KR101843873B1 - MybC promoter with root specific expression - Google Patents

Abstract

The present invention relates to a MybC promoter with root specific expression composed of a sequence represented by sequence number 1. The promoter with root specific expression composed of a sequence represented by sequence number 1 according to the present invention can express a target gene in root specific expression and has a characteristic of changing its expression under environmental stress. Therefore, it can also be used as a marker of environmental stress by detecting a change in the expression of root.

Description

Root-specific expression MybC promoter {MybC promoter with root specific expression}

The present invention relates to a root-specific expression promoter composed of the nucleotide sequence shown in SEQ ID NO: 1.

 In recent years, many studies to improve the characteristics of plants have been attracting much attention to techniques for obtaining useful purpose genes from transgenic plants. In order to express such useful genes in transgenic plants, gene expression A promoter is required to regulate the expression of the gene.

A promoter is a kind of regulatory region having a function of regulating the expression of a nucleotide sequence, that is, a nucleotide sequence that determines how and when a gene is to be expressed, and may be a promoter that induces expression constantly, Such as a promoter that induces the expression of the gene of interest, has been reported.

For example, there is a strong promoter capable of maximizing the expression level, which is a promoter used to maximize the expression level of the target gene, and has been widely used in the early stage of transformant studies. Representative examples include the 35S RNA gene promoter of cauliflower mosaic virus (CaMV 35S) and the rice actin gene promoter. They are mainly used for the purpose of production of antibiotic resistance genes used as selection markers in the transformation of plants, genes for inhibiting insect pests of plants, or plants.

Another example is a promoter that limits the timing of expression. This is a promoter that allows the expression of the gene of interest to be confined to a particular stage of the plant developmental stage. For example, the promoters of genes involved in flowering can express genes only during the flowering season, and the promoters of genes expressed by various biotic or abiotic stresses can be included in the timing-regulated promoters.

Another example is a tissue-specific promoter that limits expressed tissue. This is the promoters that are used to achieve the transfection purpose by limiting the expression of the desired gene only to specific tissues of the plant. Promoters that induce such tissue-specific expression have been actively studied for various tissues of plants according to various purposes to be used.

Such a tissue-specific promoter may be, depending on the tissue, a systemic expression-inducing promoter, a seed-specific expression-inducing promoter, a root-specific expression-inducing promoter, a leaf-specific expression-

Such seed, root or leaf-specific expression promoters are expected to be used for the purpose of improving agricultural traits, accumulating useful proteins, and producing useful substances in major crops used as food, food, or food raw materials. Among them, the root plays an important role in plant growth, water absorption and nutrient absorption. Despite the high interest in gene expression at the site, root-specific expression promoters have not been widely commercialized Therefore, there is a need for a novel promoter capable of inducing root-specific expression.

Therefore, the inventors of the present invention confirmed a root tissue-specific expression promoter while carrying out research on a promoter capable of inducing expression of a target gene specifically in roots without being expressed in other plant tissues, and completed the present invention.

Accordingly, it is an object of the present invention to provide a root-specific expression promoter, a vector containing the same, a transgenic plant, and a method for expressing a target gene in a root-specific manner.

In order to achieve the above object, the present invention provides a root-specific expression promoter consisting of the nucleotide sequence shown in SEQ ID NO: 1.

The present invention also provides a root-specific expression vector comprising the nucleotide sequence shown in SEQ ID NO: 1.

The present invention also provides a plant cell into which the promoter is introduced.

The present invention also provides a method for producing a plant cell, which comprises transforming a plant cell with a vector comprising the promoter and a target gene operably linked thereto; And a method for expressing a plant-root-specific expression of the target gene.

The present invention also provides a primer set for amplifying a root-specific promoter according to claim 1, which comprises an oligonucleotide represented by SEQ ID NO: 2 and an oligonucleotide represented by SEQ ID NO: 3.

The present invention also provides a method for producing a transgenic plant, comprising the steps of: preparing a transformed plant with a vector comprising the promoter represented by SEQ ID NO: 1 and a gene for detection operably linked thereto; And confirming a change in the expression of the detection gene in the root.

Since the root-specific expression promoter composed of the nucleotide sequence of SEQ ID NO: 1 according to the present invention is capable of expressing the target gene in a root-specific manner and the expression is changed in environmental stress, the expression of the expression in the root is detected And can also be used as a marker for environmental stress.

