KR101857260B1 - strains introduced polynucleotide encoding mutant ascorbate peroxidase derived laver that increase resistance to oxidative stress and lipid production methods using the same - Google Patents

Abstract

The present invention relates to isolated polynucleotide encoding polypeptide which increases resistance to oxidative stress; a recombinant vector containing the polynucleotide; a host cell transformed with the recombinant vector; and a production method of lipid using the host cell.

Description

[0001] The present invention relates to a strain derived from a Kim-derived mutant ascorbate peroxidase polynucleotide, which increases resistance to oxidative stress, and a method for producing lipid using the polynucleotide encoding mutant ascorbate peroxidase the same}

The present invention provides a recombinant vector comprising an isolated polynucleotide encoding a Kim derived mutant ascorbate peroxidase polypeptide that increases resistance to oxidative stress, a recombinant vector comprising the polynucleotide, a host cell transformed with the recombinant vector, And a method for producing lipid using the host cell.

Faced with exhaustion of global fossil fuels and global warming in recent years, with the aim of promoting environmentally friendly use of renewable energy such as bio, hydrogen, and solar energy in developed countries including the United States, Supply and use. Although Korea is making a lot of efforts to develop new and renewable energy, it is currently in the research stage. Bio-energy is renewable and has the advantage of reducing the acceleration of global warming by fixing carbon dioxide. Currently, bioethanol, bio-butanol and biodiesel are being actively studied.

Among the above-mentioned bioenergies, biodiesel is one of the most actively studied. Biodiesel is produced by transesterification of fatty acids contained in biomass into methyl ester or ethyl ester forms. It has a flash point of 150 and therefore has a flash point of 64 Because it is more stable than low volatility gasoline (45) at low temperatures, it is classified as a non-flammable liquid, and the stability is higher because it is ignited at high temperatures. In addition, unlike light oil, biodiesel is known to be a nontoxic energy with significantly lower emissions of harmful gases that cause carcinogens and mutations when burned, and significantly lower emissions.

It is known that such biodiesel can be produced biologically using microalgae. Microalgae are used for feed or fertilizer because of the use efficiency of solar energy about 25 times higher than plants. Especially Spirulina sp., Chlorella sp., Dunaliella sp. And Nostoc sp. Are also used as health foods. Since these microalgae have excellent utilization efficiency of solar energy, microalgae having high lipid content can be used as biomass for the production of biodiesel.

Botryococcus sp. And Schiochytrium sp. Are known microalgae having excellent lipid content. Although the microalgae do not have a high lipid content in a normal living environment, When a certain period of time elapses from the state, it shows a property of accumulating lipids in the cells.

In order to increase the lipid content of the microalgae, the microalgae may be cultured and proliferated. In the first step, the microalgae may be used as biomass for the production of biodiesel, A second step of increasing the intracellular lipid content must be performed. However, since the second step requires an excessive time, it can not be used for industrial production of biodiesel until now. Therefore, Development of microalgae with excellent lipid content for the production of biodiesel is urgently required.

In particular, microalgae used for biodiesel production are lacking in research on the metabolism characteristics of cells, and thus target gene selection for increasing lipid productivity is needed. In other words, there is a lack of prior research on which gene should be amplified to develop a recombinant strain having an increased lipid content.

Therefore, the present inventors confirmed that when overexpressing ascorbate peroxidase derived from Kim, the lipid content increases in over-expressed recombinant strains, and the present invention has been completed.

It is therefore an object of the present invention to provide isolated polynucleotides encoding polypeptides that increase resistance to oxidative stress.

Another object of the present invention is to provide a recombinant vector comprising the polynucleotide.

It is still another object of the present invention to provide a host cell transformed with the recombinant vector.

It is still another object of the present invention to provide a method for producing lipid using the host cell.

The present invention relates to an isolated polynucleotide encoding a polypeptide that increases resistance to oxidative stress, a recombinant vector comprising the polynucleotide, a host cell transformed with the recombinant vector, and a method of producing a lipid using the host cell .

The inventors of the present invention have developed Py501G, which has increased ascorbate peroxidase (APX) activity by using irradiation. Therefore, the present inventors analyzed the antioxidant gene APX characteristics through wild-type radiation patterning and radiation-induced radiation pattern Py501G, and found that the antioxidant gene APX was transformed into Chlamydomonas reinhardtii, .

