KR101857603B1 - Method for fluorometric detection of microRNA using rolling circle amplication - Google Patents

Abstract

The present invention relates to a method for detecting fluorescence of miRNAs using turnaround amplification, which comprises reacting amplified target miRNA-containing DNA with fluorescence-labeled PNA using turnover amplification, attaching an unreacted probe to the oxidized graphene, Is detected.
The pharmaceutical composition of the present invention is more sensitive than the conventional qRT-PCR method, and thus can be useful for detecting target miRNA.

Description

[0001] The present invention relates to a method for detecting miRNA fluorescence using a recombination amplification method,

The present invention relates to a method for detecting fluorescence of miRNA by using recombination amplification, and more particularly, to a method for detecting DNA by reacting a probe with DNA polymerized to contain a target miRNA through round-trip amplification.

MicroRNAs (miRNAs) are small non-coded 25 (single stranded) strands of single strand (ss) that bind to the untranslated region of the target mRNA and play an important role, such as an endogenous gene regulator RNA, which causes degradation and regulation of protein expression of the target mRNA. MiRNAs are closely associated with the onset of human diseases, including malignant tumors, because they are involved in a variety of biological processes such as cell proliferation, differentiation, stress resistance and apoptosis (Non-Patent Documents 1-4).

In miRNAs present in serum, plasma and whole blood, their detection is important for understanding biological function and for diagnosing cancer (Non-Patent Documents 5-6). The northern blot technology and microarray are currently used as basic miRNA detection methods as real-time PCR, but have limitations in that they are low in sensitivity, low in selectivity, and require a lot of labor (Non-Patent Document 7-10) . Unique characteristics of miRNAs include short length, low abundance, and homology in the miRNA family, making this difficult to analyze.

Recently, several chemical or enzymatic modification methods have been used to amplify miRNAs, including fluorescence labeling assays and nanoparticle-amplification detection methods, developed to improve analytical sensitivity and selectivity 11-15). In particular, turnover amplification (RCA) is a method commonly used for the detection of DNA, RNA and proteins. RCA is an isothermal enzymatic process used to synthesize long ssDNA molecules with tandem repeats. Due to the simplicity of the process and the high sensitivity and specificity, RCA is regarded as a promising DNA amplification tool for a variety of applications such as biosensors, diagnostics and genomics (non-patent document 16).

Graphene oxide (GO) is a water-soluble graphene derivative and is composed of carbon, oxygen and hydrogen. GO exhibits high affinity due to hydrogen bonding and pi-stacking interactions with single-stranded nucleic acids, but affinity with double-stranded nucleic acids is low because nucleases are hidden inside double helix 17-18). In addition, the GO effectively quench the nearby fluorescence through long-range energy transfer from the fluorophore of the GO molecule to the pi-system (see Non-Patent Document 19 ).

According to these properties, GO has recently been used as a fluorescence quencher to distinguish fluorescence-labeled single-stranded oligonucleotides from double-stranded nucleic acids (Non-Patent Document 20-22). Peptide nucleic acids (PNA), an artificially synthesized nucleic acid similar to DNA or RNA, have been used as probe oligonucleotides in conventional GO-based assays (Non-Patent Documents 23-24). If the phosphate group is insufficient in PNA, strong hybridization with its complementary nucleic acid occurs due to the removal of charge repulsion (Non-Patent Document 25).

Korean Patent Laid-Open No. 10-2006-0073815 (Jun. 26, 2006) discloses a conversion amplification method using a hairpin structure and a secondary primer as disclosed in Korean Patent Publication No. 10-2013-0044289 Disclose a method of amplifying nucleic acids under high temperature isothermal conditions using heat resistant proteins.

Korean Registered Patent No. 10-0957057 (2010.05.03.) Korean Patent Publication No. 10-2013-0044289 (Feb. Korean Patent No. 10-1425724 (July 25, 2014) U.S. Published Patent Application No. 2015-0080251 (Mar. 19, 2015) Korean Patent Publication No. 10-2006-0073815 (Jun. 29, 2006)

Nat. Rev. Cancer. 2006, 6, 259-269 Cancer Res. 2007, 67, 4553-4555 Cancer Chemother. Pharmacol. 2014, 74, 1105-1111. Clin. Lung Cancer. 2009, 10, 42-46. Cell Res. 2008, 18, 997-1006 Mol. Cancer. 2010, 9, 306. Nucleic Acids Res. 2004, 32, e175. Nat. Methods. 2004, 1, 47-53 RNA. 2005, 11, 1461-1470. Nucleic Acids Res. 2005, 33, e179. Chem. Commun. 2015, 51, 2156-2158 Chem. Int. Ed. 2009, 48, 3268-3272 Chem. Commun. 2012, 48, 194-196. Chem. Commun. 2014, 50, 3292-3295 Bioconjug. Chem. 2015, 26, 602-607. Angew. Chem. Int. Ed. 2008, 47, 6330-6337. Nano Lett. 2009, 9, 1058-1063. Analyst. 2013, 138, 1745-1749. Chem. Phys. 2008, 129, 054703. Langmuir 2014, 30, 12587-12595. Chem. Commun. 2015, 51, 5641-5643. Chem. Commun. 2015, 51, 6960-6963. Science. 1991, 254, 1497-1500. Chem. Commun. 2013, 49, 9203-9205. Nature. 1993, 365, 566-568. Oncogene. 2007, 26, 2799-2803.

