mRNA expression was significantly increased in the infarct / defect peripheral cerebral cortex compared to the pMCAO control group (p <0.01). In particular, in the combination of donepezil 10 mg / kg and YMJHT 400, 200 and 100 mg / kg for 5 min, the infarct / defect peripheral cortex (p <0.01 or p <0.05) Increases in STAT and Pim-1 mRNA expression in the tissues were respectively recognized in a dose-dependent manner by the combination of YMJHT (Figs. 11 and 12).

The expression of STAT3 mRNA in the peripheral cerebral cortex of infarct / defect was -57.16% in the pMCAO control group compared to the sham control group, but donepezil 10 mg / kg and YMJHT 400 mg / kg alone group, donepezil 10 mg / 34.02, 100.88, 77.13, and 68.04%, respectively, in the group treated with YMJHT 400, 200 or 100 mg / kg within 5 minutes compared with the control group.

The expression of Pim-1 mRNA in the peripheral cerebral cortex of infarct / defect was -67.29% in the pMCAO control group compared to the sham control group. However, donepezil 10 mg / kg and YMJHT 400 mg / kg and YMJHT 400, 200 or 100 mg / kg for 5 minutes, respectively, compared with the control group, the changes were 73.66, 35.50, 136.26, 108.78 and 96.18%, respectively.

3.2.9. Infarct / defect Peripheral cortex (sixth coronal section) Changes in antioxidant defense system

3.2.9.1. Changes in lipid peroxidation

In the pMCAO control group, an increase in the MDA content indicating lipid peroxidation (p <0.01) was observed in the cerebral cortex of the infarct / defect periphery compared to the sham control group. However, combination therapy with donepezil 10 mg / kg and YMJHT 100 mg / (P <0.01) of MDA content in the peripheral cerebral cortical tissues were significantly (p <0.01) lower than those of the pMCAO control group. Particularly, the concentration of MDA in the infarct / defect peripheral cerebral cortex of donepezil 10 mg / kg and YMJHT 400, 200 and 100 mg / kg within 5 min was significantly (p <0.01) higher than that of donepezil 10 mg / (Table 17).

In the pMCAO control group, the concentration of infarct / defect peripheral cerebral cortex MDA was 272.35% as compared with that of the sham control group. However, donepezil 10 mg / kg and YMJHT 400 mg / kg alone group, donepezil 10 mg / kg and YMJHT 400, 200 or 100 mg / kg within 5 minutes, -30.29, -26.98, -59.11, -50.52 and -45.53%, respectively, compared to the pMCAO control group.

Index (Unit)
Groups Malondialdehyde
(nM / g tissue) Glutathione
(nM / mg protein) Catalase
(U / mg protein) SOD
(U / mg protein) Controls Sham 3.74 ± 1.45 14.48 ± 3.44 5.73 ± 1.50 205.88 + - 42.05 pMCAO 13.94 + 2.58 ^a 3.20 ± 0.75 ^a 1.11 + 0.36 ^a 71.94 ± 11.39 ^a Single formula treated Donepezil 9.72 + 1.25 ^ac 5.41 ± 1.17 ^ac 2.41 ± 0.58 ^ac 122.00 ± 13.61 ^ac YMJHT 10.18 ± 0.81 ^ac 5.30 ± 0.86 ^ac 2.29 + 0.66 ^ac 110.88 ± 16.38 ^ac Donepezil 10 mg / kg and YMJHT co-administration 400 mg / kg 5.70 ± 1.46 ^bcd 9.51 ± 1.61 ^acd 4.41 ± 0.78 ^cd 167.13 ± 16.12 ^bcd 200 mg / kg 6.90 + - 0.70 ^acd 7.23 ± 0.99 ^acd 3.71 ± 0.51 ^acd 146.25 ± 13.80 ^acd 100 mg / kg 7.59 ± 0.89 ^acd 7.05 ± 1.06 ^aces 3.24 +/- 0.48 ^ace 140.38 ± 10.89 ^ace

3.2.9.2. Changes in endogenous antioxidant GSH content

In the pMCAO control group, a significant decrease in GSH content (p <0.01) was observed in the cerebral cortex of the infarct / defect peripheral than in the sham control group. However, in the experimental group treated with donepezil 10 mg / Significant (p <0.01) increase in GSH content in the infarct / defect peripheral cerebral cortex was found, respectively. In particular, in the combination of donepezil 10 mg / kg and YMJHT 400, 200 and 100 mg / kg for 5 min, the infarct / defect peripheral cortex (p <0.01 or p <0.05) Increases in GSH content in tissues were respectively admitted dependent on dose of YMJHT (Table 17).

The concentration of GSH in the peripheral cerebral cortex of the infarct / defect peripheral area was -77.88% as compared with that of the sham control group. However, donepezil 10 mg / kg and YMJHT 400 mg / kg alone group, donepezil 10 mg / kg and YMJHT 400 , 200 or 100 mg / kg for 5 min or less, respectively, compared to the control group, 68.89, 65.50, 196.92, 125.68 and 120.18%, respectively.

3.2.9.3. Changes in endogenous antioxidant enzyme CAT activity

In the pMCAO control group, a significant decrease in CAT activity (p <0.01) was observed in the cerebral cortex of the infarct / defect peripheral than in the sham control group. However, in the experimental group administered with the YMJHT 400 mg / Significant (p <0.01) infarct / defect CAT activity in periportal cerebral cortex was increased, respectively. In particular, in the combination of donepezil 10 mg / kg and YMJHT 400, 200 and 100 mg / kg for 5 min, the infarct / defect peripheral cortex (p <0.01 or p <0.05) The increase in CAT activity in tissues was respectively dependent on dose-dependent administration of YMJHT (Table 17).

In the pMCAO control group, infarct / defect peripheral cerebral cortical CAT activity was -80.64% compared to the sham control group, but donepezil 10 mg / kg and YMJHT 400 mg / kg alone group administration group, donepezil 10 mg / kg and YMJHT 400 , 200, or 100 mg / kg, respectively, compared with the pMCAO control group, the change was 117.25, 106.09, 297.75, 234.95 and 192.22%, respectively.

3.2.9.4. Changes in endogenous antioxidant enzyme SOD activity

In the pMCAO control group, a significant (p <0.01) decrease in SOD activity was observed in the cerebral cortex of the infarct / defect periphery than in the sham control group. However, all of the groups including donepezil 10 mg / kg and YMJHT 400 mg / In the experimental group, SOD activity in infarct / defect peripheral cerebral cortex was significantly increased (p <0.01) compared to pMCAO control group. In particular, in the combination of donepezil 10 mg / kg and YMJHT 400, 200 and 100 mg / kg for 5 min, the infarct / defect peripheral cortex (p <0.01 or p <0.05) Increased SOD activity in the tissues was recognized in a dose-dependent manner in combination with YMJHT (Table 17).

In the pMCAO control group, there was a change of -65.06% compared with the sham control group. However, donepezil 10 mg / kg and YMJHT 400 mg / kg alone group, donepezil 10 mg / kg and YMJHT 400 , And 200 or 100 mg / kg, respectively, in the group treated with 5 min or less, compared with the control group, 69.59, 54.12, 132.31, 103.29 and 95.13%, respectively.

3.2.10.1. Histopathological changes of the infarct / defect peripheral cerebral cortex (sixth coronal section)

In the pMCAO control group, a significant increase in the number of immunoreactive neurons in the right cerebral cortex, the atrophy of the right cerebral cortex, cleaved caspase-3 and PARP (apoptotic indicator), NT and 4-HNE (iNOS-related oxidative stress and lipid peroxidation index) . However, in all of the experimental groups, including donepezil 10 mg / kg and YMJHT 200 mg / kg for 5 min, the pMCAO control group showed significant pMCAO cerebral cortical atrophy, denatured neuronal cells, cleaved caspase-3, cleaved PARP , NT and 4-HNE immunoreactive neurons were observed. In particular, in combination with donepezil 10 mg / kg and YMJHT 400, 200 and 100 mg / kg within 5 min, there was a marked decrease in cerebral cortex atrophy and cleaved caspase-3, cleaved Numerical reduction of PARP, NT and 4-HNE immunoreactive neurons was observed in a dose-dependent manner with the combination of YMJHT (Table 18; Figs. 13-15).

