KR101804039B1

KR101804039B1 - Novel tetrahedron nanostructure consisting of dna-rna hybrid or rna

Info

Publication number: KR101804039B1
Application number: KR1020160024040A
Authority: KR
Inventors: 이동기; 강시내
Original assignee: 성균관대학교산학협력단
Priority date: 2015-03-02
Filing date: 2016-02-29
Publication date: 2017-12-01
Also published as: KR20160106507A

Abstract

The present invention relates to a novel DNA-RNA hybrid tetrahedral or RNA tetrahedral structure capable of inhibiting the expression of a target gene or used for drug delivery, and more particularly, to a siRNA (small interfering RNA) or miRNA (microRNA) sequence of a target gene DNA hybrid hybrid tetrahedral structure or RNA tetrahedral structure.
The present invention provides a functional RNA nanostructure into which siRNA or miRNA is introduced, thereby allowing the structure to be efficiently delivered into cells through self-delivery, inducing an RNA interference mechanism, and inducing apoptosis of target cells. In addition, it is possible to provide a controllable structure in which the drug is released to the outside by carrying the drug in the cavity. In addition, it is expected that the technology of the present invention can be commercialized as a new drug by preparing RNA nanostructures that cause suicide of target cells by using RNA interference action as the original technique.

Description

[0001] The present invention relates to novel DNA-RNA hybrid tetrahedral structures or RNA tetrahedral structures,

The present invention relates to a novel DNA-RNA hybrid tetrahedral structure or RNA tetrahedral structure which can inhibit the expression of a target gene or can be used for drug delivery.

Since the 20th century, there have been various attempts to diagnose and treat diseases using RNA (ribonucleic acid). RNA aptamers have been developed that specifically bind to specific substances for disease diagnosis purposes. In addition, researchers who identified RNA interference (RNAi) activity won the 2006 Nobel Prize for their work, and since then research based on RNA interference has grown into a major axis in life or biochemistry. RNAi is the post-transcriptional process (PTGS) and its mechanism is as follows. When a dsRNA of 27 bp or more is produced in a cell, the endonuclease dicer cuts it into RNA of 21 to 22 bps in length. These truncated RNAs are called small interfering RNAs (siRNAs), which are then combined with RISC (RNA induced silencing complex). When RISC is activated via ATP, the double stranded siRNA is split into single strands and only one strand remains in the RISC. The remaining strand is called the antisense strand (or guide strand), and the antisense strand recognizes and binds the mRNA with the complementary sequence. When the mRNA and the antisense strand form a perfect base pair, the endonuclease present in the cell acts to decompose the mRNA of the specific gene. Through this mechanism, expression of a specific gene can be suppressed. Therefore, studies are under way to regulate gene expression involved in life extension of specific cells such as cancer cells using siRNA and miRNA (microRNA) involved in the above mechanism.

However, RNAi units such as miRNA and siRNA have a problem of low intracellular delivery efficiency alone. As an example of attempts to solve this problem, there is a method of using a positively charged polymer as a carrier. Nucleic acid basically has a negative charge, so it is a principle to increase the efficiency of cell membrane permeation by forming complex by surrounding nucleic acid molecule with positively charged polymer. Lipofectamine and PEI are typical materials. When these substances are treated together, the delivery efficiency is increased, but it shows high cytotoxicity and requires an additional transfer process, which is not preferable from the viewpoint of commercialization.

There has also been an attempt to increase the delivery efficiency of the nucleic acid material itself by inducing chemical modification or structural variation of the siRNA without the aid of a transporter. One example is to add cholesterol to an asymmetric siRNA structure that changes the backbone of the siRNA, thereby increasing the hydrophobicity of the nucleic acid molecule and increasing the cell membrane permeability. It also changes the length of the overhang structure of the siRNA, or eliminates it, thereby creating a blunt end. There was also a report on the efficiency change with antisense length change. However, in such a case, there is a limit to increase the transmission efficiency, and there is a great restriction on the structural change. Despite these attempts, intracellular delivery remains a major barrier to RNA-based drug development.