While studying miRNA detection methods, the present inventors found that it is useful for detecting miRNA-containing DNA by reacting amplified miRNA-containing DNA with fluorescence-labeled PNA and attaching unreacted PNA to the oxidized graphene using a conversion amplification method .

Accordingly, it is an object of the present invention to provide a fluorescence detection method of miRNA using a turnaround amplification method.

According to one aspect of the present invention, there is provided a method of amplifying a target miRNA comprising the steps of: a) preparing single-stranded DNA by isothermal amplification of a target miRNA through a turnaround amplification method; b) mixing a fluorescently labeled PNA probe with a sample comprising said single stranded DNA; c) adsorbing to the oxidized graphene a PNA probe that is not bound to the single stranded DNA after the mixing; And d) measuring the fluorescence expression of the sample.

In one embodiment, the target miRNA can be hybridized to the target miRNA as a primer in a recursive template, padlock probe DNA, which is complementarily designed to the target miRNA for the round-trip amplification of step a).

In one embodiment, the phi29 DNA polymerase can be used for DNA polymerisation in the round-robin amplification of step a) above.

In one embodiment, the miRNA may be comprised of 1 to 25 nucleotides, wherein the fluorescently labeled PNA probe may be labeled with a fluorophore selected from the group consisting of FITC, ATTO550 and CY5, wherein the miRNA is quantitatively And the detection limit of the miRNA may be 0.4 pM.

According to one aspect of the present invention, there is provided a method of amplifying a target miRNA comprising the steps of: a) preparing single strand DNA each of which is subjected to isothermal amplification of a target miRNA through a conversion amplification method for a plurality of samples; b) mixing a fluorescently labeled PNA probe with a sample comprising said single stranded DNA; c) adsorbing to the oxidized graphene a PNA probe that is not bound to the single stranded DNA after the mixing; And d) selecting a sample containing the target miRNA by measuring fluorescence expression of the sample.

In one embodiment, the target miRNA can be hybridized to the target miRNA as a primer in a recursive template, padlock probe DNA, which is complementarily designed to the target miRNA for the round-trip amplification of step a).

In one embodiment, the phi29 DNA polymerase can be used for DNA polymerisation in the round-robin amplification of step a) above.

In one embodiment, the miRNA may be comprised of 1 to 25 nucleotides, wherein the fluorescently labeled PNA probe may be labeled with a fluorophore selected from the group consisting of FITC, ATTO550 and CY5, wherein the miRNA is quantitatively And the detection limit of the miRNA may be 0.4 pM.

According to the present invention, it has been found that the fluorescence detection method of miRNA using turnaround amplification is more sensitive than the conventional method using the qRT-PCR method. Thus, the fluorescence detection method of miRNA using the present recombinant amplification can be useful for detecting target miRNA.

Figure 1 shows a schematic diagram of a miRNA detection process using an RCA-based miRNA amplification method and a graphene oxide (GO) -based fluorescence assay.
Figure 2 shows the onset of GO-based fluorescence analysis via turnaround amplification. (a) circularization of the rotating mold; (b) identification of RCA products by electrophoresis; And (c) fluorescence emission of FITC-labeled PNA21 depending on the presence or absence of RCAP 16 or 21.
3 is a graph visualizing the concentration of GO required for fluorescence quenching.
Figure 4 is a fluorescence spectrum measured by stepwise dilution of miRNA from 10 nM to determine the sensitivity of GO-based fluorescent miRNA detection. (a) fluorescence emission spectra with changes in miRNA concentration; And (b) linear correlation between fluorescence intensity and miRNA concentration logarithm.
Figure 5 shows the detection results of miRNA21 present in an intracellular RNA sample. (a) fluorescence emission spectra with changes in miRNA concentration; And (b) linear correlation between fluorescence intensity and miRNA concentration logarithm.
Figure 6 shows the results of comparing and detecting various concentrations of miRNA using two methods of qRT-PCR and GO-based fluorescence assay. (a) a graph of fluorescence intensity increase versus increase in miRNA21 concentration using the qRT-PCR method; (b) a graph of fluorescence intensity increase versus concentration of miRNA21 using a GO-based miRNA fluorescence detection method; And (c) a comparison graph of relative fluorescence intensity with the concentration of miRNA21.
Fig. 7 shows the results of electrophoresis analysis of RCAP to determine whether the length of the DNA band is turnover amplification.
Figure 8 shows the specificity of a GO-based fluorescent miRNA detection system using multi-well plates. (a) a miRNA specificity confirmation graph of F-PNA labeled with different fluorophore groups; (b) a confirmation graph of binding of F-PNA labeled with different fluorophore groups to a specific miRNA in a miRNA mixture; And (c) miRNA multiple detection results using a multiwell plate.
Figure 9 shows GO-based fluorescent miRNA detection results using miRNAs containing a single nucleotide sequence variation. (a) a miRNA sequence with a wild-type miRNA sequence, a single base sequence mutation (red sequence) and an RCT21 DNA sequence corresponding thereto (blue sequence); (b) the result of checking the length of the RCAP band confirmed by electrophoresis; And (c) fluorescence detection results by binding of RCT21 and F-PNA21.