1 is a diagram showing a vector containing a root-specific expression promoter MybC gene (SEQ ID NO: 1).
FIG. 2A shows a control (Col-0) in which the MybC promoter was not introduced, a control group in which MybC promoter was introduced but no environmental stress (Control 1-3 and 8-1), MybC promoter was introduced, (ABA) and auxin-treated experimental group, the expression of root-specific expression and the expression level of GUS gene by the MybC promoter.
FIG. 2B is a graph showing the results of a comparison between the control (Col-0) in which the MybC promoter was not introduced, the control group in which the MybC promoter was introduced but the environmental stress was not added (Control 1-3 and 8-1), the MybC promoter was introduced, The expression of the root-specific expression and the expression level of the GUS gene by the MybC promoter in the NaCl treated experimental group.
FIG. 3 is a graph showing the results of confirmation of the change of MybC expression level by various RTs according to various environmental stresses.

The present invention relates to a root-specific expression promoter composed of the nucleotide sequence shown in SEQ ID NO: 1 and a root-specific expression vector containing the same.

The root-specific expression promoter composed of the nucleotide sequence shown in SEQ ID NO: 1 is a promoter capable of expressing a gene specifically in root tissue without inducing gene expression in other plant tissues.

The root-specific expression promoter of the present invention includes not only the nucleotide sequence of SEQ ID NO: 1 but also a nucleotide sequence which exhibits root-specific promoter activity as a modified sequence in which some bases of the nucleotide sequence of SEQ ID NO: 1 are substituted, deleted or added .

The promoter is generally a gene region located upstream of an encoding site including a site at which transcription is initiated. The promoter is usually a TATA box that regulates gene expression, a CAAT box site, a site that affects gene expression in response to an external stimulus, And an enhancer that promotes the expression of almost all genes regardless of their position and direction.

The expression vector means a plasmid, virus or other medium known in the art into which a promoter of the present invention and a gene sequence encoding a target protein operably linked to the promoter can be inserted or introduced. The root-specific expression promoter of the plant according to the present invention and the gene sequence encoding the target protein operably linked to the promoter may be operably linked to an expression control sequence and the operably linked gene sequence and expression control The sequence may be contained within an expression vector that also contains a selection marker and a replication origin.

Therefore, the vector may be a root-specific expression vector further comprising a target gene operably linked to a root-specific expression promoter composed of the nucleotide sequence shown in SEQ ID NO: 1.

For purposes of the present invention, "operably linked" means that the appropriate molecule is linked in such a way as to enable expression of the gene when bound to the expression control sequence. Also, an 'expression control sequence' refers to a DNA sequence that regulates the expression of a polynucleotide sequence operably linked to a particular host cell. Such regulatory sequences include promoters for conducting transcription, any operator sequences for regulating transcription, sequences encoding suitable mRNA ribosome binding sites, and sequences controlling the termination of transcription and translation.

As the expression vector according to the present invention, the MybC promoter of the present invention is inserted using the existing vector used for protein expression as a basic framework, and a target gene, which is a base sequence encoding a target protein, is inserted downstream of the promoter . (PBR322, pBR325, pUC118 and pUC119), plasmids derived from Bacillus subtilis (pUB110 and pTP5), yeast-derived plasmids (YEp13, YEp24 and YCp50) having various cloning sites, And Ti plasmids, plant virus vectors, and binary vectors such as pCHF3, pPZP, pGA and pCAMBIA sequences can be used. However, those skilled in the art can use any vector as long as it can introduce the promoter of the present invention and the nucleotide sequence encoding the target protein operably linked to the promoter into the host cell. In the example of the present invention, the MybC :: GUS vector was prepared using the pMDC162 vector.

In the present invention, the term 'target gene' refers to a gene encoding an exogenous target protein that is desired to be expressed specifically in plant roots by the promoter of the present invention, preferably an exogenous protein or an endogenous protein and a reporter protein Lt; / RTI > The exogenous protein refers to a protein that does not naturally exist in a specific tissue or cell, and the endogenous protein refers to a protein expressed by a gene naturally present in a specific tissue or cell. In addition, the reporter protein is a protein expressed by a reporter gene, and refers to a marker protein that shows its activity in a cell by its presence. In one embodiment of the present invention, a recombinant expression vector was constructed in which the Arabidopsis MybC promoter of the present invention was operatively linked to the upstream part of the GUS gene in a pMDC162 vector in which a reporter system in which GUS, a blue coloring gene, .