As a result, it was confirmed that the APX gene of radiation-induced Py501G was more resistant to stress, and it was confirmed that the gene could be cultured under stress environmental conditions by applying this gene to various seaweeds. Ascorbate peroxidase the inventors of the present invention have confirmed that the lipid content of recombinant Clamidomonas reinhardtii expressing the ascorbate peroxidase (APX) gene is higher than that of a control group that does not express the gene, .

Radiation-induced Mutant Radiation Pattern The ascorbate peroxidase (APX) gene derived from Py501G showed a higher antioxidative activity than the wild-type radiation pattern not irradiated with radiation. Therefore, the recombinant microalga clomidomonas line hard The tea shows excellent growth in an oxidative stress environment and is expected to be utilized for mass production of metabolites such as lipids and starch.

Hereinafter, the present invention will be described in more detail.

One aspect of the invention relates to a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 3.

Variety of environmental stresses, decreases the growth by reducing the photosynthetic capacity of the plants decrease in carbon assimilation rate is by increasing the oxygen flow in the photosynthetic electron ever radicals to (O ^2.-); the production of (Reactive pxygen species ROS) Thereby accelerating the oxidative stress of the plant.

The induction of antioxidant defense mechanism is known to be a strategy to cope with the increased oxidative stress caused by environmental stress.

Ascorbate peroxidase (APX), which acts as an enzyme that eliminates H2O2 through the action of superoxide dismutase (SOD) in plants, is present in chloroplasts, mitochondria, cytoplasm and cell walls, and ascorbate- glutathione is the most important peroxidase in the deoxidation of H2O2, which is reduced by ascorbic acid in the first stage of the cycle, and reacted in various stress conditions including temperature, And has the ability to avoid oxidative damage.

The polynucleotide is an isolated polynucleotide that encodes a polypeptide that increases resistance to oxidative stress.

The polynucleotide may comprise the nucleotide sequence of SEQ ID NO: 3, for example, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3.

The polypeptide that increases the resistance to oxidative stress may include the amino acid sequence of SEQ ID NO: 4, for example, the amino acid sequence of SEQ ID NO: 4.

Another aspect of the invention relates to a recombinant vector comprising a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3.

The term "vector" means means for expressing a gene of interest in a host cell. For example, viral vectors such as plasmid vectors, cosmid vectors and bacteriophage vectors, adenovirus vectors, retroviral vectors and adeno-associated viral vectors.

The vector that can be used as the recombinant vector may be a plasmid (for example, pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8 / 9, pUC6, pBD9, pHC79, pIJ61, pLAFR1, pHV14 , pGEX series, pET series and pUC19, etc.), phage (e.g.,? gt4? B,? -charon,?? z1 and M13 or the like) or virus .

The recombinant vector can typically be constructed as a vector for cloning or as a vector for expression. The expression vector may be any conventional vector used in the art to express an exogenous protein in plants, animals or microorganisms.

In addition, the recombinant vector can be constructed through various methods known in the art.

The recombinant vector may be constructed with prokaryotic or eukaryotic cells as hosts. For example, when the vector used is an expression vector and the prokaryotic cell is used as a host, a strong promoter capable of promoting transcription (for example, pL? Promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7 Promoter, etc.), a ribosome binding site for initiation of translation, and a transcription / translation termination sequence. When a eukaryotic cell is used as a host, the origin of replication that functions in eukaryotic cells contained in the vector includes f1 replication origin, SV40 replication origin, pMB1 replication origin, adeno replication origin, AAV replication origin, and BBV replication origin But is not limited thereto.

Also, promoters derived from the genome of mammalian cells (e.g., metallothionein promoter) or mammalian viruses (e.g., adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, The cytomegalovirus promoter and the tk promoter of HSV) can be used and generally have a polyadenylation sequence as a transcription termination sequence.

For example, a polynucleotide sequence encoding a polypeptide that increases resistance to oxidative stress may be a polynucleotide sequence that encodes a peptide comprising the amino acid sequence of SEQ ID NO: 4, for example, 3 < / RTI >

Alternatively, the polynucleotide may comprise a nucleotide sequence having substantial identity to the nucleotide sequence of SEQ ID NO: 3.

The substantial identity is determined by aligning each nucleotide sequence with any other nucleotide sequence to the greatest extent possible and analyzing the sequence to determine whether any of the other nucleotide sequences is at least 70%, at least 90% % Or more of sequence homology.

