KR101829230B1 - Primer set for detecting raw meat from processed meat product and uses thereof - Google Patents

Abstract

The present invention relates to an oligonucleotide primer set for detecting a meat source in a processed livestock product, which comprises one or more primer sets selected from the group consisting of an oligonucleotide primer set of sequence number 1 and sequence number 2; an oligonucleotide primer set of sequence number 3 and sequence number 4; and an oligonucleotide primer set of sequence number 5 and sequence number 6. Additionally, the present invention relates to a method of detecting a meat source in a processed livestock product by using the oligonucleotide primer set. The method of the present invention can contribute to establishing safety for processed products by clearly detecting false entries in ingredients of food items, and may be beneficially used in the inspection of import/export processed livestock products, inspection of ingredients in halal food items, and the like.

Description

[0001] PRIMER SET FOR DETECTING RAW MATERIAL FROM LIVER PRODUCTS AND USE THEREOF [0002]

More particularly, the present invention relates to a primer set for detecting livestock raw materials in processed livestock products, and more particularly to a livestock raw material used for processing raw livestock products such as beef and pork Meat or chicken).

Although the consumption of processed livestock products is growing to the level of 1.12 trillion won in 2012, there are problems such as stability because the raw materials can not be visually confirmed. In particular, consumer accidents are increasing due to incidents such as the use of inexpensive food ingredients or the induction of allergic diseases caused by fake foods that misrepresent the raw ingredients of foods. Therefore, there is a need for a method that can accurately detect raw material components of livestock products for processed livestock products.

The existing method of discriminating raw materials of livestock products is to extract the total DNA from the raw materials of livestock meat raw materials (unprocessed raw meat raw materials) used in processed livestock products and to identify the raw materials of livestock products by the polymerase chain reaction (PCR) No method has been developed to identify the raw materials of livestock as a sample.

The present inventors extracted total DNA directly from processed livestock products containing various food additives, differently from the method of extracting total DNA from raw materials of livestock meat and discriminating raw materials by PCR, We have developed a method to accurately identify the raw materials used in livestock products by optimizing the PCR conditions after producing specific primers capable of amplifying the target gene.

Meanwhile, Korean Patent Registration No. 1296221 discloses 'a method for distinguishing a species using a polymerase chain reaction', Korean Patent No. 0527793 discloses 'a probe for discriminating a Korean beef meat and a method for distinguishing a Korean beef meat using the same' The primer set for detecting raw meat from the processed livestock product of the present invention and its use have not been described.

SUMMARY OF THE INVENTION The present invention has been made in view of the above-mentioned needs, and it is an object of the present invention to provide a PCR primer for discriminating raw meat ingredients from a conventional livestock product, The present inventors extracted total DNA directly from processed products of livestock products and prepared new primers that selectively bind to bean, pork and chicken breeds to optimize conditions of PCR reaction Respectively. Thereafter, the present inventors completed the present invention by accurately discriminating the contents of the respective veterinary components from a variety of commercially available livestock product products as a result of discriminating the presence or absence of each veterinary species in the extracted DNA samples.

In order to solve the above problems, the present invention provides an oligonucleotide primer set of SEQ ID NO: 1 and SEQ ID NO: 2, an oligonucleotide primer set of SEQ ID NO: 3 and SEQ ID NO: 4, and an oligonucleotide primer set of SEQ ID NO: A set of oligonucleotide primers for detecting livestock raw material in an animal product processed product, comprising at least one primer set selected from the group consisting of:

The present invention also provides a kit for detecting an animal food raw material in an animal product processed product, which comprises the oligonucleotide primer set and a reagent for carrying out an amplification reaction.

In addition, the present invention provides a method for isolating total raw DNA directly from a processed livestock product, and detecting the livestock raw material in the processed livestock product using the oligonucleotide primer set.

The method of detecting the raw material of livestock products in the processed livestock products of the present invention is to detect the use of the respective species by extracting the DNA samples directly from the processed livestock products and thereby to clearly distinguish the false livestock of the raw materials of the foodstuffs, , And it can be usefully used in the field of discriminating the presence or absence of ingredients in processed livestock products such as censoring of processed livestock products or inspection of ingredients of halal foods.

FIG. 1 shows electrophoresis results of PCR products using primers of the present invention using total DNA extracted from beef, pork and chicken meat. FIG. A, PCR results using beef specific primers; B, PCR results using pork-specific primers; C, PCR results using chicken specific primers; M, 100 bp DNA size marker; 1, beef; 2, pork; 3, chicken; 4, duck meat.
FIG. 2 is a graph showing the results of PCR (a) and product livestock products (Table 1) obtained using the beef-specific primers of the present invention in Table 1 for pork products, (B) and the livestock products processed in Table 1 were subjected to PCR using a primer specific to the chicken of the present invention.
Fig. 3 shows the result of PCR using the known primers for the livestock product processed in the livestock products of Table 1, wherein a is a beef, b is pork, and c is a chicken-specific primer. The sample number indicated in red in each figure means the sample containing the raw meat of the corresponding species.

In order to accomplish the object of the present invention, the present invention provides a kit comprising an oligonucleotide primer set of SEQ ID NOs: 1 and 2, an oligonucleotide primer set of SEQ ID NOs: 3 and 4, and an oligonucleotide primer set of SEQ ID NOs: 5 and 6 A set of oligonucleotide primers for detecting raw meat in an animal product processed product comprising at least one primer set.

The term "processed livestock products" means processed meat products based on livestock products such as packed meat, seasoned meat, sausage, ham, bacon, and jerky, and "raw meat" refers to beef, pork or chicken Of the raw materials of the livestock products.

The oligonucleotide primer set of the present invention may preferably comprise one or more than two primer sets selected from the group consisting of the above three oligonucleotide primer sets, and may include all three primer sets.

The oligonucleotide primer sets of the present invention include oligonucleotide primer sets of SEQ ID NO: 1 and SEQ ID NO: 2 for amplifying the mitochondrial 16S rRNA gene of beef, SEQ ID NO: 3 for amplifying the cytochrome B gene of pork, SEQ ID NOS: 1, 3 and 5 are forward primers and SEQ ID NOS: 2, 4, and 6 are set as oligonucleotide primer sets of SEQ ID NO: 5 and SEQ ID NO: 6 amplifying the oligonucleotide primer set of SEQ ID NO: 4 and cytochrome B gene of chicken, 6 is a reverse primer.

The oligonucleotide primers of the present invention may be selected from the group consisting of SEQ ID NOs: 1 and 2; SEQ ID NOS: 3 and 4; And oligonucleotides comprised of fragments of at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 contiguous nucleotides in SEQ ID NOs: 5 and 6. For example, a primer (22 oligonucleotides) of SEQ ID NO: 1 may comprise at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 nucleotides in the sequence of SEQ ID NO: RTI ID = 0.0 > oligonucleotides < / RTI > In addition, the primers include SEQ ID NOs: 1 and 2; SEQ ID NOS: 3 and 4; And addition, deletion or substitution of the nucleotide sequences of SEQ ID NOS: 5 and 6.

In the present invention, the term "primer " refers to a single strand of oligonucleotide sequence complementary to a nucleic acid strand to be duplicated, and may serve as a starting point for synthesis of a primer extension product. The length and sequence of the primer should allow the synthesis of the extension product to begin. The specific length and sequence of the primer will depend on the primer usage conditions such as temperature and ionic strength, as well as the complexity of the desired DNA or RNA target.

As used herein, an oligonucleotide used as a primer may also include a nucleotide analogue, such as phosphorothioate, alkylphosphorothioate, or peptide nucleic acid, or alternatively, And may include an intercalating agent.

In addition, the present invention provides a kit for detecting raw meat in a processed livestock product comprising the oligonucleotide primer set. In the kit of the present invention, the reagent for carrying out the amplification reaction may include DNA polymerase, dNTPs, buffer and the like. In addition, the kit of the present invention may further include a user guide describing optimal reaction performing conditions. The manual is a printed document that explains how to use the kit, for example, how to prepare PCR buffer, the reaction conditions presented, and so on. The brochure includes instructions on the surface of the package including the brochure or leaflet in the form of a brochure, a label attached to the kit, and a kit. In addition, the brochure includes information that is disclosed or provided through an electronic medium such as the Internet.

The present invention also relates to

Isolating total DNA from the livestock product;

Amplifying the target sequence by performing amplification reaction using the separated total DNA as a template and using the oligonucleotide primer set as described above; And

And detecting the amplified product. The present invention also provides a method for detecting raw meat in a processed livestock product.

The method of the present invention comprises isolating total DNA directly from the livestock product. A method known in the art may be used for separating the total DNA from the sample. For example, the CTAB method may be used, or a Wizard prep kit (Promega) may be used. Using the separated total DNA as a template, the target sequence can be amplified by carrying out an amplification reaction using one or more oligonucleotide primer sets according to one embodiment of the present invention as a primer. Methods for amplifying a target nucleic acid include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification system, Strand displacement amplification or amplification with Q [beta] replicase, or any other suitable method for amplifying nucleic acid molecules known in the art. Among them, PCR is a method of amplifying a target nucleic acid from a pair of primers that specifically bind to a target nucleic acid using a polymerase. Such PCR methods are well known in the art, and commercially available kits may be used.

In the method of the present invention, the amplified target sequence may be labeled with a detectable labeling substance. In one embodiment, the labeling material may be, but is not limited to, a fluorescent, phosphorescent or radioactive substance. Preferably, the labeling substance is Cy-5 or Cy-3. When the target sequence is amplified, PCR is carried out by labeling the 5'-end of the primer with Cy-5 or Cy-3, and the target sequence may be labeled with a detectable fluorescent labeling substance. When the radioactive isotope such as ³² P or ³⁵ S is added to the PCR reaction solution, the amplification product may be synthesized and the radioactive substance may be incorporated into the amplification product and the amplification product may be labeled as radioactive. The set of one or more oligonucleotide primers used to amplify the target sequence is as described above.

In the method of the present invention, a method for detecting raw meat in a processed livestock product product comprises the step of detecting the amplification product, wherein the detection of the amplification product is carried out using a DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement , But is not limited thereto. As one method of detecting the amplification product, gel electrophoresis can be performed. Gel electrophoresis can be performed using agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product. Also, in the fluorescence measurement method, Cy-5 or Cy-3 is labeled at the 5'-end of the primer. When PCR is carried out, the target is labeled with a fluorescent label capable of detecting the target sequence. The labeled fluorescence is measured using a fluorescence meter can do. In addition, in the case of performing the PCR, the radioactive isotope such as ³² P or ³⁵ S is added to the PCR reaction solution to mark the amplification product, and then the radioactivity is measured by a radioactive measuring device such as a Geiger counter or liquid scintillation The radioactivity can be measured using a liquid scintillation counter.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

Materials and methods

Purchase livestock products

In order to develop a PCR method for detection of raw ingredients from processed livestock products, the products sold at livestock processed food stores in Jinju, Gyeongsangnam-do were randomly purchased. Table 1 below summarizes the types of raw meat listed in the raw material display phrase of the processed livestock product purchased.

Livestock raw material composition chart of processed livestock products Processed product Pork chicken beef duck meat Processed product Pork chicken beef duck meat One + - + - 45 + - - - 2 + - - - 46 + - - - 3 + - - - 47 + + - - 4 + - - - 48 + + - - 5 + - - - 49 + + - - 6 + - - - 50 + - - - 7 + - - - 51 - - + - 8 + - + - 52 - - - + 9 + - - - 53 - - + - 10 + - - - 54 + - - - 11 + - + - 55 + - - - 12 + - + - 56 + - - - 13 + + - - 57 + - - - 14 - + - - 58 - + - - 15 - + - - 59 + - - - 16 - + - - 60 + - - - 17 - - - + 61 + - + - 18 - + - - 62 + - - - 19 - + - - 63 + - - - 20 - + - - 64 + - + - 21 + - - - 65 - + - - 22 + + - - 66 - + - - 23 + - + - 67 - + - - 24 - - - + 68 - + - - 25 + - - - 69 - + - - 26 + + - - 70 + + - - 27 + - - - 71 + - - - 28 + - - - 72 + - - - 29 + - - - 73 - - + - 30 + + - - 74 + - + - 31 + - - - 75 + - + - 32 + - - - 76 + + + - 33 + - - - 77 + - + - 34 - + - - 78 + - - - 35 + - - - 79 + - - - 36 + - - - 80 + - - - 37 + - - - 81 + + - - 38 + + + - 82 - - + - 39 + - - - 83 - - + - 40 + + - - 84 - - + - 41 + - - - 85 - - + - 42 + - - - 86 - - + - 43 + - + - 87 - + - - 44 - - + -

Total DNA extraction and quantification

As a positive control for PCR reactions, beef, pork, chicken, and duck meat were used. 20 mg of the control and growth products were pulverized with a BioMasher Ⅱ disposable homogenizer (Nippi Inc., Japan) and the total DNA was extracted using the Exgene ^TM Cell SV kit (GeneAll, Korea) according to the manufacturer's instructions . The extracted total DNA was quantitated using NanoDrop 1000 (Thermo fisher scientific, USA) and a certain amount was used for the PCR reaction.

Primer preparation and polymerase chain reaction (PCR)

Primers that specifically bind to beef, pork, and chicken can be found in Genbank (https://www.ncbi.nlm.nih.gov/gene/), a genome of mitochondrial DNA (mtDNA) corresponding to each raw material, After confirming homology using the ClustalW Omega program (https://www.clustal.org), find a region that is not homologous to each raw material and try to avoid the non-specific binding site of the primer Respectively. Primer information specific to the prepared beef, pork or chicken is shown in Table 2 below.

The primer base sequence information of the present invention primer The primer sequence (5 'to 3') Target gene beef
(cattle) CF CTCACAAACAGTTTACCAAGAAC (SEQ ID NO: 1) mitochondrial
16S rRNA CR GCTACAGTGGGGTTTATTTG (SEQ ID NO: 2) Pork
porcine PF TTACCGTTATAGCAACAGCC (SEQ ID NO: 3) Cytochrome B PR GAGGGCGGTAATGATGAATG (SEQ ID NO: 4) chicken
(chicken) CHF CAAACGGCGCCTCATTCTTC (SEQ ID NO: 5) Cytochrome B CHR TTGCAAAGGGGAGGAGGAAG (SEQ ID NO: 6)

In addition, a known PCR primer sequence proved to be able to confirm the kind of the raw material of the livestock product was synthesized and a comparative experiment was carried out together. The PCR primers used in the comparative experiments were reviewed in the journal of Tanabe S et al. (2007, Biosci. Biotechnol. Biochem 71: 3131-3135) Table 3 shows the results.

For PCR, the concentration of total DNA was 5 ng / μl for beef detection, 15 ng / μl for pork, and 1 ng / μl for chicken, and 10 pmole forward and reverse primers were used for each 2 4 μl of dNTPs (2.5 mM each), 5 μl of 10 × PCR buffer (containing MgCl ₂ ), 1 unit of Taq DNA polymerase was added and the final reaction volume was adjusted to sterile purified water , And Bio-Rad T100 PCR instrument (Bio-Rad, USA). The PCR conditions are shown in Table 4 below.

To confirm the final PCR reaction product, 10 μl of 6X DNA loading reagent was added to the PCR reaction product, and the mixture was loaded on 2% agarose gel and electrophoresed at 100 V for 30 minutes. The gel was then stained with EtBr (1 ug / ml) and photographed using a gel-doc (Bio-Rad) instrument.

Example 1. Analysis of raw materials of livestock products in processed livestock products

The presence or absence of raw materials for livestock products was confirmed by using the primer set of the present invention as a processed product of livestock products (Table 1) distributed on the market.

As a result, the results of the presence or absence of raw materials for livestock products in processed livestock products using the primers of the present invention were confirmed to be consistent with the raw material (raw materials) of the respective processed products shown in Table 1 (Fig. 2). That is, the primer set and the PCR conditions of the present invention can clearly confirm the ingredient of raw meat even if the nucleic acid sample is directly extracted from the processed processed livestock product containing various food additives and then subjected to PCR. Could know.

On the other hand, the result of the discrimination test of raw material for livestock products in the processed livestock products using the known primers, in which the beef, pork or chicken can be identified, was confirmed to be inconsistent with the items shown in Table 1 (FIG. Specifically, as a result of PCR using a species-specific primer targeting cytochrome B of beef, positive results were confirmed in one sample (Sample No. 1) as shown in FIG. 3A (Sample No. 1), but in some samples, non-specific reactions (Sample Nos. 23, 44, and 53). In the other samples, PCR reaction was not observed (Sample Nos. 8, 11, 12, 38, 43, and 51). Namely, the results of the PCR reaction in which the nucleic acid was directly extracted from the livestock product processed food using the known primer, the presence or absence of the raw meat could not be clearly discriminated. As for the case of pork and chicken, it was not possible to clearly determine whether or not the raw material was contained in the result of the PCR reaction by directly extracting the nucleic acid from the processed livestock product using the known primer, similar to the case of the beef.

From the above results, it can be seen that the method of detecting the raw meat from the specific primer set for each kind of the present invention and the processed livestock product using the same can clearly confirm the raw meat by extracting the nucleic acid sample directly from the processed product containing various additives And it was found. Therefore, the method of the present invention was expected to be highly applicable in the field of food stability test such as the false substrate of the raw material ingredient in the processed livestock products.

<110> INDUSTRY-ACADEMIC COOPERATION FOUNDATION GYEONGSANG NATIONAL UNIVERSITY <120> Primer set for detecting raw meat from processed meat product and          uses thereof <130> PN16434 <160> 12 <170> Kopatentin 2.0 <210> 1 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 ctcacaaaca gtttaccaag aac 23 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 gctacagtgg ggtttatttg 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 ttaccgttat agcaacagcc 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 gagggcggta atgatgaatg 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 caaacggcgc ctcattcttc 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 ttgcaaaggg gaggaggaag 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 cccgattctt cgctttccat 20 <210> 8 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 ctacgtctga ggaaattcct gttg 24 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 cttgcaaatc ctaacaggcc tg 22 <210> 10 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 cgtttgcatg tagatagcga ataac 25 <210> 11 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 tctgggctta actctcatac tcacc 25 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 ggttactagt gggtttgctg gg 22

Claims (8)

An oligonucleotide primer set of SEQ ID NO: 1 and SEQ ID NO: 2, an oligonucleotide primer set of SEQ ID NO: 3 and SEQ ID NO: 4, and an oligonucleotide primer set of SEQ ID NO: 5 and SEQ ID NO: 6, Or an oligonucleotide primer set for detecting chicken delete delete A kit for detecting beef, pork or chicken from an animal product, comprising the oligonucleotide primer set of claim 1 and a reagent for carrying out an amplification reaction. 5. The kit according to claim 4, wherein the reagent for carrying out the amplification reaction comprises a DNA polymerase, dNTPs and a buffer. Isolating total DNA from the livestock product;
Amplifying the target sequence by performing amplification reaction using the separated total DNA as a template and using the oligonucleotide primer set of claim 1; And
And detecting the amplified product. &Lt; Desc / Clms Page number 19 &gt; 7. The method of claim 6, wherein the amplified target sequence is labeled with a fluorescent, phosphorescent, or radioactive substance. 7. The method according to claim 6, wherein the detection of the amplification product is performed by DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement.

Images