KR101794313B1 - Composition comprisin Creb3L1/CrebA protein or polynucleotide encoding the CrebA/CREB3L1 for the prevention or treatment of neurodegenerative disease - Google Patents

Abstract

The present invention relates to a neurodegenerative disease preventing or treating pharmaceutical composition containing a CrebA/CREB3L1 protein or a polynucleotide for encoding the same as an active ingredient. In particular, it has been confirmed that the CrebA/CREB3L1 protein restores a cell membrane loss and a GOP function disorder of a dentrite caused by MJDtr-78Q protein toxicity of the Machado-Joseph disease, inhibits a loss of a C4da neural cell dentrite, restores the shape of a branch of a dentrite, and has a strong correlation of CrebA with vesicle-mediated transportation, membrane structuring, and lipid synthesis inhibited by polyQ toxicity. It has been confirmed that expression of Sec13 and Sec23A related to CREB3L1 and cell membrane transportation is reduced by polyQ toxicity in a human-derived HEK293T cell line. Accordingly, the CrebA/CREB3L1 protein and the nucleotide for encoding the same of the present invention can be useful as a composition for preventing or treating neurodegenerative diseases.

Description

[0001] The present invention relates to a pharmaceutical composition for preventing or treating degenerative brain diseases comprising CrebA / CREB3L1 protein or a polynucleotide encoding the same as an active ingredient.

The present invention relates to a pharmaceutical composition for preventing or treating a degenerative brain disease comprising CrebA / CREB3L1 (cAMP-response element binding protein 3 like 1) protein or a polynucleotide encoding the same as an active ingredient will be.

Dendrites of neurons are designed to receive a variety of signals through the formation of a wide range of synapses morphologically. Thus, appropriately formed dendritic arbores keep dynamics important for neuronal plasticity. Since the dendrite is very long, the surface area to volume ratio of the nerve is astronomically large even if the diameter is narrow. Thus, satellite organelles in the dendrites of nerve cells are used to effectively perform the function of the area not reachable by somatic organelles. The satellite organ of the dendrites is functionally redundant but qualitatively distinct from the nuclear surrounding standard cell organelles. The reason for this difference is that, first, it requires miniaturization of satellite organs such as endoplasmic reticulum (ER) or Golgi outpost (GOP) placed around the nucleus due to limited space, Because of the difference in cell environment.

In non-neuronal cells, a microtubule nucleation site, which is bound to the centrosome and Golgi, is present around the nucleus, but a large complex such as a neuron has a microtubule nucleation point in the cytoplasm, It also exists in branches of dendrites. The GOP is a satellite organ of Golgi that constitutes the microtubule nuclei present in the branches of the dendrites, and plays a role in maintaining the microtubule dynamics and the stability of the dendritic arbor. Ori-Mckenny et al. Reported the presence of a GOP located at the branch point of the neuronal dendritic branch of Drosophila , and reported that the GOP provides a starting point for microtubule nucleation in the non-centrosome terminal region (Ori-McKenny, 2012, Neuron, 76, 921-930). In the presence of Golgi complexes and GOPs located in the periphery of the nucleus in Drosophila and mammalian neurons, predominantly in the first horn of human hippocampal neurons, Drosophila class Ⅳ da neurons (Ye et al., 2007, Cell, 24, 717-29). In addition, it is known that the proximal branches of the dendritic spines are distributed predominantly in the dendritic spines. In the distal dendritic branch, cytoskeleton polymerization of actin filaments, intermediate filaments, or microtubules occurs around the GOP to form dendritic branches, and its material Is supplied from the GOP, the GOP plays a key role in formation and maintenance of the tip end of the dendrite.

The dendritic spine is a dynamic structure that repeats deformation and generation over the life of an individual. It plays a role in signaling neurons, but in the majority of degenerative brain diseases, dendritic spine is the first And the damage of the dendrites occurs first before the nerve cells die. Therefore, the vulnerability of these dendrites to neurotoxicity must be addressed for early treatment and prevention of degenerative brain diseases.

Damage to these dendrites occurs locally or extensively and is caused by protein toxicity such as Tau, amyloid-beta, α-synuclein, prion, and polyQ. PolyQ, a protein with repeatedly extended glutamine (Q), is responsible for five degenerative brain diseases called polyQ disease. The cause of PolyQ is not known precisely, but is caused by the repeated expansion of 'CAG' encoding glutamine (Q) due to DNA damage or recovery process at the gene level. Five diseases belonging to PolyQ disease were spinal cord, cerebellar demonstration, spinocerebellar ataxias (SCA) types 1, 2, 6, 7 and 17, Machado-Joseph disease , MJD / SCA3), Huntington's disease, dentatorubral pallidoluysian atrophy (DRPLA) and X-linked spinal muscular atrophy (X-linked 1, SMAX1 / SBMA ), And neuronal cells connecting the cerebellum or cerebellum with the spinal cord are damaged, resulting in abnormal motor function such as muscle spasm, ataxia, and mood swings. The treatment of PolyQ disease is similar to other degenerative brain diseases, and there is no definite treatment. It depends on pharmacotherapy or physiotherapy to alleviate the disease progression. It is very likely to develop due to chromosomal abnormality and development of new therapeutic agent is urgent .