Another aspect of the invention relates to a host cell transformed with said recombinant vector.

In one example of the present invention, a transformant having improved fat-producing ability can be prepared by inserting an expression vector into which a target protein is inserted into a host cell. The transformant can be obtained by introducing the recombinant vector into an appropriate host cell . The host cell may be any host cell known in the art as a cell capable of continuously cloning or expressing the expression vector stably.

The host cells used in the present invention may include E. coli, yeast, animal cells, plant cells, or insect cells. Examples of prokaryotic cells include E. coli JM109, E. coli BL21, and E. coli BL21. Bacillus sp. strains such as E. coli RR1, E. coli LE392, E. coli B, E. coli X1776, E. coli W3110, Bacillus subtilis, and Bacillus thuringiensis, and Salmonella typhimurium, Serratia marcesensis Yeast (insect cells, plant cells and animal cells, for example, Sp2 / 0, CHO (Chinese), and yeast (Saccharomyces cerevisiae) are used as host cells when transforming eukaryotic cells. However, the present invention is not limited thereto. For example, there may be used Clamidomonas spp. strains, such as hamster ovary K1, CHO DG44, PER.C6, W138, BHK, COS7, 293, HepG2, Huh7, 3T3, RIN, Rhin Hard Tea ( Chlamydomonas reinhardtii ).

The delivery (introduction) of the polynucleotide or the recombinant vector containing the polynucleotide into a host cell can be carried out by a method well known in the art. For example, when the host cell is a prokaryotic cell, the CaCl ₂ method or the electroporation method can be used. When the host cell is a eukaryotic cell, the microinjection method, the calcium phosphate precipitation method, the electroporation method, Liposome-mediated transfection, and gene bombardment, but the present invention is not limited thereto.

The method of selecting the transformed host cells can be easily carried out according to a method widely known in the art by using a phenotype expressed by a selection marker. For example, when the selection mark is a specific antibiotic resistance gene, the transformant can be easily selected by culturing the transformant in a medium containing the antibiotic.

The transformed host cell of the present invention may have enhanced resistance to oxidative stress by introducing ascorbate peroxidase (APX) of the radiation-induced mutant radiolabel Py501G.

The host cell may be a cell of an algae, for example, Chlamydomonas reinhardtii .

Thus, the host cells of the invention induced excellent activating radiation than in passing wild-type radiation pattern mutation radiation pattern resistance in an oxidative environment using a ascorbyl bait peroxidase Kim Py501G enhanced recombinant Chlamydomonas line hard Ti (Chlamydomonas reinhardtii ).

The host cell has a higher lipid content than the control without the polynucleotide containing the nucleotide sequence of SEQ. ID. NO: 3, thereby significantly increasing the production of biodiesel, for example, by 30% or more, 25% Or more, 20% or more, 15% or more, 10% or more, for example, 23% or more. Therefore, the recombinant Clamidomonas reinhardtii has a higher lipid content than the control group that does not express the gene, and can be utilized for production of biodiesel in the future.

Another aspect of the present invention relates to a method for producing lipids using the transformed host cells.

The lipid production method comprises culturing a host cell transformed with a recombinant vector comprising a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 3; And a recovery step of recovering lipid.

The culturing may be performed at 10 to 30 ° C, at 15 to 30 ° C, at 10 to 25 ° C, at 15 to 25 ° C, and preferably at 20 ° C, but is not limited thereto.

The culturing step may be carried out at a temperature of 7 to 28 days, 9 to 28 days, 11 to 28 days, 13 to 28 days, 7 to 26 days, 9 to 26 days, 11 to 26 days, 13 to 26 days, 7 to 24 days, 9 13 to 22 days, 7 to 20 days, 9 to 20 days, 11 to 20 days, 13 to 24 days, 11 to 24 days, 13 to 24 days, 7 to 22 days, 9 to 22 days, 7 to 18 days, 7 to 18 days, 9 to 18 days, 11 to 18 days, 13 to 18 days, 7 to 16 days, 9 to 16 days, 11 to 16 days, 13 to 16 days, Preferably 14 days, but is not limited thereto.

Wherein the recovering step comprises lyophilizing the host cell; Extracting the lyophilized host cell with a solvent; And centrifuging the extract.