In addition, because RNA is inherently less stable to serum, it is likely to be degraded by RNA degrading enzymes before reaching the target cell. Thus, although the RNAi unit may result in RNA interference in vitro, it can not be guaranteed that the results are reproducible in vivo , ie, in the presence of serum. Although the introduction of 2'-O-methyl modification has been reported to increase the stability to RNA degradation enzymes, there is a problem that the efficiency of RNA interference is lower than that of RNAi units without chemical modification.

On the other hand, DNA nanotechnology has evolved into the mainstream of nucleic acid research with Nadrian Seeman as the vanguard. DNA is attracting attention as a good building block because it can easily design the desired structure based on complementary binding of salt period and self-assemble with appropriate buffer and temperature changes. To date, DNA nanostructures of various structures have been reported to exhibit interesting properties such as self-propagation and structural stability in cells. A typical example of the DNA tetrahedron structure is efficiently transferred into cells without the help of the transporter, and is structurally stable in the cells for at least 72 hours after delivery.

However, such DNA nanostructures exhibit useful physical properties, but externally injected DNA has a disadvantage of showing little biological function.

As a result of the development of RNA synthesis technology, it has become possible to synthesize RNA having a length of more than 50 bases, and as a result of intensive efforts to produce nanostructures using RNA, it has been found that the biological functions The present invention has been accomplished by synthesizing a nanostructure containing RNA.

However, the technical problem to be solved by the present invention is not limited to the above-mentioned problems, and other matters not mentioned can be clearly understood by those skilled in the art from the following description.

In order to achieve the object of the present invention, the present invention provides a DNA-RNA hybrid tetrahedral structure or RNA tetrahedral structure containing a siRNA (small interfering RNA) or miRNA (microRNA) sequence capable of inhibiting a target gene .

In one embodiment of the present invention, the DNA-RNA hybrid tetrahedron structure may include two or more sequences selected from the group consisting of the nucleotide sequences shown in SEQ ID NOS: 1 to 4.

In another embodiment of the present invention, the RNA isoscelet structure may include two or more sequences selected from the group consisting of the nucleotide sequences shown in SEQ ID NOS: 9 to 12.

In another embodiment of the present invention, the target gene may be an oncogene.

In addition, the present invention provides a target gene expression inhibiting composition comprising the tetrahedral structure, and a method for inhibiting the expression of a target gene, which comprises treating the cells with the tetrahedral structure.

In addition, the present invention provides a drug delivery composition comprising the tetrahedral structure on which a drug is supported.

Further, the present invention provides a method for detecting a target gene, comprising the steps of: (1) isolating two or more sequences selected from the group consisting of the nucleotide sequences shown in SEQ ID NOs: 1 to 4; and (2) RNA hybrid tetrahedral structure or RNA tetrahedral structure, comprising annealing the DNA with a small interfering RNA (siRNA) or miRNA (microRNA) sequence.

The present invention has the advantage of providing a functional RNA structure. That is, a tetrahedron structure is prepared by introducing a unit such as siRNA and miRNA, thereby providing a biological function of the RNA such as RNAi, delivering the RNA efficiently through the self-transduction, and inducing an RNA interference mechanism to induce apoptosis of the target cell can do. In addition, when the structure has the same characteristics as the structure change due to external stimulation, the structure of the tetrahedron structure can be changed and a controllable structure in which the substances in the pupil are released to the outside can be made.

In the case of DNA-RNA hybrid tetrahedral structures or RNA tetrahedral structures that do not require the carrier of the present invention, the nucleic acid as a constituent is a biopolymer It is inherently harmless to the human body, and cytotoxicity can be minimized.