The cAMP-response element binding protein A (CREBA) of Drosophila binds to the cAMP-response element (CRE) in human CREB3L1 (cAMP-response element binding protein 3 like-1) and a heterologous homologue Lt; RTI ID = 0.0 > regulatory < / RTI > CREB3L1 regulates the expression of vasopressin gene in the hypothalamus (Greenwood M. et al., 2014, J). In addition, CREB3L1 regulates vasopressin gene expression in the hypothalamus (Vellanki et al., 2013, Plosone, 8, e54060), the protective effect of CREB3L1 on neuronal cells or the degenerative brain There is no report on the effect of the disease treatment.

Under these circumstances, the present inventors intend to present a CrebA / CREB3L1 protein as a novel substance for the prevention or treatment of degenerative brain diseases through the recovery of dendritic loss, to develop a preventive or therapeutic method for degenerative brain diseases. Machado-Joseph disease The polyQ toxin MJDtr-78Q overexpressed Drosophila is destroyed by the vesicle-mediated transport, membrane structure and lipid synthesis inhibition by the GOP dysfunction of polyQ toxin-induced dendrites, resulting in loss of plasma membrane After confirming the disappearance of the protuberances, CrebA / CREB3L1 protein overexpression restored GOP dysfunction and plasma membrane supply and restored dendritic morphology. Thus, CrebA / CREB3L1 protein prevented degenerative brain disease caused by polyQ toxicity Or therapeutic effect of the present invention, thereby completing the present invention.

An object of the present invention is to provide a pharmaceutical composition for preventing or treating degenerative brain diseases containing CrebA / CREB3L1 (cAMP-response element-binding protein 3 like 1) protein or a polynucleotide encoding the same as an active ingredient To provide a composition.

In order to achieve the above object, the present invention provides a method for treating a degenerative brain disorder comprising CrebA / CREB3L1 (cAMP-response element-binding protein 3 like 1) protein or a polynucleotide encoding the same, Or a pharmaceutically acceptable salt thereof.

The present invention also provides a pharmaceutical composition for the prevention and treatment of degenerative brain diseases comprising, as an active ingredient, a vector comprising a polynucleotide encoding CrebA / CREB3L1 protein.

In addition,

1) treating the test substance with a CrebA / CREB3L1 expressing cell line;

2) measuring the expression level of CrebA / CREB3L1 protein or mRNA in the treated cell line of step 1); And

3) selecting a test substance whose expression level of CrebA / CREB3L1 protein or mRNA of step 2) is increased compared to a control group not treated with the test substance.

In the present invention, overexpression of CrebA / CREB3L1 (cAMP-response element-binding protein 3 like 1) protein in Drosophila expressing MJDtr-78Q, a polyQ toxin of Machado-Joseph disease, It was confirmed that the dysfunctional dendritic dysfunction restored the GOP dysfunction and plasma membrane loss, restrained the disappearance of C4da neuron dendrites, restored the morphology of the dendritic spines, and suppressed polyQ mediated vesicle mediated transport, membrane structuring , It was confirmed that lipid synthesis and CrebA were strongly related to each other. By confirming that expression of CREB3L1 and Sec13 and Sec23A related to cell membrane transport in humans-derived HEK293T cell line were reduced by polyQ toxicity, CrebA / CREB3L1 protein of the present invention and Encoding nucleotides can be usefully used as a composition for preventing and treating degenerative brain diseases.

1 is a diagram showing the C4da dendrites of nerve cells damaged by polyQ toxicity from overexpression of the Drosophila MJDtr-78Q (Drosophilla).
FIG. 2 is a diagram showing the dendritic plasma membrane and GOP disappearance of C4da neuron by polyQ toxicity in MJDtr-78Q overexpressing Drosophila.
FIG. 3 shows the result of genome-wide mRNA-wequencing analysis using mRNA extracted from the head of MJDtr-78Q overexpressing Drosophila.
4 is a graph showing the effect of CrebA / CREB3L1 on the recovery of GOP disappearance due to polyQ toxicity.
Fig. 5 is a graph showing the recovery effect of CrebA / CREB3L1 inhibited by polyQ toxicity.
FIG. 6 is a graph showing the recovery effect of the water dendritic structure destroyed by polyQ toxicity of CrebA / CREB3L1 and Rac1. FIG.

Hereinafter, the present invention will be described in detail.

The present invention relates to a pharmaceutical composition for the prevention or treatment of degenerative brain diseases containing CrebA / CREB3L1 (cAMP-response element-binding protein 3 like 1) protein or a polynucleotide encoding the same as an active ingredient .

These degenerative brain diseases include spinocerebellar ataxias (SCA) types 1, 2, 6, 7 and 17, Machado-Joseph disease (MJD / SCA3) ), Huntington's disease, dentatorubral pallidoluysian atrophy (DRPLA), and X-linked spinal muscular atrophy (X-linked 1, SMAX1 / SBMA) or amyotrophic And amyotrophic lateral sclerosis.