In addition, the recovering step may further include a separation step of centrifuging before the drying step. The separation step has an effect of separating the host cell and the culture medium.

The drying may be performed at -70 to -20 ° C, -70 to -30 ° C, -70 to -40 ° C, -70 to -50 ° C, -70 to -60 ° C, for example, But the present invention is not limited thereto.

The drying step may be performed for 12 to 48 hours, 12 to 42 hours, 12 to 26 hours, 12 to 30 hours, 18 to 48 hours, 18 to 42 hours, 18 to 26 hours, 18 to 30 hours And may be, for example, performed for 24 hours, but is not limited thereto.

The extraction step may be carried out at a temperature of 10 to 60 캜, 15 to 60 캜, 20 to 60 캜, 10 to 55 캜, 15 to 55 캜, 20 to 55 캜, 10 to 50 캜, 15 to 35 DEG C, 20 to 35 DEG C, 10 to 30 DEG C, 15 to 35 DEG C, 15 to 45 DEG C, 20 to 45 DEG C, 10 to 40 DEG C, 15 to 40 DEG C, 20 to 40 DEG C, At 30 ° C, 20 to 30 ° C, and may be performed at, for example, 25 ° C, but is not limited thereto.

The extraction step may be performed for 0.5 to 10 hours, 0.5 to 9 hours, 0.5 to 8 hours, 0.5 to 7 hours, 0.5 to 6 hours, 0.5 to 5 hours, 0.5 to 4 hours, 0.5 to 3 hours, 0.5 to 2 hours And may be, for example, performed for 1 hour, but is not limited thereto.

The solvent may be an inorganic solvent or an organic solvent, but is not limited thereto.

The solvent may be chloroform, methanol or a mixture thereof. In case of a mixture, the volume ratio of chloroform and methanol may be 2: 1, but is not limited thereto.

The centrifugation is carried out at a temperature of 4 to 20 캜, 6 to 20 캜, 8 to 20 캜, 4 to 18 캜, 6 to 18 캜, 8 to 18 캜, 4 to 16 캜, At 14 ° C, 6-14 ° C, 8-14 ° C, 4-12 ° C, 6-12 ° C, 8-12 ° C, and may be carried out at, for example, 10 ° C, It is not.

The centrifugation may be performed at a temperature of 4000 to 12000 rpm, 4000 to 11000 rpm, 4000 to 10000 rpm, 4000 to 9000 rpm, 5000 to 12000 rpm, 5000 to 11000 rpm, 5000 to 10000 rpm, 5000 to 9000 rpm, , 6000 to 11000 rpm, 6000 to 10000 rpm, 6000 to 9000 rpm, 7000 to 12000 rpm, 7000 to 11000 rpm, 7000 to 10000 rpm, 7000 to 9000 rpm and may be performed at, for example, 8000 rpm , But is not limited thereto.

The centrifugation may be performed for 10 to 50 minutes, 10 to 45 minutes, 10 to 40 minutes, 10 to 35 minutes, 10 to 30 minutes, 10 to 25 minutes, 15 to 50 minutes, 15 to 45 minutes, 15 to 40 minutes , 15 to 35 minutes, 15 to 30 minutes, 15 to 25 minutes, and may be carried out, for example, for 20 minutes, but is not limited thereto.

The chloroform layer obtained after the centrifugation may be further concentrated with nitrogen to remove chloroform and methanol.

The present invention relates to an isolated polynucleotide encoding a polypeptide that increases resistance to oxidative stress, a recombinant vector comprising the polynucleotide, a host cell transformed with the recombinant vector, and a method of producing a lipid using the host cell More specifically, the present invention relates to an ascorbate peroxidase (APX) gene obtained from a radiolabeled Py501G gene, which is superior in expression of ascorbate peroxidase (APX) And to a recombinant clamidomonas line hardtype using the same. More particularly, the present invention relates to a recombinant clamidase comprising an ascorbate peroxidase (APX) obtained from a mutant radiolabeled Py501G as compared with a recombinant strain containing wild-type ascorbate peroxidase Monas Rhinhardt strain shows resistance to oxidative stress superior to wild type in oxidative environment and can be used for the development of microalgae producing starch, lipid and the like.