In the present specification, the term "phi29 DNA polymerase" refers to a strand displacement activity unlike other polymerases. Therefore, when the polymerization proceeds, It means an enzyme which is released into the chain and continues to polymerize.

The present invention provides a method of amplifying a target miRNA comprising the steps of: a) preparing a single stranded DNA obtained by isothermal amplification of a target miRNA through a recombination amplification method; b) mixing a fluorescently labeled PNA probe with a sample comprising said single stranded DNA; c) adsorbing to the oxidized graphene a PNA probe that is not bound to the single stranded DNA after the mixing; And d) measuring the fluorescence expression of the sample.

In one embodiment of the present invention, the target miRNA may be hybridized to the target miRNA as a primer in a transformation template that is padlock probe DNA, which is complementarily designed to the target miRNA for the round-trip amplification of step a).

In one embodiment of the invention, phi29 DNA polymerase can be used for DNA polymerisation in the round-trip amplification of step a).

In one embodiment of the invention, the miRNA may be miRNA 21.

The miRNA may be composed of 1 to 25 nucleotides, preferably 10 to 25 nucleotides, and more preferably 21 to 23 nucleotides.

In one embodiment of the invention, the fluorescently labeled PNA probe may be labeled with a fluorophore selected from the group consisting of FITC, ATTO550 and CY5.

In one embodiment of the invention, the miRNA is quantitatively detected, and the detection limit of the miRNA may be 0.4 pM.

The present invention provides a method for amplifying a target miRNA comprising the steps of: a) preparing a single stranded DNA by subjecting a plurality of samples to isothermal amplification of a target miRNA through a turnaround amplification method; b) mixing a fluorescently labeled PNA probe with a sample comprising said single stranded DNA; c) adsorbing to the oxidized graphene a PNA probe that is not bound to the single stranded DNA after the mixing; And d) selecting a sample containing the target miRNA by measuring the fluorescence expression of the sample.

In one embodiment of the present invention, the target miRNA may be hybridized to the target miRNA as a primer in a transformation template that is padlock probe DNA, which is complementarily designed to the target miRNA for the round-trip amplification of step a).

In one embodiment of the invention, phi29 DNA polymerase can be used for DNA polymerisation in the round-trip amplification of step a).

In one embodiment of the invention, the miRNA may be miRNA 21.

The miRNA may be composed of 1 to 25 nucleotides, preferably 10 to 25 nucleotides, and more preferably 21 to 23 nucleotides.

In one embodiment of the invention, the fluorescently labeled PNA probe may be labeled with a fluorophore selected from the group consisting of FITC, ATTO550 and CY5.

In one embodiment of the invention, the miRNA is quantitatively detected, and the detection limit of the miRNA may be 0.4 pM.

MiRNAs generated for detection are isothermally amplified using rolling circle amplification (RCA) (Figure 1). Here, a rolling circle template (RCT) acting as padlock probe DNA is designed complementarily to both ends of the target miRNA. In the presence of the target miRNA, RCT can be used as a template to hybridize and form a circle by the addition of T4 DNA ligase.

RCA is initiated by phi29 DNA polymerase, and the circular DNA is used as a template, and the miRNA can be a primer for DNA synthesis. In the RCA process, long ssDNA sequences are synthesized and can produce multiple copies of the target miRNA sequence. However, when no target miRNA is present, circular DNA formation and long ssDNA synthesis by phi29 DNA polymerase do not occur. Therefore, a rolling circle amplification product (RCAP) synthesized in the presence of the target miRNA is targeted for detection via a fluorescence-quenching platform using GO and F-PNA (FIG. 1).

F-PNAs complementarily designed to target miRNAs can be annealed at multiple sites of RCAP to form F-PNA / RCAP duplex molecules. In the formation of F-PNA / RCAP hybrids in the presence of miRNA, the dual molecular form hybridized with the F-PNA probe can not adsorb to the GO monolayer and therefore the F-PNA fluorescence is not extinguished. If the target miRNA is absent and concomitant RCAP is not formed, the free single-stranded F-PNA probe is adsorbed on the GO monolayer surface, and significant fluorescence can be expressed by the GO. Therefore, quantitative detection is possible by simply measuring the fluorescence signal after addition of GO to the reactant containing the miRNA.

Prior to carrying out this analysis, atomic force microscopy (AFM) can be used to identify the uniform monolayer structure of the GO used in the present invention. MiRNA21 can be selected as the target miRNA for best experimental conditions because miRNA21 is overexpressed in many lung cancer patients (non-patent reference 26). miRNA16 is used as a reference miRNA for data normalization (Non-Patent Document 6). First, circular DNA like the template is formed for RCA. The circular DNA is formed through ligation of linear DNA (RCT21) complementary to the target miRNA only in the presence of the target miRNA (miRNA21) (Fig. 2a).