In addition, the technology of the present invention can provide a cornerstone for the development of nucleic acid drug using original technology. For example, RNA nanostructures that induce target cell suicide using RNA interference are expected to be commercialized as new drugs.

FIG. 1 shows an example of a structure in which an additional structure is combined to increase the possibility of using the tetrahedral structure according to the present invention as a therapeutic agent.
2 is a view showing various designs of a tetrahedron structure according to the present invention.
FIG. 3 shows the results of confirming the formation of the RNA tetrahedral structure according to the present invention.
FIG. 4 is a graph showing the intracellular self-transfer of DNA and RNA tetrahedra, wherein (a) and (b) are graphs of fluorescence intensities measured by flow cytometry, and (c) It will: [TF]; Transfection with transfection reagent, [IB] Transfusion without transfection reagent.
FIG. 5 is a schematic diagram showing a DNA-RNA hybrid tetrahedron structure using Survivin as a target gene according to the present invention.
FIG. 6 shows the results of confirming intracellular self-transfer of a DNA-RNA hybrid tetrahedron structure using Survivin as a target gene according to the present invention.
FIG. 7 is a schematic diagram of a DNA-RNA hybrid tetrahedron structure using Survivin and GFP as target genes according to the present invention.
FIG. 8 shows the result of confirming the gene silencing inducing effect of the DNA-RNA hybrid tetrahedron structure according to the present invention.

The present invention relates to a DNA-RNA hybrid tetrahedron structure or RNA tetrahedron structure comprising two or more sequences selected from the group consisting of the nucleotide sequences of SEQ ID NOS: 9 to 12, or siRNA capable of suppressing the target gene (small interfering RNA ) Or a miRNA (microRNA) sequence, or a RNA tetrahedral structure.

In order to prepare RNA nanostructures, the present inventors first envisaged a framework capable of exhibiting interesting properties such as self-transmission. In one embodiment of the present invention, an RNA tetrahedral structure containing the nucleotide sequences of SEQ ID NOS: 9 to 12 was prepared by an annealing method (see Example 2). However, the structure of the present invention is not limited to the regular tetrahedron skeleton, but can be applied to the manufacture of regular tetrahedrons other than a regular tetrahedron, a box which can be opened and closed using a hinge, a nanotube, and the like.

Next, RNAi units that confer biochemical functions on RNA nanostructures were envisioned. For example, siRNA or miRNA sequences may induce apoptosis by inhibiting the expression of various target genes, such as, but not limited to, an oncogene or other mechanism through an RNA interference mechanism . In one embodiment of the present invention, a DNA-RNA hybrid tetrahedron structure was prepared by introducing a base sequence of an siRNA inducing RNAi into one side of an RNA tetrahedron by annealing, and using survivin and GFP as target genes The expression inhibition of the target was confirmed (see Example 3). When two or more siRNA or miRNA sequences having different target genes are introduced into different sides, the expression of various kinds of genes can be controlled at the same time, thereby maximizing the therapeutic effect.

The siRNA capable of inhibiting the target gene may be siRNA such as survivin, GFP, luciferase, etc., and may be Sox2, Oct4, or the like, in which the stem cell is a target cell.

The DNA-RNA hybrid tetrahedron structure of the present invention can be designed to have 1 to 4 target genes, preferably 6 target genes, which are the number of sides of the tetrahedron. Examples of such designs are shown in Fig.

2 (a) and 2 (b) show a simple stereostructure of a nucleic acid tetrahedron having three target genes. 2 (a) and 2 (b) are tetrahedra in which siRNA sequences of Survivin, GFP and Luciferase (blue, red, and green) are introduced, respectively, and genes capable of suppressing a target gene using the stem cell as a target cell Is a tetrahedron in which genes such as Sox2 and Oct4 are introduced.