FIG. 1 is a photograph showing that the ascorbate peroxidase (APX) gene of wild-type radiant stamens and radiation-induced radiolabeled Py501G according to an embodiment of the present invention is resistant to stress in the clamidomonas.
FIG. 2 is a graph showing the results of a recombinant clamydomonas line hard ( Chlamydomonas ) gene expressing an ascorbate peroxidase (APX) gene derived from radiolabelled Py501G according to an embodiment of the present invention. reinhardtii ) and the control group without gene expression.

Hereinafter, the present invention will be described in more detail with reference to the following examples. However, these examples are only for illustrating the present invention, and the scope of the present invention is not limited by these examples.

Example  One. Radiation pattern Kim culture

The radish pattern was distributed from the seaweed research center of the National Fisheries Research and Development Institute.

Specifically, MGM (Modified Grund Media) C10H14O6N2Na2 · 2H2O (Na2EDTA) the medium _{3.72g, FeSO 4 · 7H 2 O} 0.28g, Na 2 HPO 4 · 12H 2 O 10.74g, NaNO 3 42.5g, MnCl 2 · 7H 2 O and 1 mg of vitamin B12 (Cyanocobalamin) per liter of sterilized seawater.

Then, the radiolabelled wild type (comparative example) and radiolabelled Py501G (example) were put into MGM medium, respectively, and added to a plant culture dish (100 X 40 mm) in a volume of 100 mL, 20 umol photon m-2s-1, 12:12 Light: Dark cycle, temperature 12 占 폚.

Example  2. RNA extraction and cDNA synthesis

Wild-type radish and Radiation-induced Mutant Radiation Patterns 100 mg of Py501G-treated thalli were treated with liquid nitrogen and finely ground into a sterilized mulberry bowl. RNA purification kit (RNA purification kit) were used, after the QIAGEN RNeasy Mini kit ^ⓡ, into the tissue is powdered in 1.5mL 100mg micro Sentry fuse (micro centrifuge) tube into a 450 uL Buffer RLT stirring, QIAshredder spin columns ( spin column) and centrifuged at 15000 rpm for 2 minutes.

Next, 200 uL of ethanol was added to the separated buffer, and the mixture was applied to an RNeasy spin column, followed by centrifugation at 8000 g for 15 seconds. The distilled buffer was removed and the column was washed with 700 uL RW1 buffer for 15 sec> 8000 g, then the distant buffer was removed and washed twice with 500 uL RPE buffer for 15, 2 min> 8000 g. The column was transferred to a new 1.5 mL microcentrifuge tube and 30-50 uL of RNase-free water was added and centrifuged at 8000 g for 1 min to obtain individual RNA samples.

Set the Biodrop (Biochrom, Germany) to an absorbance absorbance of 230 nm and a wavelength of 280 nm, and place 2 μL of RNase-free water in the spot and hold the base. 2 μL of the above RNA sample was spotted, RNA quantification value was confirmed through an absorbance of 260 nm, and 2 μL of the wild-type radiant fringe and the radiation-induced radiant fringing pyrometer Py501G were respectively quantified.

The quantified 2 uL RNA samples were synthesized using Transcriptor Fiest Strand cDNA Synthesis Kit (Roche, Germany). Specifically, each 2 uL RNA sample that had been quantified was incubated with oligo-dTUuL and DEPC-water at a total of 13 uL for 10 minutes at 65 ° C. After treatment, 4 uL of RT reaction (5x), 1 uL of reverse transcriptase, 0.5 uL of RNase inhibitor and 2 uL of DNTP were added and incubated at 50 ° C for 60 min and 85 ° C for 5 min, Were synthesized.

Example  3. At the Clamidomonas  Confirm oxidation resistance

Wild type radiolytic and radiolabeled radiation pattern Radiation pattern It was confirmed whether ascorbate peroxidase (APX) gene of Py501G imparts oxidation tolerance in algae clamidomonas.

Specifically, the APX gene was PCR-amplified using the wild-type radiolabeled and radioliganded Py501G total RNA and the primer pair shown in the following Table 1, and then the vector pChlamy_1 / D of the GeneArt ^ⓡ Chlamydomonas TOPO ^ⓡ Engineering Kits (A14264) -TOPO was used to express the APX gene.