Since both ends of RCT21 are complementary to miRNA21, the terminal fragment of RCT21 is ligated through a ligation reaction and forms a circular DNA. On the other hand, when RCT21 is mixed with miRNA16, only a single RCT21 band is observed (lane 3). The nucleotide end hydrolase I can be further used for digestion to confirm circular DNA formation, which degrades the ssDNA at the 3 'to 5' position, but does not digest double-stranded or circular DNA. RCT21 is degraded by the addition of nucleic acid terminal hydrolase I to the ligation reaction mixture (lane 4) and the band (lane 2) that corresponds to the fully conserved circular DNA. This appears to be RCT-specific rounding in the presence of the target miRNA.

Next, it can be confirmed whether the target miRNA sequence is specifically amplified through RCA after ligation. Ligation and RCA can occur in the presence of target miRNA21 or non-target miRNA16. Giant, high molecular weight DNA molecules are observed only in the presence of miRNA21 and present RCAP, a long ssDNA containing multiple copies of the target miRNA 21 sequence that can be generated by RCA (Fig. 2b, lane 3). Conversely, this enormous DNA product may not be observed in the absence of miRNA 21 or in the presence of non-target miRNA 16 (lane 1 and 2, respectively). These results may be due to ligation and RCA reactions that occur only in the presence of miRNAs that match the padlock template and the complementary sequence.

To demonstrate a GO-based fluorescence detection system, fluorescence changes in FITC-labeled PNA21 can be monitored by adding various RCAPs and GOs to a mixture of F-PNA21 (F-PNA21; complementary to miRNA21) ). When GO is added to a solution containing only F-PNA21, fluorescence can be remarkably extinguished. On the other hand, fluorescence quenching does not occur when GO is added to the F-PNA / RCAP21 hybrid.

When F-PNA is hybridized with the matching ssDNA, fluorescence of PNA can be stronger than ssPNA. As a negative control, miRNA16 sequence multiple copies of RCAP15 were also incubated with F-PNA21 (not complementary to RCAP16). Fluorescence of a mixture of F-PNA21 and RCAP16 in the presence of GO can be significantly extinguished compared to a mixture of F-PNA21 and RCAP21. Additionally, the fluorescence of F-PNA in an RCA reaction mixture in the absence of miRNA21 can also be quenched to a similar degree as RCAP16.

In order to increase the difference in fluorescence signal between the background fluorescence from the F-PNA probe and the unlabeled fluorescence of the F-PNA probe hybridized with the target miRNA sequence, the optimal concentration of GO is determined to be 3 to 10 μg / mL (Fig. 3).

Next, in order to evaluate the sensitivity of the GO-based miRNA detection method, the fluorescence intensity according to the increase in the concentration of miRNA21 (0 to 10 nM) can be measured. Figure 4 shows the relationship between the fluorescence intensity and the logarithmic value of the miRNA 21 concentration. The fluorescence intensity of RCAP21 increases gradually with increasing miRNA concentration and shows a linear correlation from 1 fM to 50 pM (Fig. 4B). The detection limit (LOD) was estimated from an equation of LOD = 3.3 X (SD / S) with a confidence level of 1%, where SD is the standard deviation of the response and S is the standard curve (standard curve). LOD was calculated at 0.4 pM, indicating that the method according to the present invention can detect up to 0.4 pM of miRNA.

The amount of miRNA21 was also quantified in a mixture of intracellular RNA. Total intracellular RNA was prepared from cultured lung cancer cells (A549 cells), 1 μg of sample was placed with miRNA 21 synthesized at various concentrations (0-100 nM), and then the fluorescence intensity of complementary F-PNA to RCAP21 Respectively. The quantitative increase in F-PNA fluorescence accompanying the logarithmic increase in miRNA21 concentration in the intracellular RNA mixture showed a linear correlation from 5 fM to 50 pM (Fig. 5). In GO-based miRNA detection for total RNA samples, the LOD was 0.7 pM. These results were compared with quantitative real-time PCR (qRT-PCR) using the same samples containing RNA of whole cells with various concentrations of miRNA21 (Figure 6). The GO-based miRNA detection system was found to be superior to qRT-PCR for quantitative detection of target RNA at low concentrations (<100 pM). These results indicate that miRNAs can be quantitatively detected by GO-based miRNA detection through isothermal amplification of miRNA sequences by RCA with high sensitivity that is unattainable with modern qRT-PCR.

To assess the specificity, the detection method of the present invention can be tested using miRNA21, miRNA16 and two different miRNAs (miRNA31 and miRNA155). PNA probes that match padlock template DNA (RCT) and other fluorescent materials are designed for amplification and detection of other miRNAs. Each incubation of the RCT with its corresponding miRNAs allows rapid synthesis of large, high molecular weight DNA molecules (RCAP) via RCA, which can be determined via agarose gel electrophoresis (FIG. 7).

A mixture of RCTs or RCTs (RCT21, RCT31 and RCT155) was used with the miRNAs (miRNA21, miRNA31 and miRNA155) in the ligation and RCFA reactions to further test the specificity of the RCT for corresponding target miRNAs. Strong fluorescence signals were selectively observed in RCA reactions involving appropriate RCT designed to anneal to each target miRNA and its corresponding fluorescent PNA probe (Fig. 8A).