The present invention also relates to a plant cell into which a root-specific expression promoter composed of the nucleotide sequence shown in SEQ ID NO: 1 has been introduced. That is, the recombinant expression vector, which comprises a promoter of the present invention or a base sequence of a target gene operably linked to the promoter, may be introduced into host cells by a method known in the art. Methods for introducing the recombinant expression vector of the present invention into a host cell include, but are not limited to, calcium chloride (CaCl ₂ ), heat shock method, Agrobacterium sp. , Particle gun bombardment, silicon carbide whiskers, sonication, electroporation, and precipitation with polyethylenglycol (PEG). Preferably, an Agrobacterium sp. -Mediated method can be used.

The present invention also relates to a method for transforming a plant cell with a vector comprising the root-specific expression promoter and a target gene operably linked thereto, To a plant root-specific expression of the target gene.

In the present invention, the plant may be a dicotyledonous plant or a monocotyledonous plant. The dicotyledonous plants include, but are not limited to, Arabidopsis, soybean, tobacco, eggplant, pepper, potato, tomato, cabbage, radish, cabbage, lettuce, peach Rice straw, watermelon, melon, cucumber, carrot, celery and rape. The terminal plants may be rice, barley, wheat, rye, corn, sugarcane, oats and sheep.

 The present invention also relates to an oligonucleotide comprising an oligonucleotide of SEQ ID NO: 2 for amplifying a root-specific expression promoter of 1.4 kb comprising the nucleotide sequence of SEQ ID NO: 1 and an oligonucleotide of SEQ ID NO: 3, And a primer set for promoter amplification. The oligonucleotide of SEQ ID NO: 2 is a forward primer and the oligonucleotide of SEQ ID NO: 3 is a reverse primer. The primer may be prepared by a method for synthesizing an oligonucleotide known to a person skilled in the art, or may be synthesized commercially. The primer of the present invention may include a modified sequence in which a part of the individual base sequence constituting the primer is mutated. The modified sequence was subjected to PCR using primer (SEQ ID NO: 2 and SEQ ID NO: 3) consisting of the result of performing Polymerase Chain Reaction (PCR) using the mutated primer and the unmodified sequence Means a sequence in which a result is deleted, substituted or added within substantially the same range.

The present invention also provides a method for producing a transgenic plant, comprising the steps of: preparing a transformed plant with a vector comprising the promoter represented by SEQ ID NO: 1 and a gene for detection operably linked thereto; And a step of confirming a change in the expression of the detection gene in the root.

According to the present invention, it was confirmed that the MybC promoter specifically expressed in the root can change its expression due to environmental stress. Therefore, it is possible to detect the expression of the MybC promoter in the plant, And a method of detecting whether or not the signal is detected.

The environmental stress may include, without limitation, various physical or chemical conditions that may cause stress to the plant, such as salt concentration, plant hormone, sugar concentration, and more specifically, mannitol, sucrose, NaCl, salicylic acid, Oxine, and abscisic acid. Depending on the type of environmental stress applied, the expression level of the MybC promoter can be adjusted upwards or downwards and can be used to distinguish the presence or absence of environmental stress according to the relative change in the expression level. The baseline level of expression may be a baseline level of expression that is not stressed at all and may be subject to some degree of stress. In this case, the expression level of a certain degree of stress may be a reference expression amount for confirming the increase or decrease, not the presence or absence of environmental stress.

In order to confirm the expression level, it is essential to confirm that the detection gene is changed in the root tissue, and the detection gene is preferably a gene that expresses color. As a preferred example of the present invention, the GUS gene can be used.

It is also within the scope of the present invention that the above-described contents of the present invention are applied mutatis mutandis to each other, and those skilled in the art will make appropriate changes. Hereinafter, the present invention will be described in detail with reference to Examples. However, the scope of the present invention is not limited to the following Examples.

Example  One. MybC Cloning  And the production of transgenic plants

In order to obtain Arabidopsis MybC promoter, gDNA of wild type Arabidopsis thaliana was extracted for 2 weeks after germination. PCR was carried out using this gDNA as a template using a primer having a sequence identical to that of 20 bp of the MYBC 1.4 kb promoter at both ends. The PCR was carried out under the conditions of denaturation at 95 ° C for 5 minutes, annealing at 57 ° C for 1 minute, polymerization at 70 ° C for 1 minute, and a total of 40 cycles. Then, the promoter of MYBC amplified by electrophoresis was confirmed and eluted from the gel. The sequence of the obtained MybC promoter is the same as the sequence of SEQ ID NO: 1 shown in Table 1 below.