The present invention also provides a pharmaceutical composition for the prevention and treatment of degenerative brain diseases comprising, as an active ingredient, a vector comprising a polynucleotide encoding CrebA / CREB3L1 protein.

It is preferable that the Creb / CREB3L1 protein has any one of amino acid sequences selected from the amino acid sequences of 1) to 3)

1) an amino acid sequence described by SEQ ID NO: 1 (NCBI Accession number AAH14097);

2) a partial amino acid sequence of the amino acid sequence shown in SEQ ID NO: 1; or

3) an amino acid sequence having 80% or more homology with SEQ ID NO: 1.

The CrebA / CREB3L1 protein is characterized by the disappearance of neuronal dendritic cells, loss of the dendritic plasma membrane, and inhibition of Golgi outpost dysfunction.

The CrebA / CREB3L1 protein is characterized by increased vesicle-mediated transport, membrane organization or lipid biosynthetic process.

Wherein the CrebA / CREB3L1 protein further comprises a Rac1 protein or a polynucleotide encoding the Rac1 protein.

The vector comprising the CrebA / CREB3L1 polynucleotide may be a vector comprising a linear DNA, a plasmid vector, a viral expression vector, or a recombinant retrovirus vector, a recombinant adenovirus vector, a recombinant vector, But is not limited to, a recombinant viral vector comprising an adeno-associated virus (AAV) vector, a recombinant herpes simplex virus vector or a recombinant lentivirus vector.

In a specific example of the present invention, the present inventors confirmed that dendritic cells were lost due to polyQ toxicity of Drosophila C4da neurons expressing polyQ toxin MJDtr-78Q of Machado-Joseph disease (see FIG. 1) (See FIG. 2), the genome-wide mRNA sequencing analysis revealed that the polyQ toxicity inhibited vesicle-mediated transport, membrane structure, and lipid synthesis (see FIG. 3) It was confirmed that the vesicle-mediated transport, membrane structure and lipid synthesis were strongly associated with CrebA. Overexpression of CrebA / CREB3L1 protein in MJDtr-78Q-expressing Drosophila showed that the expression of the medium Golgi and the number of GOPs of the dendritic branch were increased it was confirmed that the GOP dysfunction of the water dendrite caused by polyQ toxicity was restored (see Fig. 4). In addition, it has been confirmed that CD4-tdGFP located in the plasma membrane increases in Drosophila expressing both MJDtr-78Q and CrebA and that CrebA regulates secretion pathway from the ER to the Golgi complex to suppress plasma membrane loss 5), it was confirmed that CrebA inhibited the disappearance of the C4da neuron dendrites and restored the dendritic branch shape (see FIG. 6), and the expression of CREB3L1 and Sec13 and Sec23A associated with cell membrane transport in the human derived HEK293T cell line and decreased by polyQ toxicity. (See FIG. 5).

Therefore, it is clear from the above results that the increased expression of CrebA / CREB3L1 gene or protein restores the function of GOP damaged by polyQ toxicity and cell membrane transport, suppresses the disappearance of the plasma membrane and dendrites, , CrebA / CREB3L1 protein or a polynucleotide encoding the same may be usefully used as an active ingredient of a pharmaceutical composition for the prevention or treatment of degenerative brain diseases.

  Compositions of the present invention may also include carriers, diluents, excipients, or a combination of two or more thereof commonly used in biological formulations. The pharmaceutically acceptable carrier is not particularly limited as long as the composition is suitable for in vivo delivery, for example, Merck Index, 13th ed., Merck & Inc. A buffered saline solution, a buffer solution, a dextrose solution, a maltodextrin solution, glycerol, ethanol, and one or more of these components may be mixed and used, and if necessary, an antioxidant, a buffer, Conventional additives may be added. In addition, diluents, dispersants, surfactants, binders, and lubricants may be additionally added to formulate into main dosage forms such as aqueous solutions, suspensions, emulsions, etc., pills, capsules, granules or tablets. Further, it can be suitably formulated according to each disease or ingredient, using the method disclosed in Remington's Pharmaceutical Science (Mack Publishing Company, Easton PA, 18th, 1990) in a suitable manner in the art.

The composition of the present invention may further contain one or more active ingredients showing the same or similar functions. The composition of the present invention contains 0.0001 to 10% by weight, preferably 0.001 to 1% by weight of the protein, based on the total weight of the composition.

The composition of the present invention may be administered orally or parenterally (for example, intravenously, subcutaneously, intraperitoneally or topically) orally, and the dose may be appropriately determined depending on the body weight, age, sex, The range varies depending on diet, administration time, method of administration, excretion rate, and severity of the disease. The daily dose of the composition according to the present invention is 0.0001 to 10 mg / ml, preferably 0.0001 to 5 mg / ml, more preferably administered once to several times a day.