SEQ ID NO: denomination Sequence listing (5 '-> 3') Remarks (Gene) 5 Py_CAP_Ch-to_F1 CACCGTGTCTGACCTGGAGAAGGCGGTCCGCGCC Cytosolic ascorbate peroxidase
(APX) 6 Py_CAP_Ch-to_F2 TCACGCCCAAACCGCGCCCAACTCACTCA

Since the vector pChlamy_1 / D-TOPO has a hygromycin resistance gene, the wild type Chlamydomonas transformed with a gene pulse (Bio-Rad) on a strain of reinhardtii C137, cultured for 2 to 3 weeks, and then transformed with a 15 mg / L hygromycin-supplemented medium to obtain a transformant.

Then, the wild-type radiation pattern. Kim and radiation induced radiation pattern Kim Py501G concentration The inoculated solution was diluted with 10 of 10 ^-3 to 10 ^-5 / mL body of APX is introduced transgenic uL of hydrogen peroxide concentration treatment by solid medium And incubated at 28 ° C for 5 days. The growth of the cells was observed and the results are shown in FIG.

In FIG. 1, C137 is a wild type strain, C_vector is a wild type strain and pThlamy_1 / D-TOPO vector is introduced into a wild type strain. WT-APX is a strain in which ascorbate peroxidase (APX) Radiation-induced radiation pattern Kim Py501G This shows a strain that has introduced ascorbate peroxidase (APX).

As can be seen in FIG. 1, C137 and C_vec strains were almost killed when treated with 7 mM hydrogen peroxide, and strains inserted with WT-APX and MT-APX showed higher growth. In addition, the MT-APX strain exhibited higher growth than the WT-APX strain, confirming that the APX gene of the radiation-induced radiolabeled Py501G had a higher resistance to oxidative stress.

Example 4. Comparison of lipid content of recombinant clamidomonas

Resulting from radiation pattern Kim Py501G ascorbyl bait peroxidase (ascorbate peroxidase, APX), and then brightness of 20 genes are the expressed recombinant Chlamydomonas hard line tee (Chlamydomonas reinhardtii) into the Modified bold`s Basal medium medium umol photon m ^{- 2} s ^-1 , 12:12 Light: Dark cycle, and the temperature was maintained at 20 ° C for 14 days. As a control, the recombinant Clamidomonas line hardtail containing WT-APX was compared with the Clamidomonas line hardtail not transfected.

The cultured strains were centrifuged at 100 rpm for 10 min at 6000 rpm to remove the culture medium, and then lyophilized for 24 hours at -70 ° C. Next, 15 g of lyophilized Clamidomonas line hard strain strains were added to 5 liters of solvent (Chloroform: methanol = 2: 1, v / v) and extracted at 25 캜 for 1 hour. ≪ / RTI > for 10 minutes. The chloroform layer obtained after centrifugation was concentrated by nitrogen, and chloroform (chloroform) and methanol were removed to separate lipids from Clamidomonas line hardness strains.

The lipid obtained from the above Clamidomonas line hard strain strains was subjected to saponification with 5 liters of a 100% ethanol solution in which 1 M KOH was dissolved, and then hexane: ethylether = 1: 1, v / v ). The methylation of the separated hexane: ethyl ether layer was carried out. The methylation was carried out by adding 1 liter of methanol with 5% H ₂ SO ₄ dissolved therein, reacting at 90 ° C. for 90 minutes, adding 1.5 liters of 0.9% NaCl, and then extracting 3 times with 3 liters of hexane. Then, the extracted hexane layer was concentrated by nitrogen, and the lipid content was analyzed. The results are shown in Table 2 and FIG. 2.

Strain Relative Lipid Content (%) C137 (Comparative Example 1) 100 WT-APX (Comparative Example 2) 104 MT-APX (Example) 123

As can be seen in Table 2 and FIG. 2, compared with the recombinant Clamidomonas line hardty including WT-APX and the untransformed Cladidomonas line hard, the ascorbate derived from the radiolabelled Py501G peroxidase, APX) gene expressing the recombinant Clamidomonas line hardty ( Chlamydomonas reinhardtii ) showed higher lipid content.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it will be understood by those of ordinary skill in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. It will be understood that the invention may be modified and varied without departing from the scope of the invention.