Next, to test the specificity of each fluorescent PNA probe, a mixture of one or more of the PNA labeled with different fluorescent materials (FITC-PNA21, ATTO550-PNA31 and Cy5-PNA155) was incubated with RCAP . A strong fluorescence signal was selectively observed only when the target RCAP was hybridized to its matching fluorescent PNA (Fig. 8B). These results demonstrate that multiple probes containing different fluorescent materials can be used for multiple detection of different targets in a single reaction using appropriate fluorescence detection channels.

MiRNA detection technology according to the present invention was applied to multiple detection schemes and visual fluorescence images were confirmed and quantified in 96-well plates. Each padlock DNA corresponding to different target miRNAs was placed in each well for miRNA annealing, ligation and subsequent RCA reactions. As described above, after RCA, RCA products are mixed with FITC-labeled PNA (F-PNA) and annealing between RCAP and F-PNA can occur. An aliquot of each reaction mixture was transferred to a 96-well plate containing GO (5 [mu] g / mL). The RCT and F-PNA sets for each miRNA detection were arranged according to the different rows. Single or mixed miRNA samples were tested for detection in each column and fluorescence intensity was visualized using a fluorescence imaging system (Figure 8c). Strong fluorescence signals were selectively observed in the wells containing the target miRNAs that were amplified and hybridized with the corresponding F-PNAs. However, the fluorescence of multiple well plates containing non-target miRNAs was quenched because no duplex was formed.

Additional tests were performed to distinguish high homology (1 or 2 nucleotide differences) miRNA sequences to confirm the specificity of the GO-based fluorescence detection method according to the present invention. At the binding site with the 5 'or 3' end of the padlock DNA template, a single base sequence mutation of the target miRNA was induced (miRNA21_G and miRNA21_A in Fig. 9A, respectively). Ligation and RCA were performed with miRNA21 or miRNA21 containing single nucleotide sequence mutations using RCT21. miRNA16 (non-target miRNA) was also used as a negative control.

As shown in Figure 9b, high molecular weight products were observed in the presence of wild-type miRNA 21, unlike the case of non-target miRNA 16 or miRNA 21 containing single nucleotide sequence mutations. RCAP occurred in the presence of each miRNA type and fluorescence was measured in 96-well plates with F-PNA21 complementary to miRNA21 alone. Strong fluorescence was observed only in wild-type miRNA21; Fluorescence of miRNA21 including single nucleotide sequence mutations appeared similar to that of miRNA 16 (Figure 9c). These results indicate that the target miRNAs are easily distinguished from other miRNAs with a single base difference. Therefore, the GO-based fluorescence detection method of the present invention can be applied to quantitative detection of high homology miRNA sequences.

Hereinafter, the present invention will be described in more detail with reference to examples. However, the following examples are intended to illustrate the present invention, and the scope of the present invention is not limited thereto.

<Examples>

1. Preparation of oligonucleotides

The RNA oligonucleotides used in the present invention (miRNA21, miRNA16, miRNA31 and miRNA155; see Table 1) were chemically synthesized (ST Pharm Co. Ltd., Seoul, Korea) and purified by HPLC and polyacrylamide gel electrophoresis . The DNA oligonucleotides (RCT21, RCT16, RCT31 and RCT155; see Table 1) and fluorescently labeled protein nucleic acids (PNA21, PNA16, PNA31, and PNA155) were chemically synthesized (Bionics, Seoul, Korea and PANAGENE, Daejeon, Korea, respectively) and further purified by PAGE.

Oligonucleotide (nts) The sequence (from 5 ' to 3 ') miRNA 16 (22) UAG CAG CAC GUA AAU AUU GGC G miRNA 21 (22) UAG CUU AUC AGA CUG AUG UUGE miRNA 31 (21) AGG CAA GAU GCU GGC AUA GCU miRNA155 (23) UUA AUG CUA AUC GUG AUA GGG GU RCT16 (62) Phosphate - ACG TGC TGC TA TAAC GAC GAG AAA GGG CTG CCA GAT ACT CTT CGC AAT TTT CGC CAA TAT TT RCT21 (62) Phosphate - CTG ATA AGC TAT AAC GAC GAG AAA GGG CTG CCA GAT ACT CTT CGC AAT TTT TCA ACA TCA GT RCT31 (61) Phosphate - GCA TCT TGC CTT AAC GAC GAG AAA GGG CTG CCA GAT ACT CTT CGC AAT TTT AGC TAT GCCA RCT155 (63) Phosphate - GAT TAG CAT TAA TAA CGA CGA GAA AGG GCT GCC AGA TAC TCT TCG CAA TTT TAC CCC TAT CAC The PNA 16 (22) FITC - CGC CAA TAT TTA CGT GCT GCTA The PNA 21 (22) FITC - TCA ACA TCA GTC TGA TAA GCTA PNA31 (21) ATTO550 - AGC TAT GCC AGC ATC TTG CCT
FITC - AGC TAT GCC AGC ATC TTG CCT PNA155 (23) Cy5 - ACC CCT ATC ACG ATT AGC ATT AA
FITC - ACC CCT ATC ACG ATT AGC ATT AA miRNA21_G (22) UAGCUUAUCAUACUGAUGUUGA miRNA21_A (22) UAGCUUAUCAGUCUGAUGUUGA The miR21_RT primer (44) CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTCAACATC The miR21_Forward primer (30) ACACTCCAGCTGGGTAGCTTATCAGACTGA miR21_Reverse primer (16) TGGTGTCGTGGAGTCG U6 small RNA_RT primer (20) AAAATATGGAACGCTTCACG U6 small RNA_Forward primer (32) CGCTTCGGCAGCACATATACTAAAATTGGAAC U6 small RNA_Reverse primer (28) GCTTCACGAATTTGCGTGTCATCCTTGC