SEQ ID NO: Explanation order SEQ ID NO: 1 MybC promoter GTAACATTGTATCTTTAAAAAAAATTATCCTAAACAAAGAACGAAACGATACAATAGTATAAATTTGTTCTTGTCATAAACGATAATTTCCAGGTAAGATTAAGGATAAAACAAAAAAGCTTATAATAGCAATTTAAAACACGAATTCAACGTACGATCCACCACAATCCTCGTCGTCTTTCAAACTTAAAATACCGAAACTACCCTTACCTTCTTCTTTCCATAAGAAATCAAAACCAAGTCCTATGGTCGCAATTGTATCTCTATCTAAAAATCTTCTTTGAATTTGTGTATACACAAATCTTATTCAACGAATCATTTATCACCAAAAGGTTCTCTCTTTTTTGTTTGTTTCTGTCTTGTGTGA SEQ ID NO: 2 Forward promoter CTTAAGATCTAAATTTATGT SEQ ID NO: 3 Reverse promoter TCACACAAGACAGAAACAAAC

The eluted DNA fragment (1.4 kb) was inserted into a topo vector (pCR 8 / GW / TOPO: invitrogen), which was then subjected to the LR reaction (LR Clonase®: invitrogen) to the pMDC162 vector, a GUS vector. Subsequently, E. coli cells (TOP10 cell: invitrogen) were transformed by heat shock transformation and cultured until a colony was formed (37 degrees, 12 hours). The resulting colony was cultured again on LB medium and plasmid vector was extracted. The MybC GUS vector structure used is shown in Fig.

As shown in Fig. 1, MybC GUS was produced in a total size of 12884 bp, and a 1.4 kb MybC promoter sequence was inserted. The prepared MybC pro :: GUS vector was transformed into Agrobacterium by electric shock transformation method and then cultured. The transformed Agrobacterium was transformed into wild-type Arabidopsis prepared by floral dipping transformation. The seeds were then harvested from the transgenic plants and selfed to third generation, securing a homologous line.

Example  2. Confirmation of GUS blue expression reaction

In order to confirm whether root-specific expression was induced in the transformed plants prepared in Example 1, transgenic plants were sown to confirm GUS blue expression. For more precise determination, two MybC pro GUS lines (1-3, 8-1) and Col-0 control plant were used. More specifically, the transformed plants were grown for 9 days and subjected to GUS staining after stress treatment with 200, 300 mM NaCl and sucrose, 0.5, 5 μM ABA and auxin for 24 hours. The Arabidopsis thaliana was stained with GUS, and the specimen was prepared on a 4% agar medium and observed with a stereoscopic microscope (model: leica EZ 4D) of leica at 8x. The results are shown in Figs. 2A and 2B. As a control group, the plant wild type (Col-0) in which the MybC promoter was not introduced and the MybC promoter were introduced but the environment was not stressed.

As shown in Figs. 2A and 2B, it was confirmed that GUS expression was specifically expressed at the root portion in all the MybC promoter-introduced groups. Also, in the control group not treated with abiotic stress, the specimens stained specially in the root. These results indicate that the MybC promoter of SEQ ID NO: 1 can induce root-specific expression in plants.

Example  3. Depending on the stress condition MybC  Comparison of expression level

Total RNA was obtained from 9-day-old wild-type Col-0 plants and cDNA was synthesized therefrom in order to confirm the change of expression amount of MybC according to the treated stress condition. The stress condition was treated with sucrose 200, 300 mM, NaCl 200, 300 ml, mannitol 200, 400 ml, jasmonic acid (JA) 1,10 uM, ABA 1, 10 uM, IAA 1, 10 uM and salicylic acid (SA) 1 and 10 uM. RT-PCR was performed using EvaGreen 2X qPCR MasterMix. ACTIN2 was used as an internal control, and the results are shown in Fig.

As shown in FIG. 3, the expression level of MybC was decreased in the sucrose-treated group and slightly higher in the NaCl and mannitol-treated groups than in the control group. In the ABA treatment group, the expression level decreased. In the JA treatment group, the expression level was increased as the concentration increased, but this was in contrast to the decrease in SA treatment group. As a result, it was confirmed that the expression level of the MybC promoter, which is a root-specific expression promoter, could be changed by the environmental stress, and when the expression level of the MybC promoter was changed by confirming the expression level thereof, It can be predicted that comparative analysis can be performed. For example, changes in the amount of MybC expression in the root of the plant into which the MybC promoter has been introduced can confirm whether the soil is an environment that stresses the plant and the amount of environmental stress is increased or decreased.