Groups
Item (Unit) Controls Single formula treated Donepezil 10 mg / kg and YMJHTco-administration Sham pMCAO Donepezil YMJHT 400 mg / kg 200 mg / kg 100 mg / kg Atrophy% 2.70 ± 1.53 59.45 ± 10.85 ^d 38.49 + - 5.22 ^df 46.66 ± 6.76 ^dgi 17.50 ± 6.68 ^eh 26.44 + - 5.00 ^dFh 30.14 ± 6.84 ^dfi Neuronal cell numbers (cells / 1000 neuronal cells) DE 27.88 + - 16.37 809.00 ± 125.93 ^d 575.75 + - 104.59 ^df 668.50 ± 77.12 ^dgi 130.50 + - 54.82 ^dfh 202.13 + - 41.24 ^dfh 245.13 + - 58.51 ^dfh Caspase-3 33.25 + - 11.97 720.75 ± 81.52 ^d 449.00 ± 74.12 ^df 502.38 ± 63.10 ^df 151.75 ± 36.91 ^dfh 317.75 ± 58.77 ^dfh 333.13 + - 57.78 ^dfh PARP 41.50 ± 20.92 712.88 ± 119.95 ^d 452.75 ± 63.24 ^df 549.63 ± 65.43 ^dfi 138.25 ± 52.88 ^dfh 185.38 + - 62.31 ^dfh 205.38 ± 48.53 ^dfh NT 36.75 ± 18.01 537.38 ± 50.71 ^a 385.88 ± 65.72 ^ab 424.88 ± 69.88 ^ab 130.00 ± 34.14 ^abc 177.00 ± 26.37 ^abc 261.13 ± 36.16 ^abc 4-HNE 110.00 ± 49.47 731.50 ± 110.98 ^d 497.00 ± 77.12 ^df 535.00 ± 98.51 ^df 141.63 ± 45.30 ^fh 211.63 + - 31.00 ^dfh 306.88 ± 51.89 ^dfh

3.2.10.2. Changes of right cortical atrophy% in pMCAO surgery

In the pMCAO control group, there was a significant increase (p <0.01) in the percentage of right atrophy of the cerebral cortex, which was the pMCAO surgical site, compared with the sham control group. However, all experiments including donepezil 10 mg / kg and YMJHT 100 mg / (P < 0.01 or p < 0.05), respectively, in the substance-treated group compared to the pMCAO control group. In particular, in the group receiving donepezil 10 mg / kg and YMJHT 400, 200 and 100 mg / kg for 5 min or less, pCMAO was more significant than donepezil 10 mg / kg alone (p <0.01 or p <0.05) Decrease in% cirrhosis of the cortex was recognized in a dose-dependent manner with the combination of YMJHT (Table 18; FIG. 13).

In the pMCAO control group, the percentage of atrophy of the right cerebral cortex, which was the area of pMCAO, was 2105.84% as compared with the sham control group. However, donepezil 10 mg / kg and YMJHT 400 mg / kg alone group, donepezil 10 mg / kg and YMJHT 400, 200, or 100 mg / kg for 5 min compared to the pMCAO control group showed a change of -35.26, -21.51, -70.56, -55.53, and -49.31%, respectively.

3.2.10.2. Numerical changes of denatured neurons

In the pMCAO control group, there was a significant increase (p <0.01) in the right cortical neurons in the right cerebral cortex, which was significant (p <0.01) compared to the sham control group. However, in all experimental groups including donepezil 10 mg / (P < 0.01 or p < 0.05), respectively. In particular, the dose of donepezil 10 mg / kg and YMJHT 400, 200 and 100 mg / kg within 5 minutes was significantly higher than that of donepezil 10 mg / kg alone (p <0.01) (Table 18; Fig. 13), respectively.

In the pMCAO control group, the number of modified neurons in the right cerebral cortex, which was the site of pMCAO, showed a change of 2802.24% compared to the sham control group. However, donepezil 10 mg / kg and YMJHT 400 mg / kg alone group, donepezil 10 mg / kg -17.37, -83.87, -75.02 and -69.70%, respectively, in the group treated with YMJHT 400, 200 or 100 mg / kg for 5 minutes or less compared with the control group.

3.2.10.3. Numerical changes of Cleaved caspase-3 immunoreactive cells

In the pMCAO control group, the number of cleaved caspase-3 immunoreactive cells in the right cerebral cortex, which is a pMCAO surgical site, was significantly increased (p <0.01) as compared with the sham control group. However, all the experimental materials including YMJHT 400 mg / (P <0.01) cleaved caspase-3 immunoreactive cells compared to the pMCAO control group, respectively. Especially, the dose of donepezil 10 mg / kg and YMJHT 400, 200 and 100 mg / kg within 5 min was significantly higher than that of donepezil 10 mg / kg alone (p <0.01) -3 immunoreactivity cells were each admitted in a dose-dependent manner with the combination of YMJHT (Table 18; Fig. 14).

The number of cleaved caspase-3 immunoreactive cells in the right cerebral cortex, which is the site of pMCAO, was 2067.67% in the pMCAO control group compared with the sham control group. However, donepezil 10 mg / kg and YMJHT 400 mg / In the group treated with donepezil 10 mg / kg and YMJHT 400, 200 or 100 mg / kg within 5 min, the changes were -37.70, -30.30, -78.95, -55.91 and -53.78%, respectively, compared with the pMCAO control group.

3.2.10.4. Numerical changes of cleaved PARP immunoreactive cells

In the pMCAO control group, the number of cleaved PARP-immunoreactive cells in the right cerebral cortex, which is a pMCAO surgical site, was significantly increased (p <0.01) compared to the sham control group. However, donepezil 10 mg / kg and YMJHT 400 mg / (P <0.01) cleaved PARP immunoreactive cells compared to the pMCAO control group, respectively. Particularly, in the group treated with donepezil 10 mg / kg and YMJHT 400, 200 and 100 mg / kg within 5 min, cleaved PARP in the right cerebral cortex (p <0.01) The decrease in the number of immunoreactive cells was recognized in a dose-dependent manner by the combination of YMJHT (Table 18; FIG. 14).

The number of cleaved PARP immunoreactive cells in the right cerebral cortex, which is the pMCAO surgical site, was 1617.77% in the pMCAO control group compared with the sham control group. However, donepezil 10 mg / kg and YMJHT 400 mg / mg / kg and YMJHT 400, 200 or 100 mg / kg, respectively, showed a change of -36.49, -22.90, -80.61, -74.00 and -71.19%, respectively, compared with the pMCAO control group.

3.2.10.5. Numerical changes of NT-immunoreactive cells

In the pMCAO control group, the number of NT immunoreactive cells in the right cerebral cortex, which is a pMCAO surgical site, was significantly increased (p <0.01) compared to the sham control group. However, donepezil 10 mg / kg and YMJHT 200 mg / (P <0.01), respectively, compared to pMCAO control group. In particular, the dose of donepezil 10 mg / kg and YMJHT 400, 200 and 100 mg / kg within 5 minutes was significantly higher than that of donepezil 10 mg / kg alone (p <0.01) A decrease in the number of reactive cells was recognized in a dose-dependent manner with the combination of YMJHT (Table 18; FIG. 15).

The number of NT-immunoreactive cells in the right cerebral cortex, which is the area of pMCAO surgery, was 1362.24% in the pMCAO control group compared with the sham control group. However, donepezil 10 mg / kg and YMJHT 400 mg / / kg and YMJHT 400, 200 or 100 mg / kg for 5 min compared to pMCAO control group, the change was -28.19, -20.94, -75.81, -67.06 and -51.41%, respectively.