2, GO and AFM (atomic force microscopy, atomic force microscope)

SKU-HCGO-W-175, Graphene Supermarket, Graphene Laboratories, Inc., Ronkonkoma, NY, USA) were purchased (Graphene oxide) prepared by Hummer method. AFM images were acquired by tapping at room temperature using a NanoScope V controller (Model: Bruker Multimode 8, Bruker AXS Inc., Madison, Wis., USA) with spring constant of 40 N / m and tip radius ) &Lt; = 8 nm. 10 μL of GO solution (10 g / mL) was used and placed on a silicon wafer cleaned by the piranha cleaning method. The samples were dried at room temperature. The scanning speed was set to a line frequency of 1.0 Hz, and the original image was extracted using a 256 × 256 pixel method.

3. Prototype of RCT DNA

The ligation reaction of RCT DNA was performed by adding 1 μL of 10X ligation buffer (660 mM Tris-HCl, pH 7.6, 66 mM MgCl ₂ , 100 mM DTT and 1 mM ATP), 1 μL of T4 DNA ligase , Tokyo, Japan), 1 μL of RCT DNA (1 μM), 1 μL of miRNA (1 μM) and 6 μL of distilled water. Before addition of T4 DNA ligand and ligation buffer, RCT and miRNA were heated at 85 ° C for 3 minutes, then slowly cooled to room temperature for 15 minutes. After addition of T4 DNA ligase and ligation buffer, the reaction mixture was incubated at 25 DEG C for 1 hour.

Then, 10 μL of the ligation mixture was incubated with 2 μl of exonuclease I (2 U / L, New England Biolabs, Ipswich, Mass., USA), 1.5 μL of 10 × nucleic acid end- 670 mM glycine-KOH, pH 9.5, 100 mM β-mercaptoethanol and 67 mM MgCl ₂ ) and 15 μL total volume to distilled water. After an additional incubation at 37 ° C for 15 minutes, the reaction was quenched by the addition of an equal volume of a gel-loading dye containing 25 mM NA ₂ EDTA and 8 M urea . The reaction product was visualized by SYBR Gold (Molecular Probes, Life Technologies, Eugene, OR, USA) in 15% (w / v) denaturing PAGE.

4. Conversion amplification (RCA)

The RCT ligation reaction was carried out in 10 μL reaction mixture containing ligation buffer, T4 DNA ligase and RCT21 (100 nM) and miRNA, respectively. Before addition of T4 DNA ligand and ligation buffer, RCT and miRNA were heated at 85 ° C for 3 minutes, then slowly cooled to room temperature for 15 minutes. After addition of T4 DNA ligase and ligation buffer, the reaction mixture was incubated at 25 ° C for 1 hour and 2 μL of 10 × RCA reaction buffer (500 mM Tris-HCl, pH 7.5, 100 mM MgCl ₂ , 100 mM ₄ ) ₂ SO ₄ and 40 mM DTT), 1 μL of BSA (2 mg / mL), 6 μL of dNTP mix (each 2.5 mM dNTP) and 1 μL of phi29 DNA polymerase (5 U / μL, New England Biolabs ) Was prepared and mixed with 10 μL of ligation reaction mixture (total volume 20 μL). The RCA reaction was carried out at 30 &lt; 0 &gt; C for 90 minutes, followed by heating to 65 &lt; 0 &gt; C for 10 minutes and then terminated. The RCA product (RCAP) was analyzed by 1% agarose gel electrophoresis (Figure 2a) and the DNA band visualized via ethidium bromide (Figure 2b).

