KR101842221B1 - PCR primer set for detecting or quantifying components in processed products and method for detecting or quantifying the same - Google Patents

Abstract

The present invention relates to a primer for detecting or quantifying raw materials in processed foods, and a method for detecting or quantifying raw materials using the same. By using a primer set for detecting or quantifying raw material meat in processed food of the present invention, a user can confirm whether or not raw materials are contained in cooked food heated at a high temperature for a long period of time and the content of each material.

Description

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a primer for detecting or quantifying a raw material in processed foods and a method for detecting or quantifying raw materials using the primer.

The present invention relates to a primer set for detecting or quantifying a raw material in processed foods and a method for detecting or quantifying raw materials using the same.

Since 1970, Korea has been recognized as one of the most important food items for meats since the consumption of meat has increased greatly due to continuous economic growth, westernization of eating habits and development of the food service industry. According to the Food and Drug Administration (2013), meat consumption per capita in the country increased by 18.7% in 2009 to 43.7 ㎏ compared to 36.8 ㎏ in 2009. Of these, the meat with the highest consumption was pork (20.9kg), chicken kg), beef (10.3kg) and duck meat (3.1kg). The increase in meat consumption has an effect on modern people 's eating habits culture, and there is an increasing tendency to use out - of - home meals or processed foods rather than cooking them at home. In particular, the development of processed food provides convenience and functionality to busy modern people, but illegal food producers tend to process, manufacture and distribute cheap food raw materials or fake foods that exploited them for economic gain, It is becoming a problem.

Inaccurate labeling of illegal foodstuffs and supervision over the contamination of foreign substances during the manufacturing process of foodstuffs emphasize the necessity of procedures for quality assurance of processed foodstuffs. It is difficult to confirm the authenticity of the finished product in the quality assurance of the processed food, and it is difficult to secure the stability. Particularly, in the case of processed products, there is a growing disbelief in food as the various methods such as mixed blending are intentionally made without confirming whether or not the mixed raw materials are mixed with the mixed raw food. Red pepper powder, garlic, and onion are widely used as raw materials for seasoning, which is a kind of spice preparation, and traditional products such as kochujang and kimchi. However, these mixed foods are difficult to classify due to processing of raw materials, (See Non-Patent Document 1). In addition, ham and sausage are produced by mixing low raw material or mixed meat regardless of product labeling, and consumers' perception of meat products is rather deteriorating.

In order to ensure accurate identification of raw materials and reliability of consumers, it is necessary to use a scientific discrimination technology that can objectively verify the raw materials, because it is almost impossible to discriminate the raw materials by appearance or sensory method when processed or treated with mixed food or fake food. This is very necessary. (Non-patent document 2), chromatography (non-patent document 3), isoelectric point electrophoresis (non-patent document 4), and GC (non-patent document 4) as techniques for discriminating these species by diversification and segmentation of food and raw materials, LC, and HPLC (Non-Patent Document 5) have been tried. However, these immunological and electrophoresis methods can identify the species by detecting species-specific protein depending on the difference in protein composition and structure between species, but it is practically impossible to discriminate among species of the same species. Particularly, in the case of processed foods in which raw materials are pulverized and mixed, the biological characteristics of the proteins disappear, and it is difficult to classify the proteins by the denaturing of water-soluble proteins and specific antigens during processing such as autoclaving, chemical treatment, fermentation, (Non-Patent Document 6).

As the molecular biology and genetics techniques have been developed, genetic analysis techniques that directly use DNA have been introduced into the species identification of meat foods, and species discrimination can be made according to species-specific DNA sequence differences. It is widely used as a new technology to overcome. In particular, the DNA detection method based on PCR (Polymerase Chain Reaction) can extract a very small amount of DNA from a sample, amplify a desired site gene in a short time with a species specific primer, (Non-Patent Document 7 and Non-Patent Document 8).

PCR detection using species-specific primers requires techniques to search for DNA sequences with the highest specificity depending on species or species, design primers, and obtain a sufficient amount of DNA from the samples. However, in the case of processed foods, DNA is very stable compared to proteins, but due to the nature of the processing, it is difficult to expect the reproducibility of the PCR amplification results for the target gene due to the possibility of DNA damage in the food. It is most important to optimize PCR amplification conditions.

Recently, Realtime PCR technology has been introduced and reported. This method is a method using a real-time confirmation PCR apparatus in which a conventional PCR and a spectrophotometric fluorescence spectrometer are integrated (Non-Patent Document 9). In the conventional PCR technique, PCR analysis such as electrophoresis is required to confirm the amplification products (post PCR analysis), whereas Realtime PCR is a technique that can quantitatively analyze the amount of the amplified product per cycle, Real-time PCR detection is preferred because of the ease and speed of analysis without electrophoresis and low risk of contamination.

Methods for measuring the amount of amplified product in real-time PCR include absolute quantification and relative quantification. Absolute quantitation is performed on the assumption that the PCR efficiency of the target gene and the reference material is the same as that of the reference gene by using a standard substance known to be a known concentration and using the standard curve to calculate the concentration of the target gene to be measured. However, since it shows significant deviations in the PCR efficiency and the result depending on the degree of inhibition, degradation and demage of various DNA-inhibiting substances such as processed foods, much effort and time are required to optimize them . Relative quantitation is a commonly used method for gene expression, using a housekeeping gene to quantify RNA, and simply comparing the signal from the housekeeping gene with the signal from the target gene to analyze how much the target gene has increased or decreased.

In non-patent document 10, the real-time PCR method was applied for the specific detection and quantification of the animal species contained in this feed and fish meal, and after the possibility of this, the amount of raw materials Are being studied. In particular, in Korea, real-time PCR was applied to raw meat and heat-treated fish meat for the specific discrimination of animal species, and the possibility of qualitative analysis of specificity, sensitivity and detection limit was suggested. Therefore, The usefulness of the analysis is expected to increase further.

Accordingly, the present invention relates to a method for efficiently extracting DNA contained in a raw material from sausage, broth, and mixed sauce having a high risk of potentially illegal manufacturing among processed foods, and then real- We have developed a method to detect and identify the target genes and to present them as scientific data for guaranteeing the quality of processed food raw materials.

Park, et al., 2012. J. Fd Hyg. Safety. 27 (2): 182 Pineiro et al., 2000. Food Chemistry, 70, 241 Pineiro et al., 1997. Zeitschrift fur Lebensmittel-Untersuchung und-Forschung, 204, 411 Ochiai et al., 2003. Food Research International, 36, 1029 Christopoulou et al., 2004. Food chemistry. 84, 463 Montiel-Sosa et al., 2000. J Agric Food Chem 48: 2829 Jung et al., 2000. Korean Journal of Animal Science and Technology 42: 379 Koo et al., 2011. The Korean Journal of Veterinary Medicine. 28 (3): 259 Higuchi et al., 1993. Biotechnology. 11: 1026 Krcmar et al., 2005. Genetics 150: 1177

The present invention provides a primer set for detecting or quantifying raw materials in processed foods.

The present invention also provides a PCR kit for detecting or quantifying a raw material in processed foods.

The present invention also provides a raw material detection method and a quantification method in processed foods.

Thus, the inventors of the present invention confirmed that it is possible to efficiently extract DNA of raw materials from processed foods subjected to heat treatment at a high temperature for a long period of time, and to detect or quantify raw materials using species-specific genes of raw materials, thereby completing the present invention .

Accordingly, the present invention provides a primer set for detecting or quantifying a raw material in a processed food.

Specifically, a primer set for detecting or quantifying an animal species comprising the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2;

A primer set for pork detection or quantification comprising the nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: 4;

A primer set for detection or quantification of chicken comprising the nucleotide sequence of SEQ ID NO: 5 and SEQ ID NO: 6;

A primer set for beef detection or quantification comprising the nucleotide sequence of SEQ ID NO: 7 and SEQ ID NO: 8;

SEQ ID NO: 9 and SEQ ID NO: 10;

A primer set for detecting or quantifying a plant species comprising the nucleotide sequence of SEQ ID NO: 11 and SEQ ID NO: 12;

A primer set for detecting or quantifying red pepper comprising the nucleotide sequence of SEQ ID NO: 13 and SEQ ID NO: 14;

A primer set for detecting or quantifying garlic comprising the nucleotide sequence of SEQ ID NO: 15 and SEQ ID NO: 16; And

There is provided a primer set for detecting or quantifying a raw material in a processed food comprising a primer set for onion detection or quantification comprising the nucleotide sequence of SEQ ID NO: 17 and SEQ ID NO: 18.

In the present invention, the primer set consisting of the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2 is an animal species specific primer set. In one embodiment, the SEQ ID NO: 1 and SEQ ID NO: Performing a PCR using a primer set consisting of the nucleotide sequence of the second pig (Sus scrofa ), chicken ( Gallus gallus), it is possible to amplify a PCR product of 110bp from cattle (Bos Taurus) and duck (16s rRNA parts in the genes of the Anas platyrhynchos). Accordingly, the primer set can be used to confirm whether any one or more of pork, chicken, beef and duck meat in the processed food is contained.

In the present invention, the primer set consisting of the nucleotide sequences of SEQ ID NO: 3 and SEQ ID NO: 4 is a pig-specific primer set. In one embodiment, the SEQ ID NO: 3 and SEQ ID NO: Performing a PCR using a primer set consisting of the nucleotide sequence of the four pigs (Sus scrofa ) can amplify a 132 bp PCR product at the DNA site of the FGF4 gene. Therefore, it is possible to confirm the presence of pork in the processed food using the primer set.

The primer set consisting of the nucleotide sequences of SEQ ID NO: 5 and SEQ ID NO: 6 is a chicken-specific primer set. In one embodiment, when PCR is performed using a primer set consisting of the nucleotide sequences of SEQ ID NO: 5 and SEQ ID NO: 6, a PCR product of 165 bp in the DNA region of the RCP 2-like gene of chicken ( Gallus gallus ) Can be amplified. Therefore, it is possible to confirm whether the chicken is contained in the processed food using the primer set.

The primer set consisting of the nucleotide sequences of SEQ ID NO: 7 and SEQ ID NO: 8 is a small specific primer set. In one embodiment, the SEQ ID NO: 7 and SEQ ID NO: Performing a PCR using a primer set consisting of the nucleotide sequence of the eight amplified a PCR product of 110bp from the DNA portion of FGF4 genes in cattle (Bos taurus) . Therefore, it is possible to confirm whether beef is contained in the processed food using the primer set.

The primer set consisting of the nucleotide sequences of SEQ ID NO: 9 and SEQ ID NO: 10 is a set of primers specific for ducks. In one embodiment, PCR is performed using a primer set consisting of the nucleotide sequences of SEQ ID NO: 9 and SEQ ID NO: 10 to amplify a 121 bp PCR product in the DNA region of the ND2 gene of ducks ( Anas platyrhynchos ) . Therefore, it is possible to confirm whether the duck meat is contained in the processed food using the primer set.