3.2.10.6. Numerical changes of 4-HNE immunoreactive cells

In the pMCAO control group, the number of 4-HNE immunoreactive cells in the right cerebral cortex, which is the pMCAO surgical site, was significantly increased (p <0.01) compared to the sham control group. However, donepezil 10 mg / kg and YMJHT 200 mg / The number of 4-HNE-immunoreactive cells was significantly decreased (p <0.01) compared to pMCAO control group in all experimental groups. In particular, in the combination of donepezil 10 mg / kg and YMJHT 400, 200 and 100 mg / kg within 5 min, the effect of pECAOAO in the right cerebral cortex, HNE < / RTI &gt; immunoreactive cells were each admitted in a dose-dependent manner with the combination of YMJHT (Table 18; FIG. 15).

The number of 4-HNE immunoreactive cells in the right cerebral cortex, which is the pMCAO surgical site, was 565.00% in the pMCAO control group compared to the sham control group. However, donepezil 10 mg / kg and YMJHT 400 mg / In the group treated with 10 mg / kg and YMJHT 400, 200 or 100 mg / kg for 5 min or less, there was a change of -32.06, -26.86, -80.64, -71.07 and -58.05%, respectively, in comparison with the pMCAO control group.

As a result of the third embodiment, significant reduction in body weight and body weight, decrease in brain weight, neurological and cognitive motor behavioral disturbance-increase in limb placing test score, decrease in the number of body swings and ratio in the right side, (6th coronal section), cerebral cortical atrophy, metacarpal neuron, cleaved caspase-3 (6th coronal section), and the movement distance and time to escape platform And increased expression of PARP (apoptosis indicator), nitrotyrosine and 4-HNE (iNOS-related oxidative stress and lipid peroxidation index) immunoreactive neurons and decreased STAT3 and Pim-1 mRNA expression and MDA GSH content, SOD and CAT activity. In other words, pMCAO surgery resulted in vascular dementia accompanied by cerebral cortical damage, such as degeneration of nerve cells and increase of apoptosis due to depletion of a remarkable antioxidant defense system, neurological and cognitive behavioral disorders. In addition, these pMCAO-induced weight and brain weight loss, neurological and cognitive motor behavioral disturbances, degeneration of the cerebral cortical neurons around the infarct / defect, apoptosis, oxidative stress, and antioxidant defensive system were observed in donepezil 10 mg / kg and YMJHT 400 kg of donepezil and 100 mg / kg of YMJHT 400, 200 mg and 100 mg / kg, respectively, in combination with donepezil 10 mg / kg and YMJHT 400, 200 and 100 mg / In the group treated with 5 minutes or less, significant increase in the neuroprotective, cognitive, and motor function recovery effects was observed in a dose-dependent manner in combination with YMJHT, compared to the group administered with donepezil 10 mg / kg alone. Therefore, as in Examples 1 and 2, the combination administration of YMJHT within 5 minutes did not affect the bioavailability of donepezil at least under the conditions of this experiment. Therefore, the combination administration of YMJHT within 5 minutes At least under the conditions of this experiment, various pharmacological effects including the antioxidant effect of the well-known YMJHT without affecting the bioavailability of donepezil [Song et al., 2004; Kang et al., 2006a; Ha et al., 2011a; Shin et al., 2012], it has been concluded that donepezil is a synergistic and potent neuroprotective, cognitive, and motor function-restoring neuroprotective, cognitive, and motor function- Combined administration of YMJHT is expected to provide a new therapeutic method that is very useful for the treatment of bilateral oriental dementia patients with vascular dementia. Overall, the YMJHT 400 mg / kg single composition showed relatively lower neuroprotective, cognitive and motor function recovery effects in the pMCAO rat model than the donepezil 10 mg / kg single composition.

In the pMCAO control group, a significant decrease in body weight was observed from the 7th day after the pMCAO operation to 8 days after the start of the pMCAO operation, and the weight gain of the 29 day pMCAO operation was also significantly decreased. However, in the donepezil and YMJHT alone groups, Significant increase in body weight was observed at 22 and 28 days after pMCAO surgery, respectively. The body weight gain during 29 days of pMCAO operation was also significantly increased compared to pMCAO control. In addition, significant increases in body weight of pancreatic acute myocardial infarction 10 mg / kg and YMJHT 400, 200 and 100 mg / kg within 5 min were observed after pMCAO surgery 15, 15 and 22 days, Daily body weight gain was also significantly increased compared to the pMCAO control group. In particular, significant increases in body weight gain were observed after 15, 28, and 28 days of pMCAO in donepezil 10 mg / kg and YMJHT 400, 200 and 100 mg / kg for 5 min compared to donepezil 10 mg / kg alone The increase in body weight gain for 29 days after pMCAO surgery was significantly (p <0.05) dependent on the dose of YMJHT. These results suggest that the combined administration of YMJHT at intervals of less than 5 minutes at least under the conditions of this Example 3 is one of the direct proofs that synergistically significantly increase the inhibitory activity of cognition and behavioral disorders associated with donepezil by pMCAO.

TTC reacts with dehydrogenase in tissues and is observed to be red in normal tissues. In ischemic injured tissues, dehydrogenase disappears and is stained white, so it is often used to observe irreversible ischemic brain injury. In pMCAO, irreversible severe ischemic brain injury is induced, and over time, cyst formation by local necrosis of neuronal cells of the cerebral cortex is induced, and eventually the cortical and subcortical region of the cerebral cortex ) And associated cerebral atrophy and brain weight loss. In Example 3, infarct / defect findings, cortical atrophy, and brain weight associated with cerebral cortical defect were recognized in the pMCAO control group at the final autopsy 29 days after pMCAO, There was a significant decrease in brain weight, an increase in cerebral cortical infarct / defect volume and a decrease in cerebral cortical right hippocampal level in histopathological pMCAO surgery compared to sham control group. However, all experimental materials including YMJHT 400 mg / Showed a significant increase in brain weight compared with the pMCAO control group, histopathological pMCAO surgery, right atrophy of the cerebral cortex and decreased cerebral cortical infarct / defect volume, respectively. Particularly, in combination with donepezil 10 mg / kg and YMJHT 400, 200 and 100 mg / kg within 5 min, significant increases in cerebral weight, percentage of cortical atrophy and cerebral cortical infarct / defect volume reduction was admitted to each dose-dependent dose of YMJHT. These results are clear and direct evidence that the neuroprotective effect of donepezil is markedly increased synergistically, at least under the conditions of Example 3, by the concomitant administration of YMJHT at intervals of less than 5 minutes.