<110> Korea University Research and Business Foundation <120> MybC promoter with root specific expression <130> KU1-78p <160> 3 <170> Kopatentin 2.0 <210> 1 <211> 1392 <212> DNA <213> Artificial Sequence <220> <223> MybC promoter <400> 1 cttaagatct aaatttatgt atatcctaac agttatatcc gttttgtaca ctattttaaa 60 actttttaca gatctaagat aaacatagat ttattttaag aatcaaatag tgaaaactct 120 gcgtggaaaa aattaatcat gagtcatgac aatgatgagc tagttaaggt tccaagtgat 180 tgcaatcaca ttttgtgagc actaaagaac acatacacac actatatata tattcttgat 240 cacctaacga gtgaatcaaa agagatgagt agtttattgt attttgggac aaacttcgat 300 taaataatat ttacactatt tcatgaaaac atttgatcac tcatcaaata catcttatga 360 aggcgcatat atatctactg tttatgaaat ctaatctact ttactatatg aaaaaaacat 420 acaaatttgc cggagctttc taaagacttc tcagcttctt ctccggtatt atcatcccta 480 gaccggtcaa ttttggttac ttaagttgca agaaatctcc gtgtaaccca aatttcataa 540 atgcgtagtg ggatttactc ttcttctttt ttggtttcat atttggtgtt tgcctttcgc 600 gtaaaatacc aacatatagc aaagagcgtt tagacgtcaa atgtgtttgt tttatttgtg 660 tagagtatac atactttttt aagaaaagaa aaaagaagtt atgaaagctt gttctttttt 720 gttaaagatt atgaaagctt gtttaaatcc taatcacatc tcgtactaaa taaagaacta 780 tatgtgtgtg ggtaatatta tccaatctct ttaaatttaa accacttgtc tcatctcata 840 tgcaaaacgt gtatcttgta agaacacacg ctcttctaat atagaaatag atcgcgtaac 900 aagtggactt ggaaaagcta tagtttatgg cgttttcgga cagatttaca cttaaataat 960 attatcctca catcttttaa attcaattat ttcattatct tggttatcag aactgagttt 1020 tgtcggtaac attgtatctt taaaaaaaat tatcctaaac aaagaacgaa acgatacaat 1080 agtataaatt tgttcttgtc ataaacgata atttccaggt aagattaagg ataaaacaaa 1140 aaagcttata atagcaattt aaaacacgaa ttcaacgtac gatccaccac aatcctcgtc 1200 gtctttcaaa cttaaaatac cgaaactacc cttaccttct tctttccata agaaatcaaa 1260 accaagtcct atggtcgcaa ttgtatctct atctaaaaat cttctttgaa tttgtgtata 1320 cacaaatctt attcaacgaa tcatttatca ccaaaaggtt ctctcttttt tgtttgtttc 1380 tgtcttgtgt ga 1392 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 2 cttaagatct aaatttatgt 20 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 3 tcacacaaga cagaaacaaa c 21

Claims (8)

1. A composition for detecting environmental stress in plants, comprising a root-specific expression promoter composed of the nucleotide sequence shown in SEQ ID NO: 1, wherein said environmental stress is selected from the group consisting of mannitol, sucrose, NaCl, salicylic acid, Wherein the composition is at least one selected from the group consisting of:
The composition according to claim 1, wherein the promoter is contained in a vector.
The composition of claim 1, further comprising a target gene operably linked to the promoter.
1. A composition for detecting environmental stress in a plant, comprising a plant cell into which a root-specific expression promoter composed of the nucleotide sequence shown in SEQ ID NO: 1 has been introduced, wherein said environmental stress is selected from the group consisting of mannitol, sucrose, NaCl, salicylic acid, Wherein the composition is at least one selected from the group consisting of acacia, acacia, and abscisic acid.
Transforming a plant cell with a vector comprising a root-specific expression promoter consisting of the nucleotide sequence shown in SEQ ID NO: 1 and a target gene operably linked thereto; Wherein the environmental stress is at least one selected from the group consisting of mannitol, sucrose, NaCl, salicylic acid, jasmonic acid, oxine and abscisic acid, and the detection is carried out at the roots of plants Wherein the method comprises the steps of:
delete Preparing a transformed plant with a vector comprising a promoter represented by SEQ ID NO: 1 and a gene for detection operably linked thereto; And
Wherein the environmental stress is at least one selected from the group consisting of mannitol, sucrose, NaCl, salicylic acid, jasmonic acid, oxine and abscisic acid. Wherein said environmental stress detection method comprises the steps of: delete

Images