5. Fluorescence Extinction Analysis of GO by Fluorescence Analysis

50 μL reaction containing 5 μL of fluorescently labeled PNA (F-PNA; 1 μM), 5 μL of 10 × GO binding buffer (50 mM MgCl ₂ and 200 mM Tris-HCl, pH 7.5) and 40 μL of distilled water The solution was prepared and mixed. Fluorescence emission of the reaction solution was measured by using a spectrofluorophotometer (Model RF-53-1PC; Shimadzu Inc., Kyoto, Japan) at a wavelength range of 500 to 600 nm with excitation at 495 nm. Changes in the emitted spectra were done after addition of 10 ug / mL GO to the reaction solution containing F-PNA (100 nM) and GO binding buffer. To demonstrate the specificity of the GO-based fluorescent miRNA detection method, ligation and RCA reactions were performed in a reaction mixture containing miRNA (100 nM) and RCT (100 nM). Long extensions of single-stranded DNA (RCAP21 and RCAP16) are the results from RCA of miRNA 21 and miRNA 16, respectively. As a negative control, the same ligation and RCA reaction was performed with 100 nM of RCT21 in the absence of target miRNA21. 3 μL of the RCAP reaction mixture, 5 μL of F-PNA21 (1 μM) and 7 μL of distilled water were each hybridized by first heat-treating at 85 ° C. for 3 minutes and slowly cooling to room temperature for 15 minutes. Each 15 μL of the RCAP / F-PNA hybridization reaction mixture was supplemented with a solution containing 10 μL of GO (50 μg / mL), 5 μL of 10 × GO binding buffer and 20 μL of distilled water (total volume 50 μL) . Additional incubation was performed for 20 min at 25 ° C and spectral emission of the mixture (50 μL) was measured using a fluorescence spectrophotometer (Model RF-5301PC) in the wavelength range of 500-600 nm with excitation at 495 nm (Fig. 2C).

6. Optimized concentration of GO for fluorescence quenching of probe PNAs

Ligation and RCA reactions were performed in a reaction mixture containing 10 nM miRNA and 100 nM RCT as described above. The synthesized RCAP hybridized with 100 nM F-PNA. The 15 μL RCAP / F-PNA hybridization mixture contained 35 μL of GO solution at various concentrations (0, 3, 5, 10, 20, 30 and 50 μg / mL final concentration), GO binding buffer (20 mM Tris- HCl, pH 7.5, 5 mM MgCl 2) and transferred to each well of a 96-well plate containing distilled water. After incubation at 25 ° C for 20 minutes, fluorescence was measured with a multilabel plate reader (VICTOR X3; PerkinElmer, Waltham, Mass., USA) at an excitation wavelength of 485 nm and an emission wavelength of 535 nm.

7. Fluorescence measurement according to miRNA concentration change

(0, 1, 5, 100 and 500 fM; 1, 50, 100 and 500 pM; 1, 5 and 10 nM) concentrations to assess the sensitivity of the GO-based miRNA detection system. Lt; / RTI &gt; (Fig. 4). The sensitivity of the GO-based miRNA detection method was also determined by the addition of 100 nM of RCT21 and concentration (0, 1, 5, 100 and 500 fM; 1, 50, 100 and 500 pM; 5 and 10 nM) (Fig. 5). Total cellular RNA was extracted from lung cancer cells (A549 cells) lysed using TRIzol ^® solution (Invitrogen, Carlsbad, CA, USA). Ligation and RCA reactions were performed and the RCAP mixture was hybridized with 100 nM F-PNA as described above. The RCAP / F-PNA hybrid reaction mixture (15 μL) was supplemented with a solution containing 5 μL of GO (50 μg / mL), 5 μL of 10 × GO binding buffer and 25 μL of distilled water (total volume 50 μL). After additional incubation at 25 캜 for 20 minutes, the spectral emission of the mixture (50 μL) was scanned using a fluorescence spectrophotometer (Model RF-5301PC) at an excitation wavelength of 495 nm.

8. qRT-PCR analysis for miRNA detection

For the detection of miRNA21, stem-loop RT-PCR was performed. Reverse transcription (RT) was performed using each kit (PrimeScript ^™ 1 ^st Strand cDNA Synthesis Kit, Takara Bio Inc., Shiga, Japan) and (Rotor-Gene SYBR Green PCR Kit, Qiagen, Hilden, Germany) And quantitative real-time PCR (qRT-PCR). Total RNA was extracted from A549 cells using TRIzol reagent (Invitrogen) and the synthesized miRNA21 was mixed at various concentrations (0 and 5 fM; 0.1, 5, 50 and 500 pM; 5, 10, 50 and 100 nM) . A mixture of A549 total RNA (1 μg) and various concentrations of miRNA21 were reverse transcribed using a kit (PrimeScript ^™ 1 ^st Strand cDNA Synthesis Kit) according to the manufacturer's instructions. qRT-PCR was performed with forward primer (0.5 μM), reverse primer (0.5 μM) and 2 μL cDNA in the system (real-time thermocycler Rotor-gene Q system, Qiagen). The reaction mixture was incubated for 5 minutes at 16 DEG C and 45 cycles were performed at 95 DEG C for 5 seconds, 60 DEG C for 10 seconds, and 72 DEG C for 1 second. Relative strength was assessed and normalized by the expression of U6 snRNA (FIG. 6A). The primers of miRNA21 and U6 snRNA are shown in Table 1.