To date, most studies have focused on only the infarct size changes caused by ischemic brain injury and have evaluated the drug efficacy. However, despite the significant reduction in infarct size in the MCAO model, Are often observed [Jaspers et al., 1990; Yamaguchi et al., 1995], and some drugs known to have no effect on some infarct volumes have been reported to significantly reduce cognitive and behavioral disturbances caused by ischemic brain injury [Kawamata et al., 1996; Squire and Zola, 1996], there is a need to clarify the relationship between infarct volume and cognitive and behavioral disorders. Therefore, the need for appropriate neurological and cognitive athletic behaviors is needed to correct these correlations. De Ryck et al. The limb placing test of [1989] is a representative neurological exercise behavioral test that grades forelimb and hindlimb placement abnormalities. In addition, the body swing test is also frequently used as a neurological behavioral test [Borlongan and Sanberg, 1995]. In normal animals, body swing to the left and right is approximately 5: 5, whereas in animals with ischemic brain injury, Of body swings are significantly reduced [Roof et al., 2001; Menniti et al., 2009; Kim et al., 2016]. In addition, Morris [1984] 's water maze test is the most commonly used cognitive athletic behavior test. The cognitive behavioral disturbance significantly increases the travel distance and time to the escape platform, Distance and time are significantly suppressed [Roof et al. 2001; Kim et al., 2016]. In Example 3, in the pMCAO control group, an increase in the neurological and cognitive motor behavioral disturbances, ie, an increase in the limb placing test score, a decrease in the number of body swings and the ratio to the right, However, there was no significant difference in the duration of movement and time between the two groups. However, neurological and cognitive motor behavioral disturbances due to pMCAO were significantly higher in donepezil 10 mg / kg and YMJHT 400 mg / kg alone , donepezil 10 mg / kg and YMJHT 400, 200 and 100 mg / kg within 5 minutes, and especially donepezil 10 mg / kg and YMJHT 400, 200 and 100 mg / kg within 5 minutes Showed a significant increase in the cognitive and motor function recovery effects of YMJHT dose-dependently compared to donepezil 10 mg / kg alone. These results are again judged to be one of the clear evidence that synergistic and synergistic recovery of donepezil's cognitive and motor function to pMCAO is significantly increased by the combined administration of YMJHT at intervals of less than 5 minutes under the conditions of this experiment.

Free radicals produced in cells by cell metabolism or exogenous stimulation increase production as age increases and react with various biomolecule in brain tissue resulting in neurodegeneration and cognitive impairment. In the cerebral hemorrhage disorder, energy stored in nerve cells is depleted, and various acute metabolic disorders such as iron homeostasis disorder, mass release of nerve excitotoxic amino acid and free radical formation occur, and superoxide anion, hydroxyl radical and hydrogen peroxide The formation of the same ROS results in a typical secondary ischemic brain injury. These ROSs are normally removed by the endogenous antioxidative enzymes SOD and CAT, but severe brain damage such as stroke is formed in a large amount of ROS that can not be removed by endogenous antioxidant enzymes, resulting in exhaustion of the antioxidant defense system, Resulting in cognitive dysfunction due to nerve damage. Lipid peroxidation is an autocatalytic reaction that causes oxidative destruction of cell membranes. Various toxic substances formed by lipid peroxidation cause damage to surrounding tissues, and oxidative stress is important in brain damage. GSH is a typical endogenous antioxidant, and is known to control tissue injury by removing ROS at a relatively low concentration in cells. SOD is also an endogenous antioxidant enzyme, which acts as part of the cell's enzyme defense system in brain tissue. CAT is also a representative endogenous antioxidant enzyme that converts toxic hydrogen peroxide (H2O2) into harmless water (H2O). Therefore, the decrease of the activity of antioxidative enzymes, SOD and CAT, and the decrease of endogenous antioxidant, GSH, together with the increase of lipid peroxidation and ROS in brain tissues, indicate failure of compensatory action due to oxidative stress caused by brain injury. NT is a product of tyrosine nitration mediated by reactive nitrogen species such as peroxynitrite anion and nitrogen dioxide. It is well known that expression in degenerated brain tissue is increased and is currently used as an NO - related oxidative stress marker. 4-HNE is an α, β-unsaturated hydroxyalkenal formed by the lipid peroxidation of cells and is attracting attention as the cause of liver injury, chronic inflammation, neurodegenerative disease, adult respiratory distress syndrome, arteriosclerosis, diabetes and various carcinomas. Degeneration is also known to be involved. In Example 3, in the pMCAO control group, the lipid peroxidation (MDA content), NT and 4-HNE immunoreactive neurons were increased in the sixth coronal section in the infarct / defect peripheral cerebral cortex (SHC) And CAT activity, respectively. However, all of the experimental groups, including donepezil 10 mg / kg and YMJHT 100 mg / kg within 5 min, showed significant inhibition of lipid peroxidation and antioxidant defense system compared to pMCAO control group . Particularly, in the group treated with donepezil 10 mg / kg and YMJHT 400, 200 and 100 mg / kg within 5 min, significant lipid peroxidation inhibition and antioxidant defense system activities were significantly higher than those of the donepezil 10 mg / Respectively, in a dose-dependent manner in combination with YMJHT in the cortical tissue. These results indicate that, under the conditions of this experiment, the synergistic effects of synergistic protection against neuroprotection, cognition, and motor function through activation of the antioxidant defense system of donepezil against pMCAO by combination administration of YMJHT at intervals of 5 minutes or less, It is judged as evidence.

Histopathological analysis of Example 3 showed that, similar to previous pMCAO rat experiments [Lee et al., 2012; Kim et al., 2016]. In the pMCAO control group, the cerebral cortical atrophy% and the peripheral area of the infarct / defect (sixth coronal section) were increased, but the histopathological cerebral atrophy and numerical increase of the denatured neurons were observed in donepezil 10 mg / kg and 400 mg / kg of YMJHT alone, and 10 mg / kg of donepezil and YMJHT 400, 200 and 100 mg / kg for 5 minutes. Particularly, in the group treated with donepezil 10 mg / kg and YMJHT 400, 200 and 100 mg / kg within 5 min, significant decrease in the cerebral cortical% and the number of denatured neurons were observed in the infarct / YMJHT dose-dependently in cerebral cortical tissues, respectively. These results are again judged as direct evidence that synergistic increase in the histopathological cortical neuroprotective effect of donepezil against pMCAO is achieved by the combined administration of YMJHT at intervals of less than 5 minutes, at least under the conditions of this experiment.

STAT3 is one of the transcription factors encoded in human STAT3 gene. The interaction of cytokine-IL-6, oncostatin M, and leukemia inhibitory factor of interleukin (IL) -6 with gp130 receptors on JAK2 activity (PSTAT3), and phosphorylated STAT3 reacts with some tyrosine kinase receptors, such as the epidermal growth factor receptor and c-MET, and the c-src non-receptor tyrosine kinase, 12/15-lipoxygenase It also reacts with ROS. Mutations in the STAT3 gene are known to cause hyperimmunoglobulin E syndrome, which causes bone and tooth development disorders, and the structural activity of STAT3 is associated with the development of extremely poor prognosis. Currently, STAT3 is known to be effective for promoting cell proliferation through strong anti-apoptotic activity, and is being used as an anti-apoptosis indicator. pSTAT3 is an indicator of the activation of STAT3, which moves into the nucleus of the cell and promotes gene transcription, so that the expression of various proteins is regulated by pSTAT. Pim-1 is one of serine / threonine kinase protooncogene genes involved in cell cycle, apoptosis, transcription activity, and signal transduction. STAT3 activates the genetic transcription of Pim-1 and regulates the expression of bcl-2 protein. Increased expression of pim-1 increases transcription of bcl-2 protein, inhibits caspase-3 activity, and ultimately inhibits apoptosis of cells. Therefore, it has been accepted that a drug that increases the expression of STAT3 gene and the expression of Pim-1 mRNA associated therewith has a cytoprotective effect by inhibiting apoptosis of cells, and inhibits apoptosis of neurons even in the case of ischemic brain injury such as stroke It is known to be able to. Caspase-3 and PARP are the most important factors involved in apoptosis. The increase of cleaved caspase-3 and PARP immunoreactivity in the cerebral cortex is due to apoptosis and related neuronal damage, and the caspase-3 and PARP expression in the cerebral cortex during pMCAO Is also well known. Therefore, the combination of donepezil 10 mg / kg and YMJHT 400 mg / kg alone, donepezil 10 mg / kg, and YMJHT 400, 200 and 100 mg / Increased expression of STAT3 and Pim-1 mRNA in the tissues and associated cleaved caspase-3 and PARP-immunoreactive neurons decreased the inhibition of apoptosis of the cerebral cortex neurons by pMCAO via regulation of STAT3 expression, This is a direct evidence of the effect of promoting motor function recovery. Particularly, in combination with donepezil 10 mg / kg and YMJHT 400, 200 and 100 mg / kg within 5 min, significant increase of STAT3 and Pim-1 mRNA expression and cleaved caspase-3 and PARP Numerical reduction of immune - responsive neurons in the infarct / defect peripheral cerebral cortex was dose - dependent, respectively. These results suggest that the combination of YMJHT with an interval of less than 5 minutes at least under the conditions of the present experiment is effective for the neuroprotective effect of donepezil through regulation of STAT3 expression against pMCAO and the direct, It is judged as evidence.