In the present invention, the primer set consisting of the nucleotide sequences of SEQ ID NO: 11 and SEQ ID NO: 12 is a plant species specific primer set. In one embodiment, PCR is performed using a primer set consisting of the nucleotide sequences of SEQ ID NO: 11 and SEQ ID NO: 12 to yield Capsium annuum ), garlic ( Allium scorodorpasum ) and onion ( Allium cepa ) genes in the 16s rRNA region. Therefore, the presence or absence of any one or more of red pepper, garlic, and onion in the processed food can be confirmed by using the primer set.

The primer set consisting of the nucleotide sequences of SEQ ID NO: 13 and SEQ ID NO: 14 is a pepper-specific primer set. In one embodiment, when PCR is performed using a primer set consisting of the nucleotide sequences of SEQ ID NO: 13 and SEQ ID NO: 14, a PCR product of 102 bp is amplified at the DNA site of the CCS gene of Capsium annuum . Therefore, it is possible to confirm whether the red pepper powder is contained in the processed food using the primer set.

The primer set consisting of the nucleotide sequences of SEQ ID NO: 15 and SEQ ID NO: 16 is a garlic specific primer set. In one embodiment, PCR is performed using a primer set consisting of the nucleotide sequences of SEQ ID NO: 15 and SEQ ID NO: 16 to amplify a 122 bp PCR product in the DNA region of the COX2 gene of garlic ( Allium scorodorpasum ) . Therefore, it is possible to confirm whether garlic is contained in the processed food using the primer set.

The primer set consisting of the nucleotide sequences of SEQ ID NO: 17 and SEQ ID NO: 18 is an onion-specific primer set. In one embodiment, PCR is performed using a primer set consisting of the nucleotide sequences of SEQ ID NO: 17 and SEQ ID NO: 18 to amplify a 182 bp PCR product in the DNA region of the Alliinase gene of the onion ( Allium cepa ) . Therefore, it is possible to confirm whether garlic is contained in the processed food using the primer set.

In the present invention, the processed food may include all the foods that contain or are expected to contain meat, processed foods that have been subjected to heat treatment at a high temperature for a long period of time, and mixed spices that have been heated, dried and crushed, , Or a processed food containing pork, chicken, beef, and duck meat. In one embodiment, the processed food may be a sausage containing mixed meat, a mixed seasoning in which the mixed meat is heated for 1 hour or longer and baked at high temperature or heated, dried and pulverized, no.

In the present invention, the term " primer " refers to a nucleic acid sequence having a short free 3 'hydroxyl group, capable of forming base pairs with a template of a complementary nucleic acid, &Quot; means a short nucleic acid sequence which functions as a starting point for < / RTI > The primer can initiate DNA synthesis in the presence of a reagent for polymerization reaction (i. E., DNA polymerase) at a suitable buffer solution and temperature.

The present invention also provides a PCR kit for detecting or quantifying a raw material in a processed food containing the primer set and a PCR reaction mixture thereof.

The PCR reaction mixture may include dNTPs, DNA polymerases and buffers, and may include all reagents available to a person skilled in the art for PCR reactions.

The present invention also provides a method for detecting a raw material in a processed food.

Specifically, the present invention provides a method for detecting a raw material in a processed food, comprising the step of performing PCR using DNA extracted from a processed food using the primer set and analyzing a PCR product.

In the raw material detection method in the above-mentioned processed foods, all of the contents described above for the processed food, the primer set consisting of SEQ ID NO: 1 to SEQ ID NO: 18 and the PCR reaction can be applied or applied in the entirety.

In the above detection method, the step of analyzing the PCR product comprises:

When a 110 bp PCR product is amplified using a primer set consisting of the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2, one or more raw materials selected from the group consisting of pork, chicken, beef and duck meat in the processed food are contained ;

When a 132 bp PCR product is amplified using a primer set consisting of the nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: 4, the pork is contained in the processed food;

When a 165 bp PCR product is amplified using a primer set consisting of the nucleotide sequence of SEQ ID NO: 5 and SEQ ID NO: 6, the chicken is contained in the processed food;

When a 110 bp PCR product is amplified using a primer set consisting of the nucleotide sequence of SEQ ID NO: 7 and SEQ ID NO: 8, the beef is contained in the processed food;

When a 121 bp PCR product is amplified using a primer set consisting of the nucleotide sequence of SEQ ID NO: 9 and SEQ ID NO: 10, the duck meat is contained in the processed food;

Wherein the 189 bp PCR product is amplified using a primer set consisting of the nucleotide sequence of SEQ ID NO: 11 and SEQ ID NO: 12, and contains one or more raw materials selected from the group consisting of red pepper powder, garlic, and onion in the processed food;

When a PCR product of 102 bp is amplified using a primer set consisting of the nucleotide sequence of SEQ ID NO: 13 and SEQ ID NO: 14, red pepper powder is contained in the processed food;

When a 122 bp PCR product is amplified using a primer set consisting of the nucleotide sequence of SEQ ID NO: 15 and SEQ ID NO: 16, garlic is contained in the processed food; And

When a PCR product of 182 bp is amplified using a primer set consisting of the nucleotide sequence of SEQ ID NO: 17 and SEQ ID NO: 18, it can be determined that the onion in the processed food is contained.

The PCR product analysis can be performed by comparing the size of the product by electrophoresis of the PCR product, or checking whether the PCR product is amplified or not.

The electrophoresis can be performed by agarose gel electrophoresis or acrylamide gel electrophoresis according to the size of the amplification product, but the electrophoresis method is not limited thereto.

In the present invention, the term " amplification reaction " means a reaction for amplifying a nucleic acid molecule. A variety of amplification reactions have been reported in the art, including polymerase chain reaction (PCR) (US Pat. Nos. 4,683,195, 4,683,202 and 4,800,159), reverse-transcription polymerase chain reaction (RT-PCR) (Sambrook et al., Molecular Cloning. (LCR) (see, for example, A Laboratory Manual, 3rd Ed. Cold Spring Harbor Press (2001)), Miller, HI (WO 89/06700) and Davey, C. et al (EP 329,822) 17,18), Gap-LCR (WO 90/01069), repair chain reaction (EP 439,182), transcription-mediated amplification (TMA) 19 (WO 88/10315) (US Ser. No. 6,410, 276), self-sustained sequence replication (20) (WO 90/06995), selective amplification of target polynucleotide sequences (U.S. Patent No. 6,410,276), consensus sequence priming polymerase chain The consensus sequence primed polymerase chain reaction (CPPCR) (U.S. Patent No. 4,437,975), random (US Pat. Nos. 5,413,909 and 5,861, 245), nucleic acid sequence based amplification (NASBA) (U.S. Patent No. 5,130,238, 5,409,818, 5,554,517, and 6,063,603), strand displacement amplification (21,22), and loop mediated isothermal amplification. (LAMP) 23, but is not limited thereto. Other amplification methods that may be used are described in U.S. Patent Nos. 5,242,794, 5,494,810, 4,988,617 and U.S. Patent No. 09 / 854,317.

The present invention also provides a method for quantifying a raw material in a processed food.

Specifically, there is provided a method for quantifying a raw material in a processed food, which comprises performing real-time PCR on a DNA extracted from a processed food using the primer set of claim 1 and analyzing real-time PCR products .

In the method for quantifying a raw material in the processed food, all of the contents of the processed food, the primer set consisting of SEQ ID NO: 1 to SEQ ID NO: 18, and the PCR reaction can be applied or applied all in the above description.

In performing the real-time PCR, real-time PCR may be sequentially performed for each primer set in the primer sets to determine the mixing ratio of the raw materials in the processed food.

In one embodiment, performing the real-time PCR may be accomplished by selecting any one of the primer sets of SEQ ID NO: 1 to SEQ ID NO: 18 to perform real-time PCR, and then selecting among the 17 non-selected primer sets Real-time PCR is performed by selecting any one of them, and the real-time PCR is sequentially performed with the remaining primer set, so that the mixing ratio of the raw materials in the processed food can be determined.

In the present invention, the term " real time-PCR " is a technique for monitoring and analyzing the increase of PCR amplification products in real time (Levak KJ, et al., PCR Methods, Appl., 4 (6) 62 (1995)). The PCR reaction can be monitored by recording fluorescence emission in each cycle during the exponential phase, during which the increase in PCR product is proportional to the initial amount of target template. The higher the starting copy number of the nucleic acid target, the faster the fluorescence increase is observed and the lower the threshold value cycle. A pronounced increase in fluorescence above the baseline value measured between 3-15 cycles implies detection of accumulated PCR products. Compared to conventional PCR methods, real-time PCR has the following advantages: (a) Conventional PCR is measured in plateau, while real-time PCR measures data during the exponential growth phase Can be obtained; (b) the increase in the reporter fluorescence signal is directly proportional to the number of amplicons generated; (c) The degraded probe provides permanent record amplification of the amplicon; (d) increase in detection range; (e) requires at least 1,000 times less nucleic acid than conventional PCR methods; (f) detection of amplified DNA without separation by electrophoresis is possible; (g) using a small amplicon size can achieve increased amplification efficiency; And (h) the risk of contamination is low.

When the amount of PCR amplified acid reaches a detectable amount by fluorescence, the amplification curve begins to occur, and the signal rises exponentially to reach the stagnation state. The larger the initial amount of DNA, the faster the amplification curve appears because the number of cycles with which the amount of amplified product reaches the detectable amount is smaller. Therefore, real-time PCR using a stepwise diluted standard sample yields an amplification curve lined up at the same interval in the order of the initial amount of DNA. Here, if a threshold is set at an appropriate point, the CT value at which the threshold and the amplification curve intersect is calculated.

In real-time PCR, PCR amplification products are detected through fluorescence. The detection methods are largely an interchelating method (SYBR Green I method) and a method using a fluorescent label probe (TaqMan probe method). Since the interchelating method detects double stranded DNA, it is possible to construct a reaction system at low cost without preparing a gene-specific probe. The method using a fluorescent label probe is costly, while the detection specificity is high, so even the similar sequence can be detected.

 Advantages and features of the present invention and methods of achieving them will become apparent with reference to the embodiments described in detail below. The present invention may, however, be embodied in many different forms and should not be construed as being limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art. Is provided to fully convey the scope of the invention to those skilled in the art, and the invention is only defined by the scope of the claims.

The use of the primer set for detection or quantification of raw materials in the processed foods of the present invention can detect the presence or absence of raw materials in cooked foods heated at high temperatures for a long time, Can be selectively confirmed.

FIG. 1 shows the result of amplification by real-time PCR using a specific primer set of pigs, electrophoresis of the amplified product by agarose gel, and confirmation of the amplification curve.
FIG. 2 shows the result of amplification by real-time PCR using a chicken-specific primer set, electrophoresis of the amplified product by agarose gel, and confirmation of the amplification curve.
FIG. 3 shows the result of amplification by real-time PCR using a specific primer set of bovine, followed by electrophoresis of the amplified product by agarose gel, and confirming the amplification curve.
FIG. 4 shows the result of amplification by real-time PCR using a specific primer set of ducks, electrophoresis of the amplified product by agarose gel, and confirmation of the amplification curve.
FIG. 5 shows the result of amplification by real-time PCR using a specific primer set of red pepper, followed by electrophoresis of the amplified product by agarose gel and confirming the amplification curve.
FIG. 6 shows the result of amplification by real-time PCR using a specific primer set of garlic, electrophoresis of the amplified product by agarose gel, and confirmation of the amplification curve.
FIG. 7 shows the result of amplification by real-time PCR using an onion-specific primer set, electrophoresis of the amplified product by agarose gel, and confirmation of the amplification curve.
FIG. 8 is a graph showing the results of analyzing a standard curve by a melting curve and a DNA dilution ratio according to sensitivity using pig DNA. FIG.
FIG. 9 is a graph showing the results of analyzing a standard curve by a melting curve and a DNA dilution ratio according to sensitivity using chicken DNA. FIG.
10 is a graph showing the results of analyzing a standard curve by a melting curve and a DNA dilution ratio due to sensitivity using bovine DNA.
11 is a graph showing a result of analyzing a standard curve by a melting curve and a DNA dilution ratio according to sensitivity using duck DNA.
12 is a graph showing the results of analyzing a standard curve by a melting curve and a DNA dilution ratio due to sensitivity using pepper DNA.
13 is a graph showing a result of analyzing a standard curve by a melting curve and a DNA dilution ratio due to sensitivity using garlic DNA.
FIG. 14 is a graph showing the results of analyzing a standard curve by a melting curve and a DNA dilution ratio by using sensitivity of onion DNA. FIG.

Hereinafter, the present invention will be described in detail with reference to examples. The following examples illustrate the invention and are not intended to limit the scope of the invention.

[ Example ]

Manufacturing example  1. Sample Preparation

<1-1>. Manufacture of sausages

Sausages were prepared according to the composition of the following Table 1 according to the conventional sausage production method. Pork (Fuji) for making sausages and Donji were purchased from SK Livestock (Nonsan, Korea), and poultry were purchased from Iksan, Korea. The additives were purchased from Gunpo, Korea. In order to minimize the difference according to the content of lard, pork was removed at 0 mm from the lard attached to the outer wall of the fugue, and 10% of the lard was added in a batch. In order to minimize the effect of lard, additives and syrup, (Seocheon, Korea) according to the mixing ratio shown in Table 1 below. The additives were purified water (HanJusalt Co. Ltd, Ulsan, Korea), sodium nitrite (General Chemicals, Parsippany, USA), phosphate (Aditya Birla Chemicals, Mumbai, India), MCS Corp., Yangsan, Korea, soybean protein (Archer Daniels Midland, Chicago, IL, USA), Zhejiang Jiangshan Chemical Co Ltd., Shanghai, China), white sugar (TS Corp, Seoul, Korea), sodium L-glutamate (CJ Cheiljedang Corp., Incheon, Korea), CJ Cheiljedang Corp, Incheon, Korea, Miteck Korea, Jin Cheon, Korea) were used.

division Pig, chicken (parts by weight) Pig, and duck (parts by weight) Pig, and cattle (parts by weight) T1 T2 T3 T4 T5 T1 T6 T7 T8 T9 T1 T10 T11 T12 T13 pig 70 65 60 50 40 70 65 60 50 40 70 65 60 50 40 Don 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 Commitment 0 5 10 20 30 0 0 0 0 0 0 0 0 0 0 duck 0 0 0 0 0 0 5 10 20 30 0 0 0 0 0 small 0 0 0 0 0 0 0 0 0 0 0 5 10 20 30 system 80 80 80 80 80 80 80 80 80 80 80 80 80 80 additive 6.7 6.7 6.7 6.7 6.7 6.7 6.7 6.7 6.7 6.7 6.7 6.7 6.7 6.7 6.7 water 13.3 13.3 13.3 13.3 13.3 13.3 13.3 13.3 13.3 13.3 13.3 13.3 13.3 13.3 13.3 Sum 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100

<1-2>. Manufacture of broiler meat

Bovine, porcine, and chicken bones were heated at 115 ° C for 8 hours to prepare respective broth and mixed at a ratio according to the composition shown in Table 2 below.

division Broth (parts by weight) One 2 3 4 5 6 7 8 small 70 80 90 95 70 80 90 95 pig 30 20 10 5 0 0 0 0 chicken 0 0 0 0 30 20 10 5 Sum 100 100 100 100 100 100 100 100

<1-3>. Manufacture of mixed spices

Red pepper powder, garlic powder, and onion powder were mixed at a ratio according to the composition shown in Table 3 to prepare a mixed sauce.

division Mixed seasoning (parts by weight) One 2 3 4 pepper 78 78 59 59 garlic 22 0 29 12 onion 0 22 12 29 Sum 100 100 100 100