<110> INDUSTRY FOUNDATION OF CHONNAM NATIONAL UNIVERSITY <120> strains introduced polynucleotide encoding mutant ascorbate          peroxidase-derived laver that increases resistance to oxidative          stress and lipid production methods using the same <130> PN160431 <160> 6 <170> KoPatentin 3.0 <210> 1 <211> 729 <212> DNA <213> Artificial Sequence <220> <223> WT-APX <400> 1 atggtgtctg acctggagaa ggcggtccgc gccgacttgc aggcgctgat caaggagaag 60 aactgccatg gtatcatggt ccgggtggcg tggcacgacg cggggaccta ctccaaggag 120 gacggcaccg gcggcgccaa cggcacgcag cgctttgctc ctgagagtgg ccacggcgcc 180 aacgccgggc tagacattgc gcggaacatg tgcgaggaca tcaaggccaa gcaccccgag 240 atcagctacg cggacctcta ccagctcgcc tcggttgtgg cgattgagga tgctggtggc 300 ccggtcatcc ccttccgcat gggccgcaag gacgcggatg ccccgcagtg cacgcccgac 360 ggccgcctgc ccgacgcgga caagcgcatg ccccacctgc gcgacatctt ttaccggatg 420 ggctttaatg acgcggagat tgtggcgctc tcgggtgccc acacgctcgg cgccgcccac 480 aaggaccgca gcggctttga tggcccgtgg acgagcaacc cgaacacgtt tgacaactcg 540 tacttcaagg agattatgaa ggagacgccc gagtccggcc tgctgcatct gccgtcggac 600 aaggcgctgt tggatgagcc cgagtgcaag gccctggtgg agacgtacgc gtcggaccag 660 gccaagttct ttgaggacta cgccaaggcg caccagaagc tgagtgagtt gggcgcggtt 720 tgggcgtga 729 <210> 2 <211> 242 <212> PRT <213> Artificial Sequence <220> <223> WT-APX <400> 2 Met Val Ser Asp Leu Glu Lys Ala Val Arg Ala Asp Leu Gln Ala Leu   1 5 10 15 Ile Lys Glu Lys Asn Cys His Gly Ile Met Val Arg Val Ala Trp His              20 25 30 Asp Ala Gly Thr Tyr Ser Lys Glu Asp Gly Thr Gly Gly Ala Asn Gly          35 40 45 Thr Gln Arg Phe Ala Pro Glu Ser Gly His Gly Ala Asn Ala Gly Leu      50 55 60 Asp Ile Ala Arg Asn Met Cys Glu Asp Ile Lys Ala Lys His Pro Glu  65 70 75 80 Ile Ser Tyr Ala Asp Leu Tyr Gln Leu Ala Ser Val Val Ala Ile Glu                  85 90 95 Asp Ala Gly Gly Pro Val Ile Pro Phe Arg Met Gly Arg Lys Asp Ala             100 105 110 Asp Ala Pro Gln Cys Thr Pro Asp Gly Arg Leu Pro Asp Ala Asp Lys         115 120 125 Arg Met Pro His Leu Arg Asp Ile Phe Tyr Arg Met Gly Phe Asn Asp     130 135 140 Ala Glu Ile Val Ala Leu Ser Gly Ala His Thr Leu Gly Ala Ala His 145 150 155 160 Lys Asp Arg Ser Gly Phe Asp Gly Pro Trp Thr Ser Asn Pro Asn Thr                 165 170 175 Phe Asp Asn Ser Tyr Phe Lys Glu Ile Met Lys Glu Thr Pro Glu Ser             180 185 190 Gly Leu Leu His Leu Pro Ser Asp Lys Ala Leu Leu Asp Glu Pro Glu         195 200 205 Cys Lys Ala Leu Val Glu Thr Tyr Ala Ser Asp Gln Ala Lys Phe Phe     210 215 220 Glu Asp Tyr Ala Lys Ala His Gln Lys Leu Ser Glu Leu Gly Ala Val 225 230 235 240 Trp Ala         <210> 3 <211> 729 <212> DNA <213> Artificial Sequence <220> <223> Py500G-APX <400> 3 atggtgtctg agctggagaa ggcggtccgc gccgacttgc aggcgctgat caaggagaag 60 aactgccatg gtatcatggt ccgggtggcg tggcacgacg cggggaccta ctccaaggag 120 gacggcaccg gcggcgccaa cggcacgcag cgctttgctc ctgagagtgg ccacggcgcc 180 aacgccgggc tagacattgc gcggaacatg tgcgaggaca tcaaggccaa gcaccccgag 240 atcagctacg cggacctcta ccagctcgcc tcggttgtgg cgattgagga tgctggtggc 300 ccggtcatcc ccttccgcat gggccgcaag gacgcggatg ccccgcagtg cacgcccgac 360 ggccgcctgc ccgacgcgga caagcgcatg ccccacctgc gcgacatctt ttaccggatg 420 ggctttaatg acgcggagat tgtggcgctc tcgggtgccc acacgctcgg