As shown in FIG. 2 (c), a tetrahedron structure in which long wavelength dyes such as Cy5 and Cy3 (red) are labeled can also be used. FIG. 2 (d) shows the purpose of overcoming the limitations of the structure, It is a structure that introduces various moieties. For example, ligands that target specific cancer cells to induce targeted delivery, drugs that increase titer, and chemical modifications that can increase serum stability can be introduced.

In this regard, substances that can be introduced into the vertex of the tetrahedron can be a peptide, a targeting ligand, a chemical modification, a biomarker, a fluorescent dye, a drug, and the like. Introduction of these materials can improve delivery efficiency, enhance endosome escape, improve RNA interference efficiency, increase serum resistance, and enhance targeted delivery, mechanism studies, etc. Can be used.

FIG. 2 (e) shows an example of the functional nucleic acid tetrahedron structure that has undergone the optimization step. In this example, one or more target genes are targeted and an optimization process is performed to complement the disadvantages of the structure and increase transmission and gene silencing efficiency .

Survivin is a representative oncogene used in siRNA research involving life extension of cancer cells. It is a member of the inhibitor of apoptosis (IAP) family and is also called baculoviral inhibitor of apoptosis repeat-containing 5 (BIRC5). Survivin protein functions to inhibit apoptosis (or programmed cell death), that is, cell suicide. Therefore, if the Survivin protein is not expressed, the apoptosis is increased and the growth of cancer cells is decreased. In addition, Survivin protein is highly expressed in human cancer cells and fetal tissue, but not in cells that have undergone differentiation. Therefore, targeting the Survivin gene is very useful for distinguishing between transformed cells and normal cells, so that only cancer cells can be selectively eliminated.

The tetrahedral structure of the present invention may be supplemented with an additional structure to increase the potential as a therapeutic agent. For example, an aptamer or a targeting ligand may specifically transfer a structure to a specific cell. In other words, a ligand that specifically binds to cancer cells, such as folic acid, can be attached to the vertex of the polyhedron as shown in Fig. In addition, introduction of an endosome-escape enhancer into the structure of the present invention enables the structure to be efficiently transferred into cells. In addition, the therapeutic effect can be maximized when a small molecule drug such as an anticancer drug is contained in a cavity of a tetrahedron structure or intercalated between double strands of nucleic acid and delivered together with an RNAi unit. For example, when an anticancer agent such as doxorubicin is intercalated to the tetrahedral structure of the present invention together with the RNAi unit, cancer cells can be killed more efficiently.

From the above, the present invention can provide a target gene expression inhibition or drug delivery use of the tetrahedral structure.

In the present invention, the annealing is a method in which TEM is used as a buffer, denaturing is performed at a high temperature under a temperature change using a thermocycler, and the temperature is lowered to induce self-assembly into a design designed through complementary bonding of the base. There are two methods of temperature change which are mainly used at present: first, 5 minutes at 95 ° C, 30 minutes at 37 ° C, and 5 minutes at 4 ° C. Second, 5 minutes at 95 ° C and 5 minutes at 4 ° C. It is to put a minute. The former is the method used to gradually self-assemble.

Hereinafter, preferred embodiments of the present invention will be described in order to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the following examples.

DNA-RNA hybrid tetrahedral and RNA Sequence design for the production of tetrahedral nanostructures

First, as shown in the sequence information in Table 1 below, four DNA strands were synthesized (Bioneer Corp. Korea). The strands in Table 1 are each composed of 55 bases, and three pairs of edges forming a corner of a tetrahedron are composed of 17 bases.

SEQ ID NOS: 1 to 4 are described by Russell P. Goodman et al. (2004, Chem. Commun.) As the source of the single-step synthesis of a DNA tetrahedron.

The two bases present between the edges serve as hinges that provide fluidity to the structure and are present between the edges, so there are two pairs in total. In addition, Cy3, a fluorescent substance, was attached to the 3 'end of SEQ ID NO: 4 through chemical modification so as to confirm the transfer efficiency by a fluorescence microscope.

designation The sequence (5 '- > 3') SEQ ID NO: S1-DNA ACATTCCTAAGTCTGAA AC ATTACAGCTTGCTACAC GA GAAGAGCCGCCATAGTA One S2-DNA TATCACCAGGCAGTTGA CA GTGTAGCAAGCTGTAAT AG ATGCGAGGGTCCAATAC 2 S3-DNA TCAACTGCCTGGTGATA AA ACGACACTACGTGGGAA TC TACTATGGCGGCTCTTC 3 S4-DNA TTCAGACTTAGGAATGT GC T TCCCACGTAGTGTCGT TT GTATTGGACCCTCGCAT (Cy3) 4 Bold font: Base present between edges
Underscore: Edge base to create a corner

Next, Survivin was selected as a target gene for confirming the RNAi effect, and in order to hybridize the target siRNA (siSurvivin) to a tetrahedron, a new sequence (antisense and sense) . As shown in SEQ ID NOs: 5 and 6 in Table 2, the universal siRNA (siSurvivin) has 19 bases and the 5 'end of the antisense strand is called ago2 (SEQ ID NO: 2) of the antisense strand (AS) by allowing 2 nt to protrude like a tail and deleting 2 nt in the sense strand (S) in consideration of the fact that the antisense strand 7 and 8, the final sequence which can be one side of the tetrahedron was determined and synthesized.

designation The sequence (5 '- > 3') SEQ ID NO: siRNA_Survivin-AS UGAAAAUGUUGAUCUCCUU 5 siRNA_Survivin-S AAGGAGAUCAACAUUUUCA 6 siRNA_Survivin_S2-AS UGAAAAUGUUGAUCUCCUU CA GTGTAGCAAGCTGTAAT AG ATGCGAGGGTCCAATAC 7 siRNA_Survivin_S3-S AAGGAGAUCAACAUUUU AA ACGACACTACGTGGGAA TC TACTATGGCGGCTCTTC 8 Bold font: Base present between edges
Underscore: Edge base to create a corner

Next, based on the sequence of the DNA tetrahedron in Table 1, four RNA strands as shown in the following Table 3 were synthesized in order to anneal the RNA tetrahedral nano structure.

designation The sequence (5 '- > 3') SEQ ID NO: S1-RNA ACAUUCCUAAGUCUGAAACAUUACAGCUUGCUACACGAGAAGAGCCGCCAUAGUA 9 S2-RNA UAUCACCAGGCAGUUGACAGUGUAGCAAGCUGUAAUAGAUGCGAGGGUCCAAUAC 10 S3-RNA UCAACUGCCUGGUGAUAAAACGACACUACGUGGGAAUCUACUAUGGCGGCUCUUC 11 S4-RNA UUCAGACUUAGGAAUGUGCUUCCCACGUAGUGUCGUUUGUAUUGGACCCUCGCAU (Cy3) 12

Preparation of RNA tetrahedral nanostructures and confirmation of intracellular delivery

<2-1> Formation of RNA tetrahedral nanostructure

Using the RNA strand shown in Table 3, a tetrahedron structure was formed according to the experimental method proposed by R. P. Goodman (R. P. Goodman, Chem. Commun., 2004, 1372-1373). In more detail, the method was performed by mixing 5x10 min of each strand final concentration of 100 [mu] M in 1x TEM buffer, inducing annealing for 5 min at 54 [deg.] C, 30 min at 95 [ If not, it was stored at -20 ℃.

An annealing test was carried out by non-denaturing PAGE analysis to confirm that the prepared RNA tetrahedral structure (Oligonucleotide) was formed. After annealing as described above, electrophoresis was performed at 150 V for 30 minutes using 6% polyacrylamide gel, EtBr staining was performed for about 5 minutes, and UV image was confirmed to confirm formation of a tetrahedral nucleic acid structure Respectively. As a result, as shown in FIG. 3, the band (Lane 3) of the RNA tetrahedron structure on the right side appeared at a higher position than the single-stranded band (Lane 1), and was the same as the pattern of the DNA tetrahedron on the left side.

Thus, it can be seen that the RNA tetrahedral structure of the present invention has been successfully prepared.

<2-2> Confirmation of self-transfer of RNA tetrahedral nanostructure

In order to confirm the self-transmission of the tetrahedron of RNA prepared in the above <2-1>, HEK293 cells were incubated with 100 nM or L2K ™ with 10 nM of RNA-tetrahedron (RNA-Td) and DNA tetrahedron (DNA-Td) After transfection, the cells were cultured for 6 hours. The efficiency of self-propagation was measured by Nucleocounter (NC3000) based assay. As a result, as shown in FIG. 4 (a) and FIG. 4 (b), it was found that the RNA tetrahedron was efficiently transferred into the cells irrespective of whether or not the transfusion reagent was used as in the case of the DNA tetrahedron. The results are shown in Fig.

<2-3> Survivin DNA-RNA as a target gene hybrid Formation of tetrahedral structures

As shown in FIG. 5, the DNA-RNA hybrid tetrahedron in which the DNA sequence of Table 1 was substituted with the RNAi unit of SEQ ID NOS: 7 and 8 instead of SEQ ID NOS: 2 and 3 at one side of the tetrahedron with the basic framework was synthesized. Respectively. In FIG. 5, the sides of each color correspond to sequences of the same color of each strand, and when they are the same color, they are complementary to each other (anti-parallel). The starting point of the arrow indicates the 5 'end and the end of the arrow indicates the 3' end. The nucleotide sequence of 17 nt from the 5 'end of strand2 and strand3 was replaced with the sequence of AS and SS of siSurvivin, respectively. However, in order to insert all 19 nt in the case of AS, an overhang of 2 nt from the 5 'end was allowed. Also, considering the position to replace the AS and the SS, the 5 'end of the AS was designed to be open (so that the RNA interference can be made completely). Therefore, this tetrahedron was constructed as a structure that uses the Survivin gene as a target gene.

<2-4> Survivin DNA-RNA as a target gene hybrid Self-propagation confirmation of tetrahedral structures

In order to confirm the self-propagation of the DNA-RNA hybrid tetrahedron prepared in the above <2-3>, Cy3 was attached to Strand4 among four nucleic acid strands constituting the tetrahedron structure so that the structure was designed to exhibit fluorescence. After annealing, 50 nM of Td-siSurvivin was treated with HeLa cells without additional transfection reagent. Four hours later, Cy3 fluorescent images were obtained by fluorescence microscopy. As can be seen from FIG. 6, fluorescence of the DNA-RNA hybrid tetrahedron structure was clear (no treatment, only the same volume of the same media was treated) compared to the control group (no Cy3 fluorescence). Therefore, the self - propagating characteristics of the structure were confirmed.

<2-5> Survivin And GPF At the same time, DNA-RNA hybrid Formation of tetrahedral structures

Survivin and GPF were selected as target genes and hybridization of the target siRNA to the tetrahedrons was carried out in order to confirm whether the construct of the present invention can use a plurality of genes as target genes. And antisense and sense, respectively. The universal siGFP is as shown in SEQ ID NOs: 13 and 14 in Table 4 below.

As shown in Fig. 7, one side of the tetrahedron was substituted with the RNAi unit of SEQ ID NOS: 7 and 8 instead of the nucleotide sequences of SEQ ID NOS: 2 and 3, and the sequence of SEQ ID NO: 15 and 16 RNAi units to synthesize DNA-RNA hybrid tetrahedra.

designation The sequence (5 '- > 3') SEQ ID NO: siRNA_AS_siGFP UUCACCUUGAUGCCAUUCU 13 siRNA_SS_siGFP AGAAUGGCAUCAAGGUGAA 14 siRNA_AS_siGFP_S1-AS UUCACCUUGAUGCCAUUCU AC ATTACAGCTTGCTACAC GA GAAGAGCCGCCATAGTA 15 siRNA_SS_siGFP_S4-SS AGAAUGGCAUCAAGGUG GC T TCCCACGTAGTGTCGT TT GTATTGGACCCTCGCAT (Cy3) 16 Bold font: Base present between edges
Underscore: Edge base to create a corner

<2-4> and tetrahedron and design principle are the same. However, the AS and SS sequences of siGFP (SEQ ID NOS: 13 and 14) were inserted at the 5 'ends of strand1 and strand4, respectively. Therefore, it can be seen that this structure is a multi-targeting functional tetrahedral structure that simultaneously inhibits the expression of Survivin protein and GFP protein.

DNA-RNA hybrid silencing induction of tetrahedral structures

Using the tetrahedral nucleic acid construct of <2-3>, gene silencing was confirmed. HeLa cells were used as the target cells. In the cell culture, the external environment was maintained at 37 ° C and 5% CO ₂ , and DMEM containing 10% FBS, 1% penicillin and streptomycin was used as the culture medium. HeLa cells were first seeded overnight in a 24-well plate overnight. Passage was carried out once every 3 days considering confluency.

Functional DNA-RNA hybrid tetrahedral structures containing the Survivin gene as a target gene were annealed before the experiment. Seeded cells in DMEM media containing 10% serum were washed with serum-free media opti-mem and opti-mem was used as media during incubation.

For transfection, Lipofectamine 2000 (L2K) was used as a transfection reagent. siSurvivin and Td-siSurvivin were complexed with L2K, respectively, and then treated with HeLa cells. The final concentrations were 50 nM each. After incubation for about 4 h, mRNA levels of the survivin gene were determined using real-time qPCR.

As a result, it was confirmed that Td-siSurvivn induces gene silencing with an efficiency similar to siSurvivin as shown in Fig. In other words, gene expression was not inhibited in the same manner as in the case of treatment of a DNA tetrahedral structure without RNAi unit (Td-DNA) (0 nM). On the other hand, when DNA-RNA hybrid tetrahedra was treated (Td-DNA / siRNA), gene silencing was observed and knockdown was almost same as siRNA (siSurvivin).

From the above, it can be seen that the DNA-RNA hybrid tetrahedral structure according to the present invention shows excellent gene silencing inducing effect.

It will be understood by those skilled in the art that the foregoing description of the present invention is for illustrative purposes only and that those of ordinary skill in the art can readily understand that various changes and modifications may be made without departing from the spirit or essential characteristics of the present invention. will be. It is therefore to be understood that the above-described embodiments are illustrative in all aspects and not restrictive.

<110> Research & Business Foundation SUNGKYUNKWAN UNIVERSITY <120> NOVEL TETRAHEDRON NANOSTRUCTURE CONSISTING OF DNA-RNA HYBRID OR RNA <130> MP16-255 <150> KR 10-2015-29242 <151> 2015-03-02 <160> 16 <170> Kopatentin 2.0 <210> 1 <211> 55 <212> DNA <213> Artificial Sequence <220> S1-DNA <400> 1 acattcctaa gtctgaaaca ttacagcttg ctacacgaga agagccgcca tagta 55 <210> 2 <211> 55 <212> DNA <213> Artificial Sequence <220> S2-DNA <400> 2 tatcaccagg cagttgacag tgtagcaagc tgtaatagat gcgagggtcc aatac 55 <210> 3 <211> 55 <212> DNA <213> Artificial Sequence <220> S3-DNA <400> 3 tcaactgcct ggtgataaaa cgacactacg tgggaatcta ctatggcggc tcttc 55 <210> 4 <211> 55 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > S4-DNA <400> 4 ttcagactta ggaatgtgct tcccacgtag tgtcgtttgt attggaccct cgcat 55 <210> 5 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> siRNA_Survivin-AS <400> 5 ugaaaauguu gaucuccuu 19 <210> 6 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> siRNA_Survivin-S <400> 6 aaggagauca acauuuuca 19 <210> 7 <211> 57 <212> RNA <213> Artificial Sequence <220> <223> siRNA_Survivin_S2-AS <400> 7 ugaaaauguu gaucuccuuc agtgtagcaa gctgtaatag atgcgagggt ccaatac 57 <210> 8 <211> 55 <212> RNA <213> Artificial Sequence <220> <223> siRNA_Survivin_S3-S <400> 8 aaggagauca acauuuuaaa cgacactacg tgggaatcta ctatggcggc tcttc 55 <210> 9 <211> 55 <212> RNA <213> Artificial Sequence <220> <223> S1-RNA <400> 9 acauuccuaa gucugaaaca uuacagcuug cuacacgaga agagccgcca uagua 55 <210> 10 <211> 55 <212> RNA <213> Artificial Sequence <220> <223> S2-RNA <400> 10 uaucaccagg caguugacag uguagcaagc uguaauagau gcgagggucc aauac 55 <210> 11 <211> 55 <212> RNA <213> Artificial Sequence <220> &Lt; 223 > S-RNA <400> 11 ucaacugccu ggugauaaaa cgacacuacg ugggaaucua cuauggcggc ucuuc 55 <210> 12 <211> 55 <212> RNA <213> Artificial Sequence <220> <223> S4-RNA <400> 12 uucagacuua ggaaugugcu ucccacguag ugucguuugu auuggacccu cgcau 55 <210> 13 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> siRNA_AS_siGFP <400> 13 uucaccuuga ugccauucu 19 <210> 14 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> siRNA_SS_siGFP <400> 14 agaauggcau caaggugaa 19 <210> 15 <211> 57 <212> RNA <213> Artificial Sequence <220> <223> siRNA_AS_siGFP_S1-AS <400> 15 uucaccuuga ugccauucua cattacagct tgctacacga gaagagccgc catagta 57 <210> 16 <211> 55 <212> RNA <213> Artificial Sequence <220> <223> siRNA_SS_siGFP_S4-SS <400> 16 agaauggcau caagguggct tcccacgtag tgtcgtttgt attggaccct cgcat 55

Claims

A DNA-RNA hybrid tetrahedral structure or RNA tetrahedral structure, comprising siRNA (small interfering RNA) or miRNA (microRNA) sequences capable of inhibiting a target gene,
Wherein the target gene is a carcinogenic gene, and the structure comprises SEQ ID NOS: 7 and 8. The DNA-RNA hybrid tetrahedral structure or the RNA tetrahedral structure.

The method according to claim 1,
Wherein the DNA-RNA hybrid isoscelet structure comprises two or more sequences selected from the group consisting of the nucleotide sequences shown in SEQ ID NOS: 1 to 4.

The method according to claim 1,
Wherein the RNA isoscelet structure comprises two or more sequences selected from the group consisting of the nucleotide sequences shown in SEQ ID NOS: 9 to 12.

delete

A composition for inhibiting the expression of a target gene, which comprises the tetrahedral structure of claim 1.

A method for inhibiting a target gene expression, which comprises treating the cell with the tetrahedral structure of claim 1.

A composition for drug delivery, comprising a tetrahedral structure according to claim 1, wherein the drug is carried inside.

At least two or more sequences selected from the group consisting of the nucleotide sequences shown in SEQ ID NOS: 1 to 4, or the nucleotide sequences shown in SEQ ID NOS: 9 to 12, Annealing with a small interfering RNA (siRNA) or miRNA (microRNA) sequence,
Wherein the siRNA sequence is SEQ ID NOS: 5 and 6. 6. A method for producing a DNA-RNA hybrid tetrahedron structure or RNA tetrahedron structure,