As shown above, the combined administration of donepezil 10 mg / kg and YMJHT 400, 200 and 100 mg / kg within 5 minutes significantly inhibited the neuroprotective, cognitive and motor function recovery effects of donepezil on pMCAO through STAT3 regulation Respectively. Concomitant administration of YMJHT at intervals of less than 5 minutes did not affect the bioavailability of donepezil, but was based on various pharmacological effects including antioxidative effects. It is expected that it will provide a new therapeutic method which is very useful for the treatment and treatment of bilateral amblyopia in patients with vascular dementia. Overall, the YMJHT 400 mg / kg single composition showed relatively lower neuroprotective, cognitive and motor function recovery effects in the pMCAO rat model than the donepezil 10 mg / kg single composition.

Example  4. Dementia treatment Donepezil  ( AriceptTM )and Yomi  Conjugated administration experiment: Yomi  donepezil toxicity reduction effect

In Example 4, the donepezil toxicity alleviation effect of the moxibustion oil was evaluated using a mouse.

4.1. Experimental Method

4.1.1. Isolation of experimental animals and groups

In Example 4, male ICR mice (Male ICR mice) were used. SPF / VAF Outbred CrljOri: CD1 [ICR] Seven mice per group were weighed based on body weight (mean: 33.36 ± 1.59 g, 29.70 to 37.00 g) after 8 days of male mice (OrientBio, Seungnam, Korea) (Table 19, Fig. 16).

Total 6 groups (including medium control group); Seven grains per group (total 42 used)

(G0M) medium control group, (G1M) donepezil 20 mg / kg monotherapy group, (G2M) 400 mg / kg monotherapy group, (G3M) donepezil 20 mg / , Donepezil 20 mg / kg (G4M), and 200 mg / kg intravenous bolus dosed at 5 mg / kg for 5 minutes

Group Sex Dose (mg / kg) Animal No. CIMI-16-02-03 D + YMJHT TX : Mouse single oral dose toxicity test Control Male Distilled water 10 ml / kg M01 ~ M07 Reference Male Donepezil single formula ( 20 mg / kg) M08 ~ M14 Reference Male YMJHT single formula ( 400 mg / kg) M15 to M21 Active Male Donepezil and YMJHT ( 20 and 400 mg / kg) M22 to M28 Active Male Donepezil and YMJHT ( 20 and 200 mg / kg) M29 to M35 Active Male Donepezil and YMJHT ( 20 and 100 mg / kg) M36 to M42

4.1.2. Experimental purpose and method of administration

Oral gavage (oral gavage) was used for oral administration at a dose of 10 ml / kg for 5 minutes or less. A 400, 200, or 100 mg / mg / kg administered mice were administered with a single syringe attached to a 1 ml syringe at intervals of 5 minutes or less. In the single administration group, only the same volume of sterilized distilled water was administered to the mice in the case of administration of either yomi jiulghang or donepezil, Only sterile distilled water was administered twice every 5 minutes.

The dose of Donepezil was set at 20 mg / kg, which is lower than the 45.2 mg / kg of half-lethal dose (LD50) of male mice known in the literature. The dosing dose of 400, 200 or 100 mg / Concomitant administration was set based on the results of Examples 1 and 2. In this Example 4, a suitable dose of Korean herbal medicine (40, 20 or 10 mg / ml concentration) or donepezil (2 mg / ml concentration) was dissolved in sterilized distilled water to give a dose of 10 ml / kg . All surviving experimental animals were subjected to a final autopsy 14 days after administration (Table 19; Fig. 16).

The observation period was 14 days and the clinical symptoms, weight change, autopsy findings, long term weight, hematology (14 items; Table 20) and blood chemistry (20 items; Table 21) The pancreas can be divided into two parts: the cerebrum, cerebellum and soft tissue, heart, thymus, lung, testis, epididymis, kidney, adrenal gland, liver, pancreas, Respectively.

Hematology Items Units Methods Abbreviations Full name 1. RBC Red blood cell count M / L Laser optical (Flow cytometry) 2. HGB Hemoglobin concentration g / dl Cyanmethemoglobin method 3. HCT Hematocrit % Calculated from Item 1 and 4 4. MCV Mean corpuscular volume fL Laser optical (Flow cytometry) 5. MCH Mean corpuscular hemoglobin pg Calculated from Item 1 and 2 6. MCHC Mean corpuscular hemoglobin concentration g / dL Calculated from Item 2 and 3 7. PLT Platelet count K / μL Laser optical (Flow cytometry) 8. RET Reticulocyte count ea / 1000 Laser optical with cytochemical reaction 9. WBC White blood cell count K / μL Laser optical with cytochemical reaction Differential counts of white blood cells 10. NEU%  Percentages of neutrophils % Perox optical with chemical reaction 11. LYM%  Percentages of lymphocytes % Perox optical with chemical reaction 12. MON%  Percentages of monocytes % Perox optical with chemical reaction 13. EOS%  Percentages of eosinophils % Perox optical with chemical reaction 14. BAS%  Percentages of basophils % Perox optical with chemical reaction

Hematology Items Units Methods Abbreviations Full name 1. AST Aspartate aminotransferase IU / L UV-Rate method 2. ALT Alanine aminotransferase IU / L UV-Rate method 3. ALP Alkaline phosphatase IU / L P-NPP method 4. BUN Blood urea nitrogen mg / dL Urease-UV method 5. CRE Creatinine mg / dL Jaffe method 6. GLU Glucose mg / dL Enzyme method 7. CHO Total cholesterol mg / dL Enzyme method 8. PRO Total protein g / dL Biuret method 9. CPK Creatine phosphokinase IU / L UV-Rate method 10. ALB Albumin g / dL BCG method 11. BIL Total bilirubin mg / dL Jendrassik-cleghorn method 12. Globulin Globulin g / dL Calculated from Item 8 and 10 13. A / G Albumin / globulin ratio Ratio Calculated from Item 10 and 12 14. IP Inorganic phosphorus mg / dL UV method 15. Ca Calcium mg / dL OCPC method 16. TG Triglyceride mg / dL Enzyme method 17. LDH  Lactate dehydrogenase IU / L UV-Rate method 18. Na Sodium mmol / L Electrode method 19. K Potassium mmol / L Electrode method 20. Cl Chloride mmol / L Electrode method

4.2. Experiment result

4.2.1. Mortality check

In the present study, 4 (4/7; 57.14%) and 1 (1/4) of donepezil 20 mg / kg alone group, donepezil 20 mg / kg and 400, 200 and 100 mg / 7, 14.29%), 3 (3/7; 42.86%) and 3 (3/7; 42/86%) of deaths were confined to within one hour after the end of the study. On the other hand, in the control group and the 400 mg / kg single composition administration group, the mortality associated with the administration was not observed during the 14-day experimental period, and a final autopsy was performed on all the experimental animals (7/7; 100% (Table 22).

Groups Day after treatment Total * 0 ^a One 2 3 4 5 6 7 8 9 10 11 12 13 Vehicle control  Distilled water 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0/7 (0%) Donepezil single 20 mg / kg 4 0 0 0 0 0 0 0 0 0 0 0 0 0 4/7 (57.14%) YMJHTsingle  400 mg / kg 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0/7 (0%) Donepezil 20 mg / kg and YMJHTco-treated 400 mg / kg One 0 0 0 0 0 0 0 0 0 0 0 0 0 1/7 (14.29%) 200 mg / kg 3 0 0 0 0 0 0 0 0 0 0 0 0 0 3/7 (42.86%) 100 mg / kg 3 0 0 0 0 0 0 0 0 0 0 0 0 0 3/7 (42.86%)

4.2.2. Identify clinical symptoms

A significant [3+] progression and ataxia findings were observed in all experimental animals (7/7; 100%) in donepezil 20 mg / kg single composition administration group, 200 or 100 mg / kg for 5 min or less, significantly reduced to mild [1+] or moderate [2+]. In conclusion, the effects of donepezil 20 mg / kg and yommi jiwanghangang 400 mg / kg within 5 min were slightly increased in all experimental animals (7/7; 100%), In the group treated with 200 or 100 mg / kg within 5 min, moderate progression and ataxia were found in all 7 animals (7/7; 100%). On the other hand, significant clinical symptoms were not observed during the 14-day observation period in the vehicle control group and the 400 mg / kg single composition administration group of the test group, and all the surviving experimental animals recovered to normal within 6 hours of the administration (Table 23).

Groups Normal appearance Clinical signs: Tremor and loss of locomotion Slight [1+] Moderate [2+] Severe [3+] Vehicle control  Distilled water 7/7 (100%) 0/7 (0%) 0/7 (0%) 0/7 (0%) Donepezil single 20 mg / kg 0/7 (0%) 0/7 (0%) 0/7 (0%) 7/7 (100%) YMJHTsingle  400 mg / kg 7/7 (100%) 0/7 (0%) 0/7 (0%) 0/7 (0%) Donepezil 20 mg / kg and YMJHT co-treated 400 mg / kg 0/7 (0%) 7/7 (100%) 0/7 (0%) 0/7 (0%) 200 mg / kg 0/7 (0%) 0/7 (0%) 7/7 (100%) 0/7 (0%) 100 mg / kg 0/7 (0%) 0/7 (0%) 7/7 (100%) 0/7 (0%)

4.2.3. Changes in body weight and weight gain

Changes in body weight and body weight gain compared to the vehicle control group were not observed in all experimental groups, including donepezil 20 mg / kg alone, and significant changes in body weight and body weight compared to donepezil 20 mg / kg alone All donepezil 20 mg / kg and three doses of Echinosophora japonica 400, 200 or 100 mg / kg in less than 5 min intervals were not admitted throughout the experimental period (Table 24; Figure 17).

Groups Intervals Day 0 * ~ Day 7 Day 7 ~ Day 14 Day 0 ~ Day 14 ** Vehicle control Distilled water 7.64 ± 0.89 1.31 + 0.68 3.99 ± 0.88 Donepezil single 20 mg / kg 7.83 + 0.06 1.67 + - 0.42 4.07 + - 0.49 YMJHTsingle 400 mg / kg 7.30 0.66 1.79 + 0.87 3.80 ± 1.12 Donepezil 20 mg / kg and YMJHTco-treated 400 mg / kg 7.72 ± 1.18 1.63 + - 0.83 4.67 ± 1.71 200 mg / kg 8.38 ± 1.98 1.58 ± 0.78 4.80 ± 2.99 100 mg / kg 6.93 ± 1.88 1.48 ± 1.01 3.30 ± 1.99

4.2.4. Change in long-term weight

Significant changes in organ weight compared to vehicle control groups were not observed in all experimental groups, including donepezil 20 mg / kg alone, and significant changes in organ weight compared to donepezil 20 mg / kg alone were observed in all donepezil 20 mg / kg, and 400, 200 or 100 mg / kg intraperitoneal injection within 5 minutes (Table 25 and 26).

delete

Groups Principal organs Lung Heart Thymus Kidney L Adrenal G L Spleen Vehicle control 0.581 + 0.069 0.498 + 0.031 0.119 + 0.037 0.919 + 0.125 0.008 0.005 0.265 + 0.046 Donepezil single 20 mg / kg 0.566 + 0.093 0.499 + 0.015 0.135 + 0.031 0.886 ± 0.103 0.008 0.002 0.257 + 0.018 YMJHT single  400 mg / kg 0.564 + 0.039 0.500 + 0.049 0.148 + 0.038 0.897 + 0.097 0.007 ± 0.003 0.281 + 0.039 Donepezil 20 mg / kg and YMJHTco-treated 400 mg / kg 0.561 + 0.026 0.495 + 0.026 0.119 + 0.033 0.835 + 0.084 0.008 ± 0.004 0.243 + 0.045 200 mg / kg 0.580 0.080 0.492 + 0.046 0.127 0.018 0.997 + 0.074 0.007 ± 0.003 0.274 + 0.074 100 mg / kg 0.601 + - 0.051 0.483 + 0.043 0.140 + 0.041 0.850 0.119 0.006 0.002 0.284 + 0.028 Groups Vehicle control 0.364 + 0.044 4.322 + 0.585 0.485 ± 0.052 1.461 + 0.075 0.140 + 0.014 0.006 ± 0.004 Donepezil single 20 mg / kg 0.339 + 0.018 4.309 + 0.873 0.469 + 0.037 1.423 + 0.046 0.143 ± 0.005 0.005 0.002 YMJHTsingle  400 mg / kg 0.350 + 0.033 4.392 + 0.123 0.497 + 0.037 1.464 ± 0.091 0.144 + 0.015 0.006 0.005 Donepezil 20 mg / kg and YMJHTco-treated 400 mg / kg 0.353 + 0.061 4.375 ± 0.448 0.466 + 0.040 1.457 ± 0.065 0.138 + 0.010 0.004 0.002 200 mg / kg 0.337 ± 0.053 4.536 + 0.478 0.491 + 0.067 1.451 + 0.171 0.138 + 0.023 0.008 0.003 100 mg / kg 0.355 + 0.067 4.449 + 0.255 0.500 + 0.030 1.500 + - 0.142 0.134 0.025 0.006 0.002

4.2.5. Hematological change

As a result of 14 hematologic tests, significant hematologic changes compared to vehicle control were not observed in all experimental groups including donepezil 20 mg / kg monoclonal administration group and significant blood compared to donepezil 20 mg / The changes were not observed in all doses of donepezil 20 mg / kg and 400 mg / kg, 200 or 100 mg / kg in 5 min interval (Table 27).

Groups Hematological Items: Red Blood Cells RBC HGB HCT MCV MCH MCHC PLT RET Vehicle control 8.58 0.61 18.63 + - 0.57 40.73 + - 0.70 47.61 + - 2.57 21.74 ± 0.87 45.70 + - 0.74 800.57 + - 101.49 0.27 ± 0.15 Donepezil single 20 mg / kg 8.60 + - 0.53 18.70 ± 0.30 40.77 + - 0.51 47.43 + - 2.38 21.73 ± 0.99 45.83 + - 0.23 781.33 + - 138.91 0.27 ± 0.06 YMJHTsingle  400 mg / kg 8.61 ± 0.48 18.64 ± 0.59 40.74 ± 0.59 47.40 ± 1.86 21.66 ± 0.57 45.73 + - 0.81 798.14 + - 91.77 0.26 ± 0.17 Donepezil 20 mg / kg and YMJHT co-treated 400 mg / kg 8.62 ± 0.46 18.62 ± 0.48 40.62 + - 0.62 47.15 + 1.89 21.57 ± 0.67 45.78 ± 0.58 791.33 + - 93.18 0.28 ± 0.15 200 mg / kg 8.65 + - 0.47 18.68 + - 0.54 40.83 + - 0.61 47.25 + 1.93 21.60 ± 0.61 45.68 + - 0.67 788.75 ± 117.79 0.28 ± 0.17 100 mg / kg 8.49 + - 0.47 18.55 + - 0.52 40.73 + - 0.64 48.03 + - 1.95 21.80 ± 0.64 45.50 ± 0.65 799.25 + - 104.48 0.28 ± 0.17 Groups Hematological Items: White Blood Cells WBC NEU (%) LYM (%) MONO (%) EOS (%) BASO (%) Vehicle control 4.78 + - 0.53 8.93 ± 0.79 86.53 + - 0.70 2.96 + 0.24 0.27 + 0.14 0.43 0.26 Donepezil single 20 mg / kg 4.87 ± 0.28  9.00 0.70 86.43 + - 1.54 2.93 ± 0.15 0.27 ± 0.06 0.47 + 0.38 YMJHT single  400 mg / kg 4.75 ± 0.45  8.93 + - 0.54 86.34 + - 0.88 2.90 ± 0.64 0.29 ± 0.09 0.50 + - 0.38 Donepezil 20 mg / kg and YMJHT co-treated 400 mg / kg 4.87 ± 0.27  8.75 ± 0.65 86.42 + 1.33 2.97 + - 0.46 0.28 ± 0.15 0.45 ± 0.23 200 mg / kg 4.79 ± 0.32  8.90 + - 0.67 86.63 + - 1.06 2.90 + - 0.43 0.28 ± 0.17 0.45 + 0.13 100 mg / kg 4.75 0.44  8.88 ± 0.48 86.53 + - 0.86 2.93 ± 0.31 0.28 0.21 0.48 0.17

4.2.6. Blood biochemical change

Twenty blood biochemical tests showed that significant blood biochemical changes were not observed in all experimental groups, including donepezil 20 mg / kg alone, compared with vehicle control, and donepezil 20 mg / kg alone , Significant blood biochemical changes were not observed in all donepezil 20 mg / kg and 400 mg, 200 or 100 mg / kg intravenous infusion group (Table 28).

Groups Serum Biochemical Items AST ALT ALP BUN CRE GLU CHO Vehicle control 65.01 + - 10.43 23.27 ± 2.76  65.53 + - 13.34  16.09 ± 1.37 0.43 + 0.11 99.14 + - 10.93 157.57 ± 18.27 Donepezil single 20 mg / kg 63.10 ± 17.75 23.33 + - 2.79  64.27 + - 6.47  16.20 ± 1.10  0.47 + 0.21  100.33 + - 17.56 153.67 ± 7.37 YMJHT single  400 mg / kg 64.03 + - 11.71 23.44 + 1.98  65.00 ± 11.58  15.89 + - 1.23  0.41 + 0.13  101.14 + - 9.41 154.29 ± 13.00 Donepezil 20 mg / kg and YMJHTco-treated 400 mg / kg 61.20 ± 13.41 22.92 + - 2.74  65.67 ± 12.64  16.03 ± 1.96  0.45 ± 0.26  100.50 ± 10.93 155.50 + - 14.54 200 mg / kg 62.80 + - 8.71 23.20 ± 1.66  64.25 + 14.22  16.45 ± 1.56  0.45 + 0.13 99.50 ± 18.56 158.75 ± 24.25 100 mg / kg 64.78 ± 17.68 23.03 + - 2.39  64.18 + - 7.76  15.80 ± 1.78  0.45 + 0.13 99.50 + 13.23 157.50 ± 13.48 Groups PRO CPK BIL ALB Globulin A / G TG Vehicle control  4.67 ± 0.56  134.14 ± 31.41 0.13 ± 0.05 2.89 + - 0.41 1.79 ± 0.31 1.66 + - 0.33 162.00 ± 14.34 Donepezil single 20 mg / kg 4.60 ± 0.62 139.00 ± 14.42 0.13 + 0.06 2.87 ± 0.21 1.73 0.55 1.79 + 0.66 161.00 ± 19.16 YMJHT single  400 mg / kg 4.64 ± 0.49 131.71 ± 29.71 0.11 + 0.04 2.87 ± 0.41 1.77 + - 0.55 1.76 ± 0.57 161.71 ± 22.46 Donepezil 20 mg / kg and YMJHTco-treated 400 mg / kg 4.67 ± 0.45 134.00 ± 30.95 0.12 + 0.04 2.85 ± 0.29 1.82 + - 0.25 1.59 ± 0.21 159.50 ± 22.00 200 mg / kg 4.70 ± 0.37 132.25 ± 52.60 0.13 ± 0.05 2.90 ± 0.16 1.80 ± 0.22 1.62 + - 0.12 164.75 ± 20.02 100 mg / kg 4.63 + - 0.46 128.75 ± 48.22 0.13 ± 0.05 2.90 ± 0.22 1.73 ± 0.56 1.89 ± 0.89 162.00 ± 31.32 Groups LDH (x 10 ² ) Ca P Na K Cl Vehicle control 16.04 + - 6.80 11.41 ± 0.20 10.99 ± 0.27 141.43 + - 1.27 10.33 + - 0.26 114.00 ± 0.58 Donepezil single 20 mg / kg 16.67 ± 9.82 11.43 ± 0.23 11.03 + - 0.32 141.33 + - 0.58 10.30 ± 0.20 114.00 ± 1.00 YMJHT single  400 mg / kg 15.23 8.38 11.39 ± 0.23 10.96 ± 0.26 141.57 1.51 10.36 ± 0.28 114.14 ± 1.07 Donepezil 20 mg / kg and YMJHTco-treated 400 mg / kg 17.05 + - 8.71 11.43 ± 0.26 11.02 ± 0.26 141.33 ± 1.21 10.33 + - 0.23 113.83 ± 0.75 200 mg / kg 18.05 ± 3.73 11.45 ± 0.31 11.05 + -0.31 141.50 ± 1.29 10.30 ± 0.27  113.75 ± 1.26 100 mg / kg 15.09 + - 6.01 11.43 + - 0.17 11.05 + 0.19 141.50 ± 1.29 10.33 + - 0.26  114.25 ± 1.26

4.2.7. Autopsy findings

There was no significant gross autopsy findings in all deaths confined to the dosing day in Donepezil alone or in combination with Yomi jiulhwangang within 5 minutes. Mild lung congestion, thrombocytopenia, spleen atrophy or enlargement, sublingual lymph node enlargement Significant gross autopsy findings were not observed in all study groups except for the media control group (Table 29).

Groups Vehicle control Donepezil
Single YMJHT
Single Donepezil 20 mg / kg and YMJHT co-administration 20 mg / kg 400 mg / kg 400 mg / kg 200 mg / kg 100 mg / kg Lung
Normal
Congestion 1+
6/7
1/7
2/3
1/3
7/7
0/7
5/6
1/6
3/4
1/4
3/4
1/4 Thymus
Normal
Atrophy 1+
6/7
1/7
3/3
0/3
7/7
0/7
6/6
0/6
3/4
1/4
4/4
0/4 Spleen
Normal
Atrophy 1+
HT ^† 1+
5/7
1/7
1/7
2/3
1/3
0/3
4/7
1/7
2/7
4/6
1/6
1/6
2/4
1/4
1/4
3/2
0/2
1/2 Lymph node ^a)
Normal
HT 1+
5/7
2/7
2/3
1/3
7/7
0/7
5/6
1/6
3/4
1/4
2/4
2/4 Others
Normal
7/7
3/3
7/7
6/6
4/4
4/4

4.2.8. Histopathological observation

(Fig. 18), thymic cortical lymphocyte reduction (Fig. 19), splenic red watery lymphocyte enlargement or white watery lymphocyte reduction (Fig. 20), hepatic inflammatory cell infiltration (Fig. 21) and subcutaneous lymphocyte diffuse lymphocyte enlargement ) Were observed sporadically in all study groups, including the vehicle control group, but significant histopathological findings were not observed in surviving experimental animals in all study groups (Table 30)

Groups Vehicle control Donepezil
Single YMJHT
Single
400 mg / kg Donepezil 20 mg / kg and YMJHT co-administration 20 mg / kg 400 mg / kg 200 mg / kg 100 mg / kg Lung
Normal
CG ^† 1+
6/7
1/7
2/3
1/3
7/7
0/7
5/6
1/6
3/4
1/4
3/4
1/4 Spleen
Normal
wDE ^† 1+
rHP ^† 1+

6/7
1/7

3/3
0/3

7/7
0/7

6/6
0/6

3/4
1/4

4/4
0/4 Liver
Normal
IF ^† 1+ 5/7
1/7
1/7 2/3
1/3
0/3 4/7
1/7
2/7 4/6
1/6
1/6 2/4
1/4
1/4 3/4
0/4
1/4 Lymph node ^a)
Normal
dHP ^† 1+
6/7
1/7
2/3
1/3
6/7
1/7
6/6
0/6
3/4
1/4
3/4
1/4 Fundus
Normal
CY ^† 1+
5/7
2/7
2/3
1/3
7/7
0/7
4/6
2/6
3/4
1/4
2/4
2/4 Others
Normal
7/7
3/3
7/7
6/6
4/4
4/4

In this Example 4, 4 cases (4/7; 57.14%) of deaths were confined within 1 hour after administration of donepezil 20 mg / kg alone, and severe progression and ataxia were observed in all experimental animals (7/7; 100%), respectively. On the other hand, deaths due to donepezil treatment were 1 (1/7; 14.29%), 3 (3/7; 42.86%) and 3 (3/7; The incidence of progression and ataxia was also significantly reduced in the moxifloxacin dose-dependently, administered mildly or moderately by intravenous administration of 400, 200, and 100 mg / kg for 5 minutes. . In conclusion, the effects of donepezil 20 mg / kg and yommi jiwanghangang 400 mg / kg within 5 min were slightly increased in all experimental animals (7/7; 100%), In the group treated with 200 or 100 mg / kg within 5 min, moderate progression and ataxia were found in all 7 animals (7/7; 100%). Body weight, hematological and blood biochemical changes, gross autopsy and histopathological findings associated with donepezil or yomi jiwanghang administration were not observed in the surviving experimental animals in all treatment groups as compared with the vehicle control group, and survival of donepezil 20 mg / kg The progression and ataxia findings in all experimental animals survived in the single composition, donepezil 20 mg / kg and 400, 200 and 100 mg / kg administration group, also recovered to normal within 6 hours after the administration. Therefore, as a result of Examples 1 and 2, it was observed that the administration of donepezil for 5 minutes or less did not affect the bioavailability of the herbicide. Therefore, , It was judged that donepezil significantly reduced neurological symptoms and death through ACE inhibition based on various well-known pharmacological effects without affecting the bioavailability of donepezil. Thus, donepezil and yemmi- Is expected to provide a new treatment method that is very useful for the treatment and management of both oriental herbs.

In the medium control group used in Example 4, donepezil and Yemmi jiuanghang alone, all three doses of Jommi jiuanghang 400, 200 or 100 mg / kg and donepezil 20 mg / kg within 5 minutes, Kg body weight and weight gain, respectively. Significant changes in body weight and body weight were not observed in all experimental groups, including donepezil 20 mg / kg alone, and donepezil 20 mg / kg alone Changes in body weight and body weight gain compared to the control group were not observed in all donepezil 20 mg / kg and three doses of 400, 200 or 100 mg / Therefore, the combined administration of donepezil 20 mg / kg and 400 mg / kg of Echinosporium japonica, 100, 200 or 400 mg / kg of donepezil and 20 mg / kg of donepezil for 5 minutes did not affect the weight and body weight of normal mice. .

After oral administration of donepezil 20 mg / ml single composition in Example 4, a significantly higher mortality (4/7; 57.14%) than the LD 50 of 45.2 mg / kg in donepezil male mice known in the prior literature The effects of stress on the fasting and concomitant administration are considered to be significant. On the other hand, deaths due to donepezil treatment were decreased by 1 (1/7; 14.29%), 3 (3/7; 42.86%) and 3 / 7; 42/86%), which is a clear direct evidence that donepezil's ACE inhibition is significantly reduced by concomitant administration of YMI. On the other hand, deaths associated with the administration of the 400 mg / kg single composition of the medium control group and the yummy herbal extract were not observed during the 14 day experimental period.

Donepezil major clinical symptoms are known as neuropathy, progression and ataxia due to ACE inhibition. In the result of Example 4, severe progression and ataxia were observed in all experimental animals (7 mg / kg body weight) in donepezil 20 mg / / 7; 100%), but the degree of progression and ataxia by these donepezil was dose-dependently administered with moxifloxacin 400, 200 and 100 mg / kg for 5 min or less . In conclusion, the effects of donepezil 20 mg / kg and yommi jiwanghangang 400 mg / kg within 5 min were slightly increased in all experimental animals (7/7; 100%), In the group treated with 200 or 100 mg / kg within 5 min, moderate progression and ataxia were found in all 7 animals (7/7; 100%). These results are clear evidence that the neuropathy due to ACE inhibition of donepezil is significantly reduced by the combined administration of Jukmi jiu-Huang Tang under at least the condition of Example 4. [ On the other hand, significant clinical symptoms were not observed during the observation period of 14 days in the vehicle control group and 400 mg / kg of the single component composition of the test group, and all the surviving experimental animals recovered to normal within 6 hours after the administration.

Significant hematological and blood biochemical changes compared to vehicle control groups were not observed in all experimental groups, including donepezil 20 mg / kg alone, and donepezil 20 mg / kg alone, Biochemical changes were not observed in all doses of donepezil 20 mg / kg and 400 mg / kg, 200 or 100 mg / kg,

On the other hand, there was a slight increase in pulmonary congestion, thrombus atrophy, spleen atrophy or enlargement, subclinical lymph node enlargement and slight pulmonary congestion observed during histopathological examination, decrease in thymic cortical lymphocytes, increase in splenic red water lymphocytes or decrease in white water lymphocytes, Infectious inflammatory cell infiltration and diffuse lymphocytic hyperplasia were observed sporadically in all the experimental groups including the medium control group and were thought to be accidental lesions rather than toxic symptoms caused by donepezil or yommi jiwanghang administration, Are rare findings.

Therefore, it was observed that the administration of 400, 200 or 100 mg / kg of Jummi Jiwanghang for 5 minutes or less significantly inhibited the neuropathy and death through donepezil ACE inhibition through the various pharmacological effects of Jummi Jiwanghang itself. In conclusion, the combination of 5 mg / kg or more of 100 mg / kg of cow's milk under the conditions of this experiment did not affect the bioavailability of donepezil, but the effect of ACE inhibition of donepezil through various well- It is expected that the combination of donepezil and yemmi jiulhangtang in patients with vascular dementia can provide a new treatment method which is very useful for bilateral oriental medicine and treatment.

It will be understood by those skilled in the art that the foregoing description of the present invention is for illustrative purposes only and that those of ordinary skill in the art can readily understand that various changes and modifications may be made without departing from the spirit or essential characteristics of the present invention. will be. It is therefore to be understood that the above-described embodiments are illustrative in all aspects and not restrictive.

Claims (6)

The present invention relates to a pharmaceutical composition for treating dementia comprising donepezil and moxa zhiwanghang, wherein said moxa is selected from the group consisting of Rehmannia glutinosa Liboschitz var. Purpurea Makino, Dioscorea batatas Decaisne, Cornus Officinalis Siebold et Zuccarini, Wherein the composition comprises Poria cocos Wolf, Paeonia suffruticosa Andrews, and Alisma orientale Juzepczuk.
delete delete The method according to claim 1,
Characterized in that the donepezil and keratin juice are previously mixed and formulated or separately formulated.
The method according to claim 1,
Wherein the donepezil and the moxibustion oil are administered parenterally, orally, locoregionally, or percutaneously.
The method according to claim 1,
The method of claim 1, wherein the administration of Jomi jiu Huanghang starts between 1 minute and 30 minutes after administration of Donepezil.

Images