The vector containing the polynucleotide encoding the CrebA / CREB3L1 protein of the present invention preferably contains 0.05 to 500 mg, more preferably 0.1 to 300 mg, and the CrebA / CREB3L1 protein encoding polynucleotide It is preferable that the recombinant viruses contain 10 ³ to 10 ¹² IU (10 to 10 ¹⁰ PFU), more preferably 10 ⁵ to 10 ¹⁰ IU.

In addition, the effective dose of the composition containing the polynucleotide encoding the CrebA / CREB3L1 protein of the present invention as an active ingredient is 0.05 to 12.5 mg / kg in the case of the vector per 1 kg of body weight, 10 ⁷ to 10 ¹¹ viral particles (10 ⁵ to 10 ⁹ IU) / ㎏, preferably when the vector is 0.1 to 10 ㎎ / ㎏, when the recombinant virus is 10 ⁸ to 10 ¹⁰ particles (10 ⁶ to 10 ⁸ IU ) / Kg, and can be administered 2 to 3 times a day. Such composition is not necessarily limited to this, and may vary depending on the condition of the patient and the severity of the disease.

The therapeutically effective amount of the composition of the present invention may vary depending on a variety of factors, such as the method of administration, the site of administration, the condition of the patient, and the like. Therefore, when used in the human body, the dosage should be determined in consideration of safety and efficacy. It is also possible to estimate the amount used in humans from the effective amount determined through animal experiments. These considerations in determining the efficacy can be found in, for example, Hardman and Limbird, eds., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 10th ed. (2001), Pergamon Press; And E.W. Martin ed., Remington's Pharmaceutical Sciences, 18th ed. (1990), Mack Publishing Co.

The present invention also provides a method for screening candidate substances for treating degenerative brain diseases.

The screening method of the degenerative brain disease therapeutic agent candidate preferably comprises the following steps:

1) treating the test substance with a CrebA / CREB3L1 expressing cell line;

2) measuring the expression level of CrebA / CREB3L1 protein or mRNA in the treated cell line of step 1); And

3) Selecting the test substance whose expression level of CrebA / CREB3L1 protein or mRNA of step 2) is increased compared to the control not treated with the test substance.

The test substance in the step 1) is preferably selected from the group consisting of natural compounds, synthetic compounds, RNA, DNA, polypeptides, enzymes, proteins, ligands, antibodies, antigens, bacteria or fungi metabolites and bioactive molecules.

The level of expression of the protein in step 2) may be determined by immunoprecipitation, radioimmunoassay (RIA), enzyme immunoassay (ELISA), immunohistochemistry, RT-PCR, Western blotting and flow cytometry ), But is not limited thereto.

The level of mRNA expression in step 2) is determined by reverse transcriptase polymerase chain reaction (RT-PCR), real-time PCR, and next-generation sequencing (NGS) But the present invention is not limited thereto. .

The activity level of the protein of step 2) is preferably, but not limited to, one selected from the group consisting of SDS-PAGE, immunofluorescence, enzyme immunoassay (ELISA), mass spectrometry and protein chip.

Hereinafter, the present invention will be described in detail with reference to Examples and Experimental Examples.

EXAMPLES The following Examples and Experiments are for the purpose of illustrating the present invention, but the present invention is not limited by the following Examples and Experimental Examples.

< Example  1> Genetically Modified Drosophila ( Drosophila ) Ready

The following fruit flies were sold in the Bloomington Drosophila Stock Center: UAS- MJDtr-27Q, UAS - MJDtr -78Q (II) UAS - MJDtr -78Q (III), UAS - SNCA A30P , UAS - RedStinger , UAS - Scr, UAS - GMA , UAS - Rac1 , UAS - TrioGEF1 , UAS - CBP - V5 , UAS - CBP RNAi , UAS- CyR2 , UAS- SCR RNAi, elav - gal4 (III) , UAS - CrebA , UAS - HLH106 RNAi, UAS - Dcr2 , UAS - Sec23 RNAi and UAS - Sec31 RNAi . The flies and their hybrids were grown in an incubator maintained at 25 ° C and 60% humidity and were fed a standard corn diet (GenExel).

< Example  2> Genome-wide mRNA -sequencing

Primarily, total RNA was extracted from 200 Drosophila heads per sample using Qiagen's RNeasy Mini Kit. Total RNA (2 ug) was obtained and fragmented using Illusion's Truseq Stranded mRNA LT Sample Prep Kit and poly-T oligo-attached magnetic beads. Then, reverse transcription of the segmented RNA was performed using Superscript II reverse transcriptase (Life Technologies). After that, adapter ligand libraries were sequenced using Illumina Hi-Seq 2500 (DNA Link, Korea). MRNA-sequencing analysis was performed using the results of two repeated experiments for each condition (wildtype control and MJDtr-78Q). During the read sequences from each sample, adapter sequences (TruSeq universal and indexed adapters) were removed using the cutadapter software. The remaining reads are done using the TopHat aligner and Drosophila melanogaster The standard dielectric (Flybase r5.57) was aligned. Because there are individual variations and consent gene copies in each genome, we allow two discrepancies when reading the sequence and allow reads to be aligned at up to 20 different positions (default for the TopHat aligner). After the alignment was completed, reads mapping to gene features (GTF flie of BDGP 5.73) were quantified using HTseq.

