KR101825596B1 - CaLOP gene from Capsicum annuum regulating growth, development and disease resistance of plant and uses thereof - Google Patents

Abstract

When TMV-P0, TMV-P2, PepMoV, and red chili pathogen are individually inoculated to plants, stronger expression of CaLOP genes are confirmed compared to a comparison group without any pathogen. When the virus-induced gene silencing (VIGS) method is used to induce the silence of the GaLOP genes derived from red chili, the plants died while having reduced plant height and leaf areas. Accordingly, the GaLOP genes derived from the red chili, which can adjust the plant growth, development, and disease resistance, can be used to promote the growth and development of the plants while obtaining plants with strong disease resistance, thereby contributing to significantly improving the production, quality, and production efficiency of the cost-efficient crops.

Description

The present invention relates to a CaLOP gene derived from pepper that regulates plant growth, development and disease resistance, and a use thereof.

The present invention relates to a CaLOP gene derived from pepper and its use for regulating plant growth, development and disease resistance.

Plants have a system to cope with and adapt to various environmental changes by controlling growth and development. Environmental stimuli and plant development programs throughout the entire life-span from seed germination to flowering are known to increase plant survival suitability through constant interactions. It is known that the regulation of the development of a plant by such environmental stimuli is mainly caused by the interaction with the external environment and the intrinsic developmental program of the plant. And plants have evolved to protect themselves by activating immune responses against invading various pathogens and external stimuli. However, despite this resistive response, if a plant is threatened by external stimuli or disease, the production and quality of the crop will be lowered, causing economic damage. In order to minimize these damages, programs for breeding of disease-resistant varieties of various economic crops including pepper have been steadily progressed. To understand the disease resistance and practical application, As a model.

Capsicum annuum ) is a crop belonging to the genus Cucumis, originating in South America and cultivated worldwide and used as a spice and red pigment. However, the red pepper is caused by various pathogens such as virus, plague, and anthrax, resulting in a loss of 10 ~ 30% of the total yield each year. Therefore, stable productivity and development of disease-resistant varieties are important goals of the breeding of the capsicum. In recent years, the analysis of whole nucleotide sequence of pepper has been completed and studies on identification of disease resistance factor of pepper have been accelerated. However, research on the stable growth and development of pepper is still in its infancy compared to economic and industrial importance and other crops.

On the other hand, Chinese Patent No. 103667265 discloses a method for controlling the plant disease resistance of a tomato-derived LOX gene. However, the CaLOP gene derived from pepper controlling the growth, development and disease resistance of the plant of the present invention and its use It has not yet been disclosed.

The present invention has been made in view of the above-mentioned needs, and the present inventors have found that TMV-P0, TMV-P2, PepMoV (pepper mottle virus) and Phytophthora capsici) to when each inoculated on pepper plants, in contrast to the control not inoculated with the pathogen and the CaLOP (Capsicum annuum lipoxgenase homology protein) gene strongly expressed, using a virus-based gene silencing techniques (Virus-induced Gene Silencing, VIGS) The present inventors have completed the present invention by confirming that when a phenotype of a pepper plant in which a CaLOP gene is silenced is analyzed and phenotype is analyzed, the plant height and leaf area are decreased.

In order to achieve the above object, the invention is by transforming the plant cell with a pepper-derived CaLOP (Capsicum annuum lipoxygenase protein homology) recombinant containing the gene encoding the protein vector CaLOP A method for regulating the growth, development and disease resistance of a plant comprising the step of regulating gene expression.

The present invention also relates to a method for producing a transformed plant, which comprises transforming a plant cell with a recombinant vector comprising a gene encoding CaLOP ( Capsicum annuum lipoxygenase homology protein) protein derived from pepper, A method for producing a plant is provided.

In addition, the present invention provides a transgenic plant having controlled growth, development and disease resistance of the plant produced by the above method, and a transformed seed thereof.