9. Characterization of RCT DNA and F-PNA in GO-based fluorescent miRNA detection system

To characterize the GO-based miRNA detection system, several miRNAs (miRNA21, miRNA16, miRNA31 and miRNA155) were prepared. RCT sequences and PNA probes were matched with various fluorophores designed for amplification and detection of other miRNAs (see Table 1). The various fluorophore was used to label the probe _{PNA {FITC (λ ex = 495} nm and _{λ em = 519 nm), ATTO550} (λ ex = 554 nm and λ _em = 576 nm) and Cy5 (λ _ex = 650 nm and? _em = 670 nm). The fluorescent ends labeled the 5 'ends of PNA21, PNA31 and PNA155, respectively. To evaluate the characteristics of RCT, a mixture of miRNAs (miRNA21, miRNA31 and miRNA155, respectively 10 nM) was incubated with a mixture of one or more of ligation or RCT (RCT21, RCT31 and RCT155, 100 nM each) (Fig. 8A). As a negative control, RCT16 (100 nM) was added to the reaction mixture containing a mixture of miRNAs except miRNA16. Ligation and RCA reactions were performed in multiwell-plate conditions as described above. An aliquot (3 μL) of RCAP was then hybridized with F-PNA (FITC-PNA21, ATTO550-PNA31 and Cy5-PNA155, respectively). The properties of F-PNA in the GO-based miRNA detection method are also shown in the following table: FITC-PNA21 (50 nM), ATTP550-PNA31 (50 nM) and Cy5-PNA155 (50 nM) (Fig. 8B). RCAP21, RCAP16, RCAP31 and RCAP155 were synthesized using a pair of corresponding RCT DNA and miRNAs. One or more mixed RCAPs (RCAP21, RCAP31 and RCAP155) were hybridized with F-PNA using a mixture of F-PNAs. As a negative control, RCAP16 was added to the reaction mixture containing a mixture of F-PNA (complementary to miRNA 16) except F-PNA16. The RCAP / F-PNA hybrid reaction mixture (15 μL) was then transferred to each well of a 96-well plate containing 35 μL of GO solution (5 μg / mL), GO binding buffer and distilled water. After incubation for 20 min at 25 ° C, fluorescence was measured with a multilabel plate reader (VICTOR X3; PerkinElmer, Waltham, Mass., USA).

10. Multiple detection in GO-based fluorescent miRNA detection

For multiple detection, four F-PNA probes were prepared. The FITC fluorophore labeled the 5 'end of the PNA16, PNA21, PNA31 and PNA155 sequences complementary to miRNA16, miRNA21, miRNA31 and miRNA155, respectively. One or more miRNAs (miRNA16, miRNA21, miRNA31 and miRNA155, 10 nM each) were mixed and ligated with each RCT (100 nM). After ligation, RCA was performed with ligation products. Then, 3 μL of the RCAP reaction mixture was incubated with 5 μL of FITC-PNA probe (1 μM), and 7 μL of distilled water, incubated for 3 minutes at 85 ° C. for the first heat treatment, then slowly cooled to room temperature Lt; / RTI &gt; Each RCAP reaction mixture using RCT21, RCT31 or RCT155 was probed as described above with FITC-PNA21, FITC-PNA31 or FITC155, respectively. Then, 15 μL of RCAP / F-PNA hybridization mixture was transferred into each well of a 96-well place containing 35 μL of GO solution (5 μg / mL). After 20 min incubation at 25 ° C, fluorescent images of 96-well plates were obtained using a fluorescence imaging system (IVIS-Lumina II; Caliper Life Sciences, Hopkinton, MA, USA) (FIG.

11. Characterization of GO-based fluorescent miRNA detection systems using miRNAs containing single nucleotide sequence variants

A variant of miRNA 21, containing a single base sequence variation of the 5 ' or 3 ' terminal binding site in the RCT sequence, was prepared (see Table 1). Ligation and RCA reactions were performed using RCT21 (100 nM) in the presence of wild type miRNA21 (10 nM) or a miRNA 21 variant containing a single nucleotide sequence variation (100 nM) as described above (Fig. 9A). As a control experiment, miRNA16 (10 nM) was used in RCT21 in the same reaction. The RCA product DNA band was visualized with ethidium bromide using 1% agarose gel electrophoresis (Fig. 9b). For fluorescence detection, the RCA product was hybridized to F-PNA21 (100 nM) and the hybrid was mixed with the GO solution (5 μg / mL) in a 96-well plate as described above. After 20 minutes of incubation at 25 ° C, fluorescence was measured with a multi-label plate reader (VICTOR X3) at excitation wavelength 485 nm and emission wavelength 535 nm (FIG. 9c).

Claims (12)

a) preparing single-stranded DNA by isothermal amplification of the target miRNA through a round-trip amplification method;
b) mixing a fluorescently labeled PNA probe with a sample comprising said single stranded DNA;
c) adsorbing the PNA probe not bound to the single stranded DNA to 10 μg / mL oxidized graphene after the mixing; And
d) measuring the fluorescence expression of the sample and selecting the sample containing the miRNA
Wherein the nucleotide sequence of the miRNA is from about 1 to about 25 nucleotides.
A detection method according to claim 1, characterized in that the target miRNA is hybridized to a primer in a recursive template, padlock probe DNA, complementarily designed to the target miRNA for round-trip amplification of step a) .
2. A detection method according to claim 1, wherein phi29 DNA polymerase is used for DNA polymerization in the round-trip amplification of step a).
delete The method according to claim 1, wherein said fluorescently labeled PNA probe is labeled with a fluorophore selected from the group consisting of FITC, ATTO550 and CY5.
2. The detection method according to claim 1, wherein the miRNA is quantitatively detected, and the detection limit of the miRNA is 0.4 pM.
delete delete delete delete delete delete

Images