cgccgcccac 480 aaggaccgca gcggctttga tggcccgtgg acgagcaacc cgaacacgtt tgacaactcg 540 tacttcaagg agattatgaa ggagacgccc gagtccggcc tgctgcatct gccgtcggac 600 aaggcgctgt tggatgagcc cgagtgcaag gccctggtgg agacgtacgc gtcggaccag 660 gccaagttct ttgaggacta cgccaaggcg caccagaagc tgagtgagtt gggcgcggtt 720 tgggcgtga 729 <210> 4 <211> 242 <212> PRT <213> Artificial Sequence <220> <223> Py500G-APX <400> 4 Met Val Ser Glu Leu Glu Lys Ala Val Arg Ala Asp Leu Gln Ala Leu   1 5 10 15 Ile Lys Glu Lys Asn Cys His Gly Ile Met Val Arg Val Ala Trp His              20 25 30 Asp Ala Gly Thr Tyr Ser Lys Glu Asp Gly Thr Gly Gly Ala Asn Gly          35 40 45 Thr Gln Arg Phe Ala Pro Glu Ser Gly His Gly Ala Asn Ala Gly Leu      50 55 60 Asp Ile Ala Arg Asn Met Cys Glu Asp Ile Lys Ala Lys His Pro Glu  65 70 75 80 Ile Ser Tyr Ala Asp Leu Tyr Gln Leu Ala Ser Val Val Ala Ile Glu                  85 90 95 Asp Ala Gly Gly Pro Val Ile Pro Phe Arg Met Gly Arg Lys Asp Ala             100 105 110 Asp Ala Pro Gln Cys Thr Pro Asp Gly Arg Leu Pro Asp Ala Asp Lys         115 120 125 Arg Met Pro His Leu Arg Asp Ile Phe Tyr Arg Met Gly Phe Asn Asp     130 135 140 Ala Glu Ile Val Ala Leu Ser Gly Ala His Thr Leu Gly Ala Ala His 145 150 155 160 Lys Asp Arg Ser Gly Phe Asp Gly Pro Trp Thr Ser Asn Pro Asn Thr                 165 170 175 Phe Asp Asn Ser Tyr Phe Lys Glu Ile Met Lys Glu Thr Pro Glu Ser             180 185 190 Gly Leu Leu His Leu Pro Ser Asp Lys Ala Leu Leu Asp Glu Pro Glu         195 200 205 Cys Lys Ala Leu Val Glu Thr Tyr Ala Ser Asp Gln Ala Lys Phe Phe     210 215 220 Glu Asp Tyr Ala Lys Ala His Gln Lys Leu Ser Glu Leu Gly Ala Val 225 230 235 240 Trp Ala         <210> 5 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Py_CAP_Ch-to_F1 <400> 5 caccgtgtct gacctggaga aggcggtccg cgcc 34 <210> 6 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Py_CAP_Ch-to_F2 <400> 6 tcacgcccaa accgcgccca actcactca 29

Claims (12)

A polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3, wherein the isolated polynucleotide encodes a polypeptide that increases resistance to oxidative stress. 4. The isolated polynucleotide of claim 1, wherein the polypeptide comprises the amino acid sequence of SEQ ID NO: 4. A recombinant vector comprising a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4. Chlamydomonas reinhardtii transformed with the recombinant vector of claim 3. delete delete 5. The method of claim 4, wherein the Clamidomonas line hardty is for lipid production. A culturing step of culturing a host cell transformed with a recombinant vector comprising a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3; And
A recovery step of recovering lipid;
&Lt; / RTI &gt; 9. The method of claim 8, wherein the culturing step is performed at 10 to 30 &lt; 0 &gt; C. The method of claim 8, wherein the culturing step is performed for 7 to 28 days. 9. The method according to claim 8,
A step of lyophilizing the host cells;
An extraction step of extracting the lyophilized host cell by adding it to a solvent; And
A separation step of centrifuging the extract;
&Lt; / RTI &gt; 12. The method of claim 11, wherein the recovering step further comprises centrifuging the host cells prior to the drying step.

Images