The present invention also provides a composition for regulating the growth, development and disease resistance of a plant containing, as an active ingredient, a gene encoding CaLOP ( Capsicum annuum lipoxygenase homology protein) protein derived from pepper.

In the present invention, when the TMV-P0, TMV-P2, PepMoV, and pepper-eradicating bacteria were inoculated into the plant, the CaLOP gene was strongly expressed against the control group not inoculated with the pathogen, Virus-induced Gene Silencing (VIGS) was used to induce the silencing of CaLOP gene from pepper. Therefore, the CaLOP gene derived from pepper, which regulates the growth, development and disease resistance of the plant of the present invention, promotes the growth and development of the plant and obtains a plant having high resistance to disease, It can contribute greatly to increase production efficiency.

Brief Description of the Drawings Fig. 1 shows the nucleotide sequence of the pepper-derived CaLOP gene of the present invention and the nucleotide sequence comparison (A) of the homologous genes thereof and the domain structure (B) of the CaLOP gene. CaTin1 and CaTin1 -2 gene in pepper stems; Sotub03g021410 and Sotub03g021420 are potato-derived genes; Niben101Scf05326g00010.1 and Niben101Scf05326g00012 . 1 is a gene derived from tobacco; Solyc03g096540 and Solyc03g096550 are genes derived from tomato; Os02g51710 is a gene derived from rice; And AT2G22170 are genes derived from Arabidopsis.
Fig. 2 shows a flexible relationship between the pepper-derived CaLOP gene of the present invention and its homologous genes.
Fig. 3 shows the expression patterns of the pepper-derived CaLOP gene of the present invention and its homologous gene CaTin1 by the plant tissues of the paprika. PL is Placenta; PR is the Pericarp; MG is the green of fruit; B is a fruit discolouring machine; And DPA (day post-synthesis) mean post-flowering.
FIG. 4 is a graph showing the results of the detection of TMV-P0 (tobacco mosaic virus-P0) (A), TMV-P2 (tobacco mosaic virus-P2), PepMoV (pepper mottle virus), and Phytophthora capsici ) Were respectively inoculated into the capsicum plants, the expression patterns of the CaLOP gene of the present invention and its homologous homologous gene CaTin1 were shown.
FIG. 5 is a graph showing the relationship between the CaLOP gene of the present invention and its homologous homologous gene CaTin1 The vector structure of TRV-CaLOP (A) and TRV-CaTin1 (B) used for silencing induction is shown.
FIG. 6 is a graph showing the relationship between the CaLOP (A) and RT-PCR analysis (B) of the pepper plants with silenced genes.
FIG. 7 is a graph showing the effect of the CaLOP The results of analysis of phenotypic phenotype of gene silenced (A) and CaLOP Gene and CaTin1 (B) and plant height (C) of the pepper plants with silenced genes.

According to an aspect of the invention, the invention is by transforming the plant cell with a pepper-derived CaLOP (Capsicum annuum lipoxygenase protein homology) recombinant containing the gene encoding the protein vector CaLOP A method for regulating the growth, development and disease resistance of a plant comprising the step of regulating gene expression.

In the method according to an embodiment of the present invention, the CaLOP protein may be an amino acid sequence of SEQ ID NO: 2, and the CaLOP gene may be a nucleotide sequence of SEQ ID NO: 1, but is not limited thereto. In addition, homologues of the nucleotide sequences are included within the scope of the present invention. Specifically, the gene has a nucleotide sequence having a sequence homology of 70% or more, more preferably 80% or more, still more preferably 90% or more, and most preferably 95% or more, with the nucleotide sequence of SEQ ID NO: 1 . "% Of sequence homology to polynucleotides" is ascertained by comparing the comparison region with two optimally aligned sequences, and a portion of the polynucleotide sequence in the comparison region is the reference sequence for the optimal alignment of the two sequences (I. E., A gap) relative to the < / RTI >

In a method according to an embodiment of the present invention, the growth, development and disease resistance of a plant may be reduced by inhibiting the CaLOP gene expression, but not limited thereto.

In addition, the growth and development of the plant may be reduced or depleted in leaf area and plant height compared to the wild type plant, but the present invention is not limited thereto.

The term "recombinant" refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a protein encoded by a peptide, heterologous peptide or heterologous nucleic acid. The recombinant cell can express a gene or a gene fragment that is not found in the natural form of the cell in one of the sense or antisense form. In addition, the recombinant cell can express a gene found in a cell in its natural state, but the gene has been modified and reintroduced intracellularly by an artificial means.

In the present invention, the CaLOP gene sequence can be inserted into a recombinant vector. The term "vector" is used to refer to a DNA fragment (s), nucleic acid molecule, which is transferred into a cell. The vector replicates the DNA and can be independently regenerated in the host cell. The term "carrier" is often used interchangeably with "vector ". The recombinant vector means a bacterial plasmid, a phage, a yeast plasmid, a plant cell virus, a mammalian cell viral vector, or other vector. In principle, any plasmid and vector can be used if it can replicate and stabilize within the host. An important characteristic of the expression vector is that it has a replication origin, a promoter, a marker gene and a translation control element.

Expression vectors containing sequences of each of the CaLOP genes and appropriate transcription / translation control signals can be constructed by methods known to those skilled in the art. Such methods include in vitro recombinant DNA technology, DNA synthesis techniques, and in vivo recombination techniques. The DNA sequence can be effectively linked to appropriate promoters in the expression vector to drive mRNA synthesis. The expression vector may also include a ribosome binding site and a transcription terminator as a translation initiation site.

A preferred example of the recombinant vector of the present invention is a Ti-plasmid vector capable of transferring a so-called T-region to a plant cell when present in a suitable host, such as Agrobacterium tumefaciens. Other types of Ti-plasmid vectors (see EP 0 116 718 B1) are currently used to transfer hybrid DNA sequences to plant cells or protoplasts in which new plants capable of properly inserting hybrid DNA into the plant's genome can be produced have. A particularly preferred form of the Ti-plasmid vector is a so-called binary vector as claimed in EP 0 120 516 B1 and U.S. Patent No. 4,940,838. Other suitable vectors that can be used to introduce the DNA according to the invention into the plant host include viral vectors such as those that can be derived from double-stranded plant viruses (e. G., CaMV) and single- For example, from non -complete plant virus vectors. The use of such vectors may be particularly advantageous when it is difficult to transform the plant host properly.

In the recombinant expression vector of the present invention, the promoter may be, but is not limited to, the CaMV 35S promoter, the actin promoter, the ubiquitin promoter, the pEMU promoter, the MAS promoter, the histone promoter or the Clp promoter, . The term "promoter " refers to a region above the DNA from the structural gene and refers to a DNA molecule to which an RNA polymerase binds to initiate transcription. A "plant promoter" is a promoter capable of initiating transcription in plant cells. A "constitutive promoter" is a promoter that is active under most environmental conditions and developmental conditions or cell differentiation. In the present invention, the use of a constant promoter may be desirable. Therefore, the constant promoter does not limit the selectivity.

In the recombinant vector of the present invention, conventional terminators can be used. Examples thereof include nopaline synthase (NOS), rice α-amylase RAmy1 A terminator, Agrobacterium but are not limited to, the Octopine gene terminator of the tumefaciens , the phaseoline terminator of E. coli, and the rrnB1 / B2 terminator of E. coli. Regarding the need for a terminator, it is generally known that the terminator region increases the certainty and efficiency of gene transcription in plant cells. Therefore, the use of a terminator is highly desirable in the context of the present invention.

The recombinant vector may preferably comprise one or more selectable markers. The marker is typically a nucleic acid sequence having a property that can be selected by a chemical method, and includes all genes capable of distinguishing a transformed cell from a non-transformed cell. Examples include herbicide resistance genes such as glyphosate or phosphinothricin, antibiotics such as kanamycin, hygromycin, chloramphenicol, G418, Bleomycin, Resistant gene, aadA gene, and the like, but are not limited thereto.

The method of delivering the vector of the present invention into a host cell can be carried out by the CaCl ₂ method, one method (Hanahan, D., J. MoI. Biol., 166: 557-580 (1983)) when the host cell is a prokaryotic cell, And an electric drilling method or the like. In addition, when the host cell is a eukaryotic cell, it can be produced by a method such as gene bombardment, Agrobacterium-mediated transformation, microinjection, calcium phosphate precipitation, electroporation, liposome- The vector may be injected into the host cell by DEAE-dextran treatment or the like, but is not limited thereto.

The present invention also provides a method for producing a plant cell, comprising the steps of: transforming a plant cell with a recombinant vector comprising a gene encoding CaLOP ( Capsicum annuum lipoxygenase homology protein) protein of pepper, which is composed of the amino acid sequence of SEQ ID NO: 2; And

And regenerating the plant from the transformed plant cell. The present invention also provides a method of producing a transgenic plant having regulated plant growth, development and disease resistance.

The method of transforming the plant cell is as described above.

In addition, the method of the present invention comprises regenerating a transgenic plant from the transformed plant cell. Regeneration of transgenic plants can be carried out by any method known in the art. Techniques for the regeneration of mature plants from callus or protoplast cultures are well known in the art for a number of different species.

In addition, the present invention provides a transgenic plant having controlled growth, development and disease resistance of the plant produced by the above method, and a transformed seed thereof.

The plant may be selected from the group consisting of monocot plants such as rice, barley, wheat, rye, corn, sorghum, oats and onions or potatoes, potatoes, eggplant, tobacco, pepper, tomato, burdock, cilia, lettuce, spinach, And can be dicot plants such as celery, carrot, buttercup, parsley, cabbage, cabbage, gab, watermelon, melon, cucumber, amber, pak, strawberry, soybean, mung bean, kidney bean and pea. Preferably, it is a pepper plant, but is not limited thereto.

Further, the present invention provides a composition for regulating the growth, development and disease resistance of a plant comprising, as an active ingredient, a gene encoding CaLOP ( Capsicum annuum lipoxygenase homology protein) protein derived from pepper which is composed of the amino acid sequence of SEQ ID NO: 2. The composition comprises a gene encoding an CaLOP protein consisting of the amino acid sequence of SEQ ID NO: 2 as an active ingredient. By transforming the recombinant vector containing the CaLOP gene or the CaLOP gene into a plant, the growth, development and disease resistance Can be adjusted.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are merely illustrative of the present invention and that the scope of the present invention is not limited thereto.

Materials and methods

1. Plant materials, virus-based gene silencing techniques and phenotypic analysis of plants

The red pepper was grown in a growth chamber at 23 ° C. for 16 hours under light and 8 hours in dark condition and modified by TRV (tobacco rattle virus) -based VIGS (virus-induced gene silencing) . CaTin1 with pTRV1 And CaLOP gene the two types of Agrobacterium the pTRV2 vector Solarium Tome Pacific Enschede (Agrobacterium cloning each tumefaciens ). The CaTin1 And CaLOP gene were incubated in a YEP (yeast extract peptone) liquid medium containing 50 mg / ml of rifampicin and 50 mg / ml of kanamycin for 2 days at 30 ° C. After the incubation, Agrobacterium tumefaciens The culture of Tumefaciens was centrifuged to precipitate the cells, which were then dissolved in permeation buffer (10 mM MES and 10 mM MgCl ₂ , pH 5.5), and the absorbance of the culture was determined to be 0.5 (Optical density, OD = 0.5) Acetosyringone was added and cultured at room temperature for 3 to 5 hours. Then, TRV1 vector and Agrobacterium containing TRV2 vector cloned with each gene were mixed at a ratio of 1: 1. Then, the culture was inoculated into the back of the cotyledon of red pepper with 1 ml of syringe and cultivated for 24 hours at 16 ° C in a growth chamber at 23 ° C for 16 hours light and 8 hours dark. Phenotypic analysis was carried out on the 5th plant after the inoculation, and the height and leaf area of the plant were measured. The leaf area was measured by collecting the third leaf of each plant. Statistical analysis was performed by ANOVA using the SPSS program (PASW statistics 18, Chicago, USA). The mean comparison between the variance analyzes was performed using the multiple comparison method of Turkey (Tukey).

2. Analysis of gene sequence, structure and evolution

The CaTin1 used in the present invention And CaLOP The entire sequence of the gene was verified and secured based on the pepper genome site (http://genome.pepper.snu.ac.kr/), and the structural analysis of the two genes was performed by Smart (http: //smart.embl-heidelberg .de /) was used. Orthologous genes in other crop genomes were identified using Tomato genome protein sequences (ITAG release 2.40), potato (ITAG release 2.40), and tomato (Tomato genome) using a database of SOL (sol genomic network, https://solgenomics.net/) 1 predicted proteins (ST1.0)) and tobacco ( N. benthamiana genome v1.0.1 predicted proteins), and rice was identified as RGAP (rice genome annotation project, Gene in MSU RGAP Release 7-protein sequences, /rice.plantbiology.msu.edu/), Arabidopsis thaliana sequenced the gene using a database of TAIR (Arabidopsis information resource, TAIR10 Proteins (protein), https://www.arabidopsis.org). The MSA (Multiple Sequence Alignment) uses the T-coffee program of EBI (http://www.ebi.ac.uk/) and the evolutionary tree analysis uses MEGA7 (http://www.megasoftware.net) /) Program was used. Neighbor-joining was used for the statistical method, and the phylogenetic experiment was repeated 100 times by the bootstrap method. The substitution model is JTT (Jones-Taylor-Thornton) model, and the ratio between the parts is the uniform rate. Partial deletion of blank and bad data was performed and overlapping of less than 95% was removed.

3. RT- PCR (Reverse transcription polymerase chain reaction)

The total RNA was extracted from the 3rd or 4th leaf of the 5th plant after virus-induced gene silencing (VIGS), and the RNA was extracted using triazole (Invitrogen, Carlsbad, CA, USA) Respectively. cDNA synthesis was performed using M-MLV reverse transcriptase (Promega, Madison, USA) and according to manufacturer's instructions. Was used CaTin1 _C_F (SEQ ID NO: 3, GGCAGTGGTTACGACTACTT), CaTin1 _C_R (SEQ ID NO: 4, CATGATAGGACTGAGGATCG), CaLOP _N_F (SEQ ID NO: 5, ACTGCCATGGGAGTAGCTCAGGT) and CaLOP _F_C_R (SEQ ID NO: 6, GCCTACACAAATGATGAGATAACGT) primers to analyze the expression of genes .

4. Expression pattern analysis

The RNA sequence information of the red pepper genes was obtained from Kim et al. (2014, Nat Genet, 46, 270-278), and among the 16 levels of CM334, leaf, Information about the stam, Root, Placenta, PL, and pericarp (PR), information on the greenness (Mature green, MG) and discoloration (Breaker, B) , And the skin and placenta were obtained on the 6th, 16th, and 25th days after greening and discoloration on the 5th and 10th days respectively, and log ₂ RPKM values were used. RNA base sequence information of CM334 cultivars inoculated with TMV-P0, TMV-P2, PepMoV (pepper mottle virus) and Phytophthora capsici (Kang et al. 2016, Sci Rep, 6, 33332) and normalized to the negative control value of the pathogens and then converted to log ₂ RPKM (reads per kilobase million). The heat map was created by using the heat-map package (http://bioconductor.org/).

Example  One. CaLOP  Identification and structural analysis of genes

CaLOP A gene comparison analysis at the protein level was performed using the entire sequence of the gene. As a result, CaLOP It was confirmed that the gene had a 96% coverage with the CaTi n1 gene and 62% similarity. CaLOP Gene was confirmed to have the gene and CaTin1 -2 keobeoyul of 84% previously reported to have a 99% similarity. As a result, it was confirmed that the two genes are highly homologous but different from each other (FIG. 1A). The structure of CaLOP gene was analyzed by using a smart. As a result, SP (signal peptide) was present from the 53rd nucleotide sequence to the 130th nucleotide sequence of the nucleotide sequence, and PLAT / LH2 (Polycystin- 1, Lipoxygenase, Alpha-Toxin / Lipoxygenase homology). When analyzed using only the CDS interval, SP was present from the 1st to 26th intervals, and the PLAT / LH2 structure was present from the 33rd to the 160th (FIG. 1B). The CaLOP gene has a PLAT / LH2 structure in the structure of the CaLOP gene, which is predicted to be a potential lipoxygenase. Therefore, CaLOP The gene was called lipoxygenase analogue protein of pepper and was named CaLOP ( Capsicum annuum lipoxgenase homology protein). Also, for functional analysis related to the growth and development of gene CaLOP, CaTin1 -2 gene of the same homologous (Paralog) was also used with the analysis of the present invention.

In addition, CaLOP and CaTin1 Blast was performed using the gene. As a result, potatoes ( Solanum tuberosum ; Sotub03g021410 , Sotub03g021420 ), tobacco ( Nicotiana sylbestris ; Niben101Scf05326g00010 .1, Niben101Scf05326g00012 .1), tomato (Solanum lycopersicum; Solyc03g096540, Solyc03g096550) , rice (Oryza sativa Japonica Group; Os02g51710) and Arabidopsis (Arabidopsis thaliana ; AT2G22170 ). In the case of rice and Arabidopsis, the CaLOP and CaTin1 OsO2g51710, a gene having high homology with the gene And AT2G22170 , respectively, and these genes were cloned into CaLOP All of the genes had SP and PLAT / LH2 domain structure, and homology of the protein sequence was confirmed to be high. As a result of evolutionary analysis through phylogenetic analysis, as shown in Fig. 2, the total of three groups were observed. In the branching , CaLOP gene and CaTin1 The genes were divided into two groups. CaLOP gene CaTin1 -2, Sotub03g021420, Solyc03g096540 And Niben101Scf05326g00010 .1 gene was tied to a group, CaTin1 gene Sotub03g021410, Solyc03g096550 And the Niben101Scf05326g00012.1 gene were grouped into another group. In addition, OsO2g51710 and AT2G22170 identified in rice and Arabidopsis thaliana It was confirmed that the gene forms a different group from the branch (Fig. 2).

Example  2. CaLOP Gene Analysis of expression patterns

In Example 2, expression patterns of the CaLOP gene of the present invention and the CaTin1 gene as a control group were analyzed. As a result, as shown in Fig. 3, the two genes showed similar expression pattern, the highest expression was observed in the root, and the periplasm (PL_6DPA, PL_16DPA and PL_25DPA) of 6 days, , Respectively. On the other hand, it was confirmed that the expression was low in the course of discoloration machines (PL_MG, PL_B, PL_B5, PR_MG, PR_B, and PR_B5) including the green color of the fruit (FIG.

TMV-P0 (tobacco mosaic virus-P0) used in the present invention shows a resistance reaction, and TMV-P2 shows a sensitivity reaction. As a result of confirming the expression pattern after inoculation of TMV-P0 against CM334 cultivars, it was confirmed that the expression of CaLOP and CaTin1 gene gradually increased from 4 hours after TMV-P0 virus inoculation (FIG. 4A). In addition, the expression of CaLOP gene began to appear 0.5 hour after the inoculation of TMV-P2 virus, and both genes showed the strongest expression at 4 hours after the inoculation of virus. However, (Fig. 4B).

In addition, in the expression pattern for PepMoV (pepper mottle virus), expression of CaLOP and CaTin1 gene was strongly observed at 4 hours after the inoculation of virus, and it became weak from 24 hours after the virus inoculation. (Fig. 4C). Phytophthora As a result, the expression level of both CaLOP and CaTin1 genes increased from 4 hours after inoculation with P. aeruginosa. However, the expression level of CaTin1 gene decreased significantly after 48 hours of inoculation with pepper there was. On the other hand, the CaLOP gene showed strong expression even after 48 hours (FIG. 4D).

Example  3. CaLOP Phenotypic analysis of plants by gene silencing

In the third embodiment it was compared with the control group (TRV-GFP) in order to analyze the function of CaLOP gene, by inducing the CaTin1 CaLOP and gene silencing via VIGS. The gene silencing interval inserted in the vector used in VIGS was used in the N-terminal region of the genes (Fig. 5). At 5 weeks after virus-induced gene silencing (VIGS), the control (TRV-GFP) (TRV-CaTin1) and the CaTin1 gene-silenced plants (TRV-CaTin1) showed no phenotypic differences. However, in the case of the plant with the CaLOP gene silenced (TRV-CaLOP) And 3 kinds of phenotypes were observed. In addition, when the plant lengths were compared, it was confirmed that plants with silenced CaLOP gene had an average 7.8 cm of plant height reduced compared to the control (TRV-GFP) (Fig. 6A). Through RT-PCR analysis, the CaTin1 And CaLOP As a result of the expression pattern of the gene, CaTin1 gene silenced plant and CaLOP (FIG. 6B), and it was confirmed through repeated experiments that changes in the growth and development of plants were inhibited by inhibiting the expression of CaLOP gene I could confirm.

Further, CaLOP Twenty-seven (20%) plants out of 135 silent plants were killed at the early stage of development with inhibition of CaLOP gene expression and 33 plants (24%) were compared to the control (TRV-GFP) And the plant height was significantly decreased. In the remaining 75 individuals (56%), the plant height was significantly reduced compared to the control (TRV-GFP) and the leaf shape was changed (Fig. 7A). As a result of measuring the leaf area of the plants, the average level of the control (TRV-GFP) was 11.1 cm 2 in the leaf area of the VIGS 5th plant, 8.5 cm 2 in the plant in which the CaTin 1 gene was silenced, The plant is genetically CaLOP silence 0.9㎠, the plant with a gene than control CaTin1 silent 2.6㎠, the plant CaLOP gene silencing could be confirmed that the 10.2㎠ decreases (Fig. 7B). In addition, the plant height was 11.1 cm in the control group (TRV-GFP) and 11.3 cm in the control group, and the CaTin1 gene was silenced . In the silent plants, the mean length was 3.5 cm, and the plant height was decreased by an average of 7.8 cm when compared with the control group (FIG. 7C). These results suggest that the CaLOP gene is CaTin1 Unlike genes, it can be seen that it plays a key role in plant growth and development.

<110> INDUSTRY-ACADEMIC COOPERATION FOUNDATION GYEONGSANG NATIONAL UNIVERSITY <120> CaLOP gene from Capsicum annuum regulating growth, development          and disease resistance of plants and uses thereof <130> PN16411 <160> 6 <170> KoPatentin 3.0 <210> 1 <211> 555 <212> DNA <213> Capsicum annuum <400> 1 atgggagtag ctcaggttaa ccaattttgg ttccatctca tgttcatcct tctctccgcc 60 tcgatttctt caatttcggg agatgaaaca aataattgta tctacacagc ttatgtccga 120 actgggccat tcgacgagga tgcaactgac tcaaaaatca ccttaactct gtatgatgcg 180 agtggtcatg gaattagaat caacaaccta gtgacttggg gtgggcttat gggcaaaggt 240 tacaactact ttgaaaggga aaacttggat atgttcagtg ggaagggccc ctgtttgaat 300 gggaccatat gcaaaatggt cttggcttct gatggtacag gccgaaacca tgaatggttc 360 tgtaactacg tggaagtcac ttctacagga gcccacaaac gatgcagcca acaactgttc 420 accgtggatc agtggcttag caccaatcgt tcaccgtatc agctctccgc caccaggaac 480 aactgtcggc gtatgtccga tgagcaacag cccctttacg attcagaatc aaatcatgtt 540 gttgatgtta tttga 555 <210> 2 <211> 184 <212> PRT <213> Capsicum annuum <400> 2 Met Gly Val Ala Gln Val Asn Gln Phe Trp Phe His Leu Met Phe Ile   1 5 10 15 Leu Leu Ser Ale Ser Ser Ser Ser Ser Ser Asp Glu Thr Asn Asn              20 25 30 Cys Ile Tyr Thr Ala Tyr Val Arg Thr Gly Pro Phe Asp Glu Asp Ala          35 40 45 Thr Asp Ser Lys Ile Thr Leu Thr Leu Tyr Asp Ala Ser Gly His Gly      50 55 60 Ile Arg Ile Asn Asn Leu Val Thr Trp Gly Gly Leu Met Gly Lys Gly  65 70 75 80 Tyr Asn Tyr Phe Glu Arg Glu Asn Leu Asp Met Phe Ser Gly Lys Gly                  85 90 95 Pro Cys Leu Asn Gly Thr Ile Cys Lys Met Val Leu Ala Ser Asp Gly             100 105 110 Thr Gly Arg Asn His Glu Trp Phe Cys Asn Tyr Val Glu Val Thr Ser         115 120 125 Thr Gly Ala His Lys Arg Cys Ser Gln Gln Leu Phe Thr Val Asp Gln     130 135 140 Trp Leu Ser Thr Asn Arg Ser Ser Pro Thyr Gn Leu Ser Ala Thr Arg Asn 145 150 155 160 Asn Cys Arg Arg Met Ser Asp Glu Gln Gln Pro Leu Tyr Asp Ser Glu                 165 170 175 Ser Asn His Val Val Asp Val Ile             180 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 ggcagtggtt acgactactt 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 catgatagga ctgaggatcg 20 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 actgccatgg gagtagctca ggt 23 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 gcctacacaa atgatgagat aacgt 25

Claims (8)

Comprising the step of transforming a plant cell with a recombinant vector comprising a gene encoding CaLOP ( Capsicum annuum lipoxygenase homology protein) protein derived from pepper comprising the amino acid sequence of SEQ ID NO: 2 to regulate the expression of CaLOP gene And methods of regulating development. delete The method according to claim 1, wherein the growth and development of the plant are inhibited by inhibiting the expression of the CaLOP gene. Transforming a plant cell with a recombinant vector comprising a gene encoding a Capsicum annuum lipoxygenase homology protein (CaLOP) derived from pepper consisting of the amino acid sequence of SEQ ID NO: 2; And
And regenerating the plant from the transformed plant cell. The method for producing a transgenic plant having regulated plant growth and development. [Claim 5] The method according to claim 4, wherein the growth and development of the plant are inhibited by inhibiting the expression of the CaLOP gene, compared to the wild type plant. A transgenic plant having controlled growth and development of a plant produced by the method of claim 4 or 5. A transformed seed of a plant according to claim 6. A composition for regulating the growth and development of a plant, which comprises, as an active ingredient, a gene coding for CaLOP ( Capsicum annuum lipoxygenase homology protein) protein derived from pepper consisting of the amino acid sequence of SEQ ID NO: 2.

Images