Example  1. DNA concentration and purity measurement from samples

The sausage was completely crushed and mixed with a blender since there is a possibility that the raw materials are not scattered evenly during packaging in the manufacturing process. Crushed and mixed samples were washed several times with sterile distilled water for 1-2 days to remove the salt, seasoning and various inhibitors contained in the sausage. Mixed seasonings were mixed with a blender and some of the raw materials were used. To remove it, the broth was centrifuged at 3,000 r / min for about 1 minute to remove the aggregated fat as much as possible. The fat-free solution was placed in a 2 ml tube and centrifuged at 8,000 r / min. Only the pellet formed at the bottom was transferred to a new tube. Approximately 25 mg of each of the processed food samples thus treated was put into a 1.5 ml tube and the DNA was extracted and purified by partially supplementing the manual of QIAamp DNA Micro Kit (QIAGEN, USA). That is, 300 μl of ATL buffer and 20 μl of proteinase K were added and cultured in a constant temperature water bath at 56 ° C. until the sample was completely degraded. After adding 4 R of RNase, the mixture was allowed to stand at room temperature for 2 minutes, 300 ㎕ of AL buffer was added, vortexed for 15 seconds, and then re-cultured in a water bath at 70 캜. The culture was transferred to a spin column and centrifuged at 8,000 r / min for 1 minute. The column was transferred to a new collection tube, 500 μl of AW1 buffer was added, and centrifuged at 8,000 r / min for 1 minute. After transferring the column to a new collection tube, 500 μl of AW2 buffer was added, centrifuged at 8,000 r / min for 1 minute, transferred to a collection tube, and left at room temperature until the membrane was dried. 100 μl of AE buffer was added to the collection tube, and the DNA was allowed to stand at room temperature for 1 minute. Then, the DNA was dissolved and centrifuged at 8,000 r / min for 1 minute to recover the final DNA. The absorbance of the extracted DNA was measured at 230: 260: 280 nm using a NanoDrop ND-1000 Spectrophotometer (Thermo Fisher Scientific, USA), and the quantified DNA was stored frozen at -20 ° C until the experiment.

sample Concentration (ng / l) Purity (260/280) Purity (260/230) One 182.49 1.99 2.12 2 56.24 2.12 1.15 3 59.93 2.07 1.11 4 31.84 2.33 0.82 5 29.78 2.20 0.81 6 89.41 2.12 1.56 7 92.60 2.35 1.84 8 165.80 1.94 1.05 9 120.93 2.05 1.69 10 89.61 2.06 1.39 11 125.68 1.99 1.53 12 86.96 2.17 1.53 13 82.73 2.08 1.51 14 92.13 2.01 1.50 15 98.06 2.01 1.22 16 29.79 2.77 1.13 17 62.99 2.24 1.51 Average 88.12 2.14 1.38

As a result, as shown in Table 4, the DNA concentration measured according to the mixed sample was 29.78 ng / μl to 182.49 ng / μl (average 88.12 ng / μl) of DNA. In addition, DNA purity (260/280) extracted from sausages was 1.9 or more, which was higher than the standard value. Also, the average purity (260/230) associated with inhibitor was 1.38, which was very good. Despite the fact that DNA was extracted from sausage samples by thoroughly grinding and mixing them with a blender before extracting the DNA from the sausage samples, the cause of the difference in DNA concentration according to the samples was the physical and chemical treatment during sausage production It is judged that the DNA concentration is affected by the extent to which the cells containing DNA are destroyed depending on the sample and when the treated raw materials are mixed or the concentration is not uniformly distributed during the casing treatment.

division sample Concentration (ng / l) Purity (260/280) Purity (260/230) Mixed seasoning One 48 1.89 0.79 2 61 2.17 0.38 3 28 1.87 1.07 4 37 1.8 0.39 Average 43.5 1.93 0.66

As shown in Table 5, the concentration of DNA extracted from the mixed spices (red pepper powder, garlic, onion) was 28 to 61 ng / μl (average 43.50 ng / (Average 1.93), but it was 0.38 to 1.07 (mean 0.66), which is lower than the standard value (1.8 to 2.0) in the purity indicating the degree of pollution (260/230) PCR amplification using a specific gene may act as an inhibitor to primer binding and cause the amplification products not to be generated properly. DNA concentration and purity (260/230) in mixed sauce are low due to the direct destruction of DNA when sterilized and dried / pulverized by high heat using applied irradiation technique for food preservation and hygiene, Is pointed out as a low cause.

division sample Concentration (ng / l) Purity (260/280) Purity (260/230) Broth One 39 1.95 1.19 2 39 1.86 1.13 3 163 2.04 1.86 4 127 2.07 1.79 5 77 1.96 1.74 6 129 2.02 1.76 7 70 2.01 1.64 8 30 1.82 0.98 Average 76.5 1.95 1.53

As can be seen from Table 6, the DNA concentration was found to be 30 to 163 ng / μl (average 76.50 ng / μl) after the extraction of DNA against the broth, It was relatively good. The concentration of DNA extracted from the broth was good, but in the case of liquid products such as broth, a large number of cells containing DNA were destroyed by processing such as high pressure and sterilization for a long time, Since it is often diluted at a certain rate when packaged, it is interpreted that the concentration of the cell varies depending on the content of the diluted solid, resulting in a different DNA concentration.

Example  2. Species specific Primer  making

For species-specific primer design, nucleotide sequence information of the corresponding species is searched for in the genes contained in mitochondrial DNA (mtDNA), nucleus and chloroplast DNA registered in NCBI GenBank (www.ncbi.nlm.nih.gov) ClustalW2-Multiple Sequence Alignment was used to select only the regions with high species specificity in the nucleotide sequences. Also, considering the characteristics of processed food, the primer was designed to have a PCR amplification product of about 200 bp, and it was confirmed whether it intersected with other species through Primer-BLAST. The internal positive control (IPC) was designed and synthesized as a primer for common regions of 16S rRNA to correspond to pigs and chickens (Table 7).

Specification Academic name gene SEQ ID NO Sequences (5 '- &gt; 3') Size
(bp) Tm
(° C) pig Sus scrofa FGF4 3
4 CAGGATGGAAAGTAACCCTGTC
GAGGCAACTTTTGACTGGCTA 132 62 chicken Gallus gallus RCP 2-like 5
6 CTGGGTTGAAAAGGACCACAGT
GTGACGCACTGAACAGGTTG 165 62 small Bos  taurus FGF4 7
8 GCCGCGGGATTGAAAGTAA
GGCAGCGGAGGGTCTACA 110 62 duck Anas  platyrhynchos ND2 9
10 TCTCAACCCAGCCCTACTTACC
GCCTAGGTGGGAGATGGATGA 121 62 pepper Capsicum annuum CCS 13
14 CTAATGGAAACCCTTCTAAAGC
GGTTGGATTTGGAAAAGTGG 102 62 garlic Allium  scorodorpasum COX2 15
16 AATAATTGGCGATGTGTCGCTGT
AAATGAATATACTGGGCGTG 122 62 onion Allium cepa Alliinase 17
18 GCATTGCTCGATAATTCAGACAG
TATGCATCAGCGGTAATGTCTC 182 62 Animal IPC - 16S rRNA One
2 AGTGACGAAAAATAACAATACAGGA
GCTGCTGGCACCAGACTT 110 62 Plant IPC - 16S rRNA 11
12 CGCAACCCTCGTGTTTAGTT
GACACACGTGCTACAATGG 189 62

Example  3. Real- PCR  Species-specific gene amplification

The processed food is likely to be destroyed by the template DNA even if PCR is carried out using the purified DNA after the destruction of the tissue cell due to the physical and chemical treatment during the process, and the PCR inhibitor existing in the added food is PCR The effect is very large. In order to maximize PCR amplification efficiency using DNA extracted from processed foods, the amplification conditions were tested first. In order to optimize the PCR amplification conditions, the most optimized conditions were selected considering the total amount of ① template DNA, ② PCR cycle, ③ PCR reaction solution, ④ Primer concentration, ⑤ annealing temperature, and ⑥ Extention time. When the PCR reaction solution was 20 μl, the template DNA and the primer concentration were most suitable in the range of 3.0 to 5.0 μl and the primer concentration of 0.5 μl, respectively. The PCR amplification conditions were annealing and extension temperature of 62 ° C., 33, and the final PCR cycle was 40 cycles. In addition, the mixed sauce showed the most effective amplification efficiency in the same PCR reaction solution and amplification conditions as sausage or broth.

Thus, 3.0 to 5.0 μl of template DNA (5 to 20 ng / μl), 10 μl of 2 × Cybr buffer, 0.5 μl of each primer (10 pmol) and 6.0 μl of dH 2 O were added to adjust the final DNA to 20 μl. The amplification conditions for the PCR reaction were pre-denaturation at 95 ° C for 1 minute, real-time PCR 7500 (Applied Biosystems, USA), denaturation at 95 ° C for 15 seconds, ) Was performed at 62 ° C for 33 seconds. The extension was repeated for 30 seconds at 72 ° C for a total of 40 times, followed by heating at 72 ° C for 10 minutes, and the gene amplification was terminated.

Example  4. Real- PCR  Species specificity test for amplification products

Real-time PCR amplification was performed to confirm whether the species-specific gene was correctly amplified and generated using DNA extracted from a standard sample and whether the gene cross-reacted with other species. The product was electrophoresed in 2% agarose gel containing TBE buffer (90 mM Tris-borate, 2 mM EDTA, pH 8.0) at 100 V constant voltage for about 1 hour. A 100 bp DNA ladder was loaded as a size marker. After completion of the electrophoresis, the gel was stained with GelRed, and specific DNA detection was confirmed by Gel Image Analyzer. Allelic discrimination plots and PCR amplification plots were confirmed using Realtime PCR 7500 software program (v.2.0.6). The amplification curves of real-time PCR products according to the respective raw materials are shown in Figs. 1 to 7.

As shown in FIGS. 1 to 7, the PCR amplification products on the agarose gel were detected, and DNA was detected only in the corresponding species, and nonspecific amplification products were not found. Also, in the real-time PCR reaction, amplification curves were confirmed only in species-specific primers.

Example  5. Real- PCR  Amplification Sensitivity to products

To verify the sensitivity, template DNA was diluted 10 times with 50 ng, 5.0 ng, 0.5 ng and 0.05 ng of DNA of animal species (cattle, pig, chicken, duck) and plant species (pepper, garlic, onion) And amplified with real-time PCR to perform sensitivity (minimum detection limit) test. In order to improve the reliability of the results, the experiment was repeated three times. The DNA sensitivity according to each raw material is shown in FIG. 8 to FIG.

As a result, the minimum detection limit for all species was found to be 0.05ng. That is, DNA of animal species and plant species was diluted to 50 ng, 5.0 ng, 0.5 ng and 0.05 ng, respectively, and the C _T values were analyzed to find that the cows were 25.87, 29.25, 34.15 and 38.65, and the pigs were 20.10, 22.35, 26.08 and 31.00 , 11.87, 15.10, 18.67 and 22.48 for the chicken, and 11.41, 14.56, 18.14 and 21.91 for the duck, respectively. The C _T values of the plant species were 29.23, 31.77, 34.21 and 35.80 in pepper, 11.22, 14.51, 17.93 and 21.53 in garlic and 23.19, 26.47, 30.21 and 33.79 in onion, respectively. When DNA was diluted differentially, the C _T value was found to be faster as the DNA concentration increased, and the C _T value was decreased as the DNA concentration was lower. The standard curve should be at least 0.98 in order to obtain useful information on the quantification and PCR amplification efficiency of the unknown sample, so that the reliability can be obtained by considering the value of the coefficient of determination (R ² ). As a result, the determination coefficient (R ² ) was found to be 0.98 or more over the standard curve, and it was confirmed that it was very suitable for quantitative determination.

<110> Defense Agency for Technology and Quality <120> PCR primer set for detecting or quantifying components in          processed products and methods for detecting or quantifying the          same <130> P16R13C1887 <160> 18 <170> Kopatentin 2.0 <210> 1 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> Meat_F <400> 1 agtgacgaaa aataacaata cagga 25 <210> 2 <211> 18 <212> RNA <213> Artificial Sequence <220> <223> Meat_R <400> 2 gctgctggca ccagactt 18 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Pig_FGF4_F <400> 3 caggatggaa agtaaccctg tc 22 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Pig_FGF4_R <400> 4 gaggcaactt ttgactggct a 21 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Chicken_RCP2-like_F <400> 5 ctgggttgaa aaggaccaca gt 22 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Chicken_RCP2-like_R <400> 6 gtgacgcact gaacaggttg 20 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Beef_FGF4_F <400> 7 gccgcgggat tgaaagtaa 19 <210> 8 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Beef_FGF4_R <400> 8 ggcagcggag ggtctaca 18 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Duck_ND2_F <400> 9 tctcaaccca gccctactta cc 22 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Duck_ND2_R <400> 10 gcctaggtgg gagatggatg a 21 <210> 11 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Seasoning_F <400> 11 cgcaaccctc gtgtttagtt 20 <210> 12 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> Seasoning_R <400> 12 gacacacgtg ctacaatgg 19 <210> 13 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Redpepper_CCS_F <400> 13 ctaatggaaa cccttctaaa gc 22 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Redpepper_CCS_R <400> 14 ggttggattt ggaaaagtgg 20 <210> 15 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Garlic_COX2_F <400> 15 aataattggc gatgtgtcgc tgt 23 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Garlic_COX2_R <400> 16 aaatgaatat actgggcgtg 20 <210> 17 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Onion_Alliinase_F <400> 17 gcattgctcg ataattcaga cag 23 <210> 18 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Onion_Alliinase_R <400> 18 tatgcatcag cggtaatgtc tc 22

Claims (8)

A primer set for detecting or quantifying a plant species comprising the nucleotide sequence of SEQ ID NO: 11 and SEQ ID NO: 12;
A primer set for detecting or quantifying red pepper comprising the nucleotide sequence of SEQ ID NO: 13 and SEQ ID NO: 14;
A primer set for detecting or quantifying garlic comprising the nucleotide sequence of SEQ ID NO: 15 and SEQ ID NO: 16; And
A primer set for detecting or quantifying a raw material in a processed food which has been subjected to heat treatment for at least one hour, comprising a primer set for onion detection or quantitation comprising the nucleotide sequence of SEQ ID NO: 17 and SEQ ID NO: 18. The method according to claim 1,
The primer set
A primer set for detecting or quantifying an animal species comprising the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2;
A primer set for pork detection or quantification comprising the nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: 4;
A primer set for detection or quantification of chicken comprising the nucleotide sequence of SEQ ID NO: 5 and SEQ ID NO: 6;
A primer set for beef detection or quantification comprising the nucleotide sequence of SEQ ID NO: 7 and SEQ ID NO: 8; And
A primer set for detecting or quantifying a raw material in a processed food, further comprising a primer set for detecting or quantifying duck meat comprising the nucleotide sequence of SEQ ID NO: 9 and SEQ ID NO: 10. A PCR kit for detecting or quantifying a raw material in a processed food which has been subjected to heat treatment for 1 hour or more containing the primer set of claim 1 or 2 and a PCR reaction mixture thereof. The method of claim 3,
The PCR reaction mixture contains a dNTP, a DNA polymerase and a buffer. A method for detecting a raw material in a processed food which has been heat-treated for at least 1 hour, comprising performing PCR using the primer set of claim 1 or 2 and analyzing the PCR product. 6. The method of claim 5,
For PCR product analysis,
When a 110 bp PCR product is amplified using a primer set consisting of the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2, one or more raw materials selected from the group consisting of pork, chicken, beef and duck meat in the processed food are contained ;
When a 132 bp PCR product is amplified using a primer set consisting of the nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: 4, the pork is contained in the processed food;
When a 165 bp PCR product is amplified using a primer set consisting of the nucleotide sequence of SEQ ID NO: 5 and SEQ ID NO: 6, the chicken is contained in the processed food;
When a 110 bp PCR product is amplified using a primer set consisting of the nucleotide sequence of SEQ ID NO: 7 and SEQ ID NO: 8, the beef is contained in the processed food;
When a 121 bp PCR product is amplified using a primer set consisting of the nucleotide sequence of SEQ ID NO: 9 and SEQ ID NO: 10, the duck meat is contained in the processed food;
Wherein the 189 bp PCR product is amplified using a primer set consisting of the nucleotide sequence of SEQ ID NO: 11 and SEQ ID NO: 12, and contains one or more raw materials selected from the group consisting of red pepper powder, garlic, and onion in the processed food;
When a PCR product of 102 bp is amplified using a primer set consisting of the nucleotide sequence of SEQ ID NO: 13 and SEQ ID NO: 14, red pepper powder is contained in the processed food;
When a 122 bp PCR product is amplified using a primer set consisting of the nucleotide sequence of SEQ ID NO: 15 and SEQ ID NO: 16, garlic is contained in the processed food; And
A primer set consisting of the nucleotide sequence of SEQ ID NO: 17 and SEQ ID NO: 18 is used to determine that the 182 bp PCR product is amplified and contains onion in the processed food. Performing real-time PCR on real-time PCR using the primer set of claim 1 or 2, and analyzing real-time PCR products for 1 hour or more A method for quantifying a raw material in a heat treated processed food. 8. The method of claim 7,
The step of performing the real-
A method for quantifying a raw material in a processed food, wherein a mixing ratio of the raw materials in the processed food is determined by sequentially performing real-time PCR on the respective primer sets of the raw material detection or quantitative primer set in the processed foods of claims 1 or 2.

Images