< Example 3> HEK293T  Transformation of cells and confirmation of gene expression

HEK293T cells were cultured in DMEM / High Glucose (Thermo Scientific HyClone) medium containing 10% fetal bovine serum (FBS) at 37 ° C in a CO ₂ incubator. Transfection was carried out one day before transfection and when confluency of 70-80% was observed. construct encoding the MJD-77Q (SEELRKRREAYFEKQQQKQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQRDLSGQSSHPCERPATSSGALGSDLGKACSPFIMFATFTLYLT, SEQ ID NO: 2) and the DNA of which the back 5 ㎍ introduced into a vector containing the CMV promoter using the lipofectamin2000 reagent (Invitrogen) were introduced into HEK 293T cell line. In order to confirm gene expression of the HEK 293T cells, the RNA of the cultured HEK 293T cells was extracted using RNeasy Mini Kit of Qiagen, 1 ug of extracted total RNA was reverse transcribed to synthesize cDNA, and PCR was performed using a Biorad PCR machine Were used for each polymerase chain reaction. Table 1 shows the primers used for confirmation of expression of sec61a, sec13, sec23A, and CREB3L1 used in the experiment. The band intensities of 18S rRNA in the electrophoresis were compared with the internal control.

gene Primer (Forward) Primer (Reverse) Sec61a 5'-GATCCAATTCAGGGAGAAAGTGC
(SEQ ID NO: 3) 3'-CGTACATGCCAGTCATCACATAG
(SEQ ID NO: 4) Sec13 5'-GTTGTACCTGGAAGCCTCATAG
(SEQ ID NO: 5) 3'-CACCTTATTGTCTCCACCAGAG
(SEQ ID NO: 6) Sec23A 5'- CTCCTGGAGATGAAATGCTGTC
(SEQ ID NO: 7) 3'-GCTAAGGTTGTAGTGGGACTAAG
(SEQ ID NO: 8) CREB3L1 5'- GATCTGAACGAGTCGGACTTCC
(SEQ ID NO: 9) 3 '- CATGCTCCATGCTCTGCATC
(SEQ ID NO: 10)

< Experimental Example  1> PolyQ  Toxic nerve cell Dendrite dendrite damage

(MJDtr-78Q OE) ppk-gal4 driver (Drosophila C4da) was used to over-express MJDtr-78Q, a disease of Machado-Joseph's Disease, one of the spinal cord cerebellar degeneration, The fluorescence signal of the expression system for specific expression of neurons was observed with a Confocal microscope (Zeiss), and the shape of the dendrite was confirmed. The number of branch points within 150 μm from soma The degree of loss of the number of water dendrites was counted.

As a result, it was confirmed that the dendritic cells branched in higher order from the C4 da (Drosophila larval class IV dendritic arborization) neurons of MJDtr-78Q overexpressing Drosophila (MJDtr-78Q OE) were severely destroyed compared to the control (W1118) . In addition, in order to confirm the effect of polyQ toxicity on F-actin polymerization, Rac1 together with MJDtr-78Q was analyzed by using Drosophila expressing TrioGEF1 activating Rac1, a protein controlling F-actin polymerization, Respectively. As a result, it was confirmed that dendrites lost by MJDtr-78Q toxicity were restored by overexpression of TrioGEF1. (Figures 1A-E).

In order to confirm whether the polyQ toxin protein inhibits the growth of the dendritic cells, the present inventors used the Drosophila induced to express MJDtr-78Q and simultaneously label the plasma membrane (PM) with CD4-tdGFP, And the size of dendritic branches of C4da neurons were compared. As a result, as shown in Fig. 1 F and G, MJDtr-78Q OE showed weak fluorescence intensity of CD4-tdGFP as compared with the control, and found that the plasma membrane of the dendritic lobes disappeared. The disappearance of the plasma membrane of these dendrites is due to nuclear toxicity of polyQ protein, which is a protein of Ataxin1-82Q, a disease of Spinocerebella ataxia, a type of polyQ disease, MJDtr-78Q, a protein of Machado-Joseph's Disease Plasma membrane loss was observed in MJDFL-78 overexpressing Drosophila (Fig. 1H).

< Experimental Example  2> PolyQ  GOP dysfunction due to toxicity Dendrite  Loss of plasma membrane

In order to confirm whether the disappearance of dendritic cells due to toxicity of polyQ in Experimental Example 1 was a phenomenon specific to the plasma membrane (PM), the ratio of mCD8GFP marking the water dendrites to the nucleus-labeled Redstinger was compared. As a result, MJDtr- Showed no decrease in the expression of Redstinger, but the ratio of mCD8GFP / Redstinger was decreased as compared with that of the control, confirming that polyQ toxicity was a plasma membrane-specific phenomenon (FIGS. 2A and B).

Recent studies have reported that Golgi outposts (GOPs) play an important role in the growth and maintenance of dendrites by supplying proteins and plasma membranes of peripheral dendrites. Therefore, in order to confirm that the loss of peripheral dendrites and the reduction of plasma membrane are caused by functional dysfunction of GOP, the change of intracellular expression of Man II-eGFP, which mediates the medial Golgi compartment due to polyQ toxicity, was observed . As a result, it was confirmed that the expression of GOP in the first and second dendrites of C4da neurons of MJDtr-78Q or Ataxin 1-82Q overexpressing Drosophila was reduced compared to the control (Figs. 2C, D and E).

< Experimental Example  3> polyQ  Toxicity-mediated vesicle transport, membrane structure and lipid synthesis inhibition

MRNA was extracted from the head of the control and MJDtr-78Q Drosophila, as in Example 2, in order to investigate the signal pathway related to degradation of the plasma membrane supply or GOP loss due to PolyQ nuclear toxicity confirmed in <Experimental Example 2> mRNA-sequencing was performed (Figure 3A). As a result, 5,385 genes showing different expression from the control in MJDtr-78Q were identified, and 98.9% (5,325 genes) of them were found to be suppressed in the expression of polyQ. Thus, polyQ toxicity inhibited general cell activity It can be seen that it plays a role. In addition, the 5,325 inhibitory genes were subjected to an enrichment analysis of gene ontology biological processes (GOBP) using the DAVID program (DAVID Bioinformatics Resources, USA NIH provided) as an online analysis database. As a result, (Fig. 3B). Using the above results, sub-GOBP analysis was conducted to examine the factors influenced by polyQ toxicity in each field. As a result, ER-Golgi transport (Figs. 3C and F), vesicle-mediated transport Regarding membrane organization-related processes, protein distribution and plasma membrane structure of the plasma membrane (Figures 3D and G) are strongly influenced by polyQ toxicity. Also, in relation to lipid biosynthetic process, sphingolipid biosynthesis is strongly influenced by polyQ toxicity, which means that polyQ toxicity changes the lipid level of the plasma membrane.

< Experimental Example 4> CrebA / Of CREB3L1 polyQ  Recovery of GOP loss due to toxicity

In order to find factors that could inhibit the damage of the dendritic cells due to polyQ toxicity, the vesicle-mediated transport, which is an intracellular process strongly influenced by polyQ toxicity, We examined the transcription factor associated with membrane organization and lipid biosynthetic process. As a result, 29 transcription factors related to the above three processes were selected (Fig. 4A). Among the 29 candidate transcription factors, CrebA (human CREB3L1 and ortholog) was found to have strong association with membrane structure represented by vesicle-mediated transport and plasma membrane protein distribution represented by ER-Golgi transport. In addition, HLH006 (human SREBP1 and heterologous homologous gene) was found to be strongly associated with lipid synthesis, represented by spingolipid biosynthesis. In addition, Dref (human DREF and heterologous homologous genes) were found to be involved in both vesicle mediated transport, gt vesicle mediated transport, membrane structure, and lipid synthesis. In addition, these CrebA, HLH106, Dref and gt in the MJDtr-78Q Drosophila And the expression of the 4 genes was inhibited by polyQ toxicity (Fig. 4B).

In order to confirm whether CrebA, HLH106, Dref and gt were able to restore GOP disappearance due to polyQ toxicity in neurons, MJDtr-78Q was expressed and at the same time, , The expression of ManⅡ-eGFP, which is a medium Golgi complex, was confirmed by microscopy. As a result, it was confirmed that the disappearance of GOP was recovered in CrebA overexpressed individuals (CrebA OE) (FIGS. 4C, D and E). These results indicate that CrebA can regulate GOP production and restore the polyQ-induced GOP loss of C4da neurons.

< Experimental Example  5> CrebA / Of CREB3L1 on polyQ  Restriction of supply of plasma membrane by

Expression changes of CD4-tdGFP (protoplasmic markers) in W1118 (control), MJDtr-78Q OE, or MJDtr-78Q OE + CrebA OE fruit flies were examined to determine whether GOP recovery was accompanied by recovery of plasma membrane supply of peripheral dendrites Respectively. As a result, expression of CD4-tdGFP was decreased in MJDtr-78Q OE, and expression of CD4-tdGFP was restored in MJDtr-78Q OE + CrebA OE Drosophila and higher expression level than that of the control (FIGS. 5A and 5B).

In order to confirm whether COPⅡ (coat protein II), which is known to regulate the secretion pathway from ER to Golgi, is involved in the recovery of the plasma membrane by CrebA, sec31, which is a main component of COP II, is expressed by knockdown The expression of mCD8-GFP (a plasma membrane marker) was compared using the Drosophila melanogaster (MJDtr-78Q OE + CrebA OE + Sec31 RNAi). As a result, it was confirmed that expression of mCD8-GFP recovered in MJDtr-78Q OE + CrebA OE Drosophila was reduced again by sec31 RNAi (FIG. 5C). In addition, 15 COP II pathway-related molecules (44.1% of 34 genes) among the target genes of CrebA were found to be inhibited in MJDtr-78Q OE Drosophila (FIG. 5D), and the expression of Sec61α was overexpressed by CrebA Recovery was confirmed by western blot analysis (Fig. 5E). From the above results, it can be seen that CrebA controls the COP II signaling pathway, and the CrebA-COP II signaling pathway is inhibited by polyQ toxicity, resulting in loss of peripheral dendritic cells. In addition, the expression of mRNAs of Sec13 and Sec23A, which are major constituents of CREB3L1 and COP II, by polyQ toxicity was examined using HEK293T cell line derived from humans, and the expression of CREB3L1 was decreased in MJD-77Q overexpressed group , Sec13, and Sec23A were reduced, indicating that the disappearance of dendritic cells by the polyQ-CrebA / CREB3L1-COP II axis is a pathway to both Drosophila and humans, and that CrebA / CREB3L1 can restore dendritic loss Respectively.

< Experimental Example  6> CrebA  And To Rac1  by Dendritic  Recovery of form

Although overexpression of CrebA restored the disappearance of plasma membrane in Experimental Example 4 and Experiment 5, Rac1 was overexpressed with CrebA to solve the problem, As a result of increasing the actin polymerization, it was confirmed that the shape of the peripheral dendritic bifurcation branched to the lower level as shown in FIG. 6.

<110> Daegu Gyeongbuk Institute of Science and Technology <120> Composition comprising Creb3L1 / CrebA protein or polynucleotide          encoding the CrebA / CREB3L1 for the prevention or treatment of          네로 드제제제 <130> 20160044 <160> 10 <170> KoPatentin 3.0 <210> 1 <211> 519 <212> PRT <213> Artificial Sequence <220> Artificial sequence <400> 1 Met Asp Ala Val Leu Glu Pro Phe Pro Ala Asp Arg Leu Phe Pro Gly   1 5 10 15 Ser Ser Phe Leu Asp Leu Gly Asp Leu Asn Glu Ser Asp Phe Leu Asn              20 25 30 Asn Ala His Phe Pro Glu His Leu Asp His Phe Thr Glu Asn Met Glu          35 40 45 Asp Phe Ser Asn Asp Leu Phe Ser Ser Phe Phe Asp Asp Pro Val Leu      50 55 60 Asp Glu Lys Ser Pro Leu Leu Asp Met Glu Leu Asp Ser Pro Thr Pro  65 70 75 80 Gly Ile Gln Ala Glu His Ser Tyr Ser Leu Ser Gly Asp Ser Ala Pro                  85 90 95 Gln Ser Pro Leu Val Pro Ile Lys Met Glu Asp Thr Thr Gln Asp Ala             100 105 110 Glu His Gly Ala Trp Ala Leu Gly His Lys Leu Cys Ser Ile Met Val         115 120 125 Lys Gln Glu Gln Ser Pro Glu Leu Pro Val Asp Pro Leu Ala Ala Pro     130 135 140 Ser Ala Met Ala Ala Ala Ala Met Ala Thr Thr Pro Leu Leu Gly 145 150 155 160 Leu Ser Pro Leu Ser Arg Leu Pro Ile Pro His Gln Ala Pro Gly Glu                 165 170 175 Met Thr Gln Leu Pro Val Ile Lys Ala Glu Pro Leu Glu Val Asn Gln             180 185 190 Phe Leu Lys Val Thr Pro Glu Asp Leu Val Gln Met Pro Pro Thr Pro         195 200 205 Pro Ser Ser His Gly Ser Asp Ser Asp Gly Ser Gly Ser Pro Arg Ser     210 215 220 Leu Pro Pro Ser Ser Pro Val Arg Pro Met Ala Arg Ser Ser Thr Ala 225 230 235 240 Ile Ser Thr Ser Pro Leu Leu Thr Pro Pro His Lys Leu Gln Gly Thr                 245 250 255 Ser Gly Pro Leu Leu Leu Thr Glu Glu Glu Lys Arg Thr Leu Ile Ala             260 265 270 Glu Gly Tyr Pro Ile Pro Thr Lys Leu Pro Leu Thr Lys Ala Glu Glu         275 280 285 Lys Ala Leu Lys Arg Val Arg Arg Lys Ile Lys Asn Lys Ile Ser Ala     290 295 300 Gln Glu Ser Arg Arg Lys Lys Lys Glu Tyr Val Glu Cys Leu Glu Lys 305 310 315 320 Lys Val Glu Thr Phe Thr Ser Glu Asn Asn Glu Leu Trp Lys Lys Val                 325 330 335 Glu Thr Leu Glu Asn Ala Asn Arg Thr Leu Leu Gln Gln Leu Gln Lys             340 345 350 Leu Gln Thr Leu Val Thr Asn Lys Ile Ser Arg Pro Tyr Lys Met Ala         355 360 365 Ala Thr Gln Thr Gly Thr Cys Leu Met Val Ala Leu Cys Phe Val     370 375 380 Leu Val Leu Gly Ser Leu Val Pro Cys Leu Pro Glu Phe Ser Ser Gly 385 390 395 400 Ser Gln Thr Val Lys Glu Asp Pro Leu Ala Ala Asp Gly Val Tyr Thr                 405 410 415 Ala Ser Gln Met Pro Ser Arg Ser Leu Leu Phe Tyr Asp Asp Gly Ala             420 425 430 Gly Leu Trp Glu Asp Gly Arg Ser Thr Leu Leu Pro Met Glu Pro Pro         435 440 445 Asp Gly Trp Glu Ile Asn Pro Gly Gly Pro Ala Glu Gln Arg Pro Arg     450 455 460 Asp His Leu Gln His Asp His Leu Asp Ser Thr His Glu Thr Thr Lys 465 470 475 480 Tyr Leu Ser Glu Ala Trp Pro Lys Asp Gly Gly Asn Gly Thr Ser Pro                 485 490 495 Asp Phe Ser His Ser Lys Glu Trp Phe His Asp Arg Asp Leu Gly Pro             500 505 510 Asn Thr Thr Ile Lys Leu Ser         515 <210> 2 <211> 134 <212> PRT <213> Artificial Sequence <220> Artificial sequence <400> 2 Ser Glu Glu Leu Arg Lys Arg Arg Glu Ala Tyr Phe Glu Lys Gln Gln   1 5 10 15 Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln              20 25 30 Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln          35 40 45 Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln      50 55 60 Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln  65 70 75 80 Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Arg Asp Leu Ser Gly                  85 90 95 Gln Ser Ser His Pro Cys Glu Arg Pro Ala Thr Ser Ser Gly Ala Leu             100 105 110 Gly Ser Asp Leu Gly Lys Ala Cys Ser Pro Phe Ile Met Phe Ala Thr         115 120 125 Phe Thr Leu Tyr Leu Thr     130 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <220> Artificial sequence <400> 3 gatccaattc agggagaaag tgc 23 <210> 4 <211> 23 <212> DNA <213> Artificial Sequence <220> Artificial sequence <400> 4 cgtacatgcc agtcatcaca tag 23 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> Artificial sequence <400> 5 gttgtacctg gaagcctcat ag 22 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> Artificial sequence <400> 6 caccttattg tctccaccag ag 22 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> Artificial sequence <400> 7 ctcctggaga tgaaatgctg tc 22 <210> 8 <211> 23 <212> DNA <213> Artificial Sequence <220> Artificial sequence <400> 8 gctaaggttg tagtgggact aag 23 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> Artificial sequence <400> 9 gatctgaacg agtcggactt cc 22 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> Artificial sequence <400> 10 catgctccat gctctgcatc 20

Claims (14)

A pharmaceutical composition for preventing or treating a degenerative brain disease comprising, as an active ingredient, CrebA / CREB3L1 (cAMP-response element-binding protein 3 like 1) protein or a polynucleotide encoding the same,
These degenerative brain diseases include spinocerebellar ataxias (SCA) types 1, 2, 6, 7 and 17, Machado-Joseph disease (MJD / SCA3) ), Huntington's disease, dentatorubral pallidoluysian atrophy (DRPLA), X-linked spinal muscular atrophy (X-linked 1, SMAX1 / SBMA) And amyotrophic lateral sclerosis. &Lt; Desc / Clms Page number 13 &gt;
delete CLAIMS 1. A pharmaceutical composition for the prevention and treatment of degenerative brain diseases comprising, as an active ingredient, a vector comprising a polynucleotide encoding CrebA / CREB3L1 protein,
The degenerative brain diseases include spinal cord motor neuron demonstration 1, 2, 6, 7 and 17, Machado-Joseph disease, Huntington's disease, dentate nucleus hypocotyledonous atrophy, X-linked spinal muscular atrophy 1, and amyotrophic lateral sclerosis Lt; RTI ID = 0.0 &gt; of: &lt; / RTI &gt;
4. The pharmaceutical composition according to any one of claims 1 to 3, wherein the CrebA / CREB3L1 protein has an amino acid sequence represented by SEQ ID NO: 1 (NCBI Accession number AAH14097).
The pharmaceutical composition according to any one of claims 1 to 3, wherein the CrebA / CREB3L1 protein inhibits the disappearance of neuronal dendritic cells, loss of dendritic plasma membrane, and Golgi outpost dysfunction.
4. The pharmaceutical composition according to claim 1 or 3, wherein the CrebA / CREB3L1 protein increases vesicle-mediated transport, membrane organization or lipid biosynthetic process. .
4. The pharmaceutical composition according to any one of claims 1 to 3, further comprising a Rac1 protein or a polynucleotide encoding the Rac1 protein.
4. The pharmaceutical composition according to claim 3, wherein the vector is any one selected from the group consisting of a linear DNA plasmid DNA and a recombinant viral vector.
9. The pharmaceutical composition according to claim 8, wherein the recombinant virus is any one selected from the group consisting of retrovirus, adenovirus, adeno-associated virus, herpes simplex virus, and lentivirus.
1) treating the test substance with a CrebA / CREB3L1 expressing cell line;
2) measuring the expression level of CrebA / CREB3L1 protein or mRNA in the treated cell line of step 1); And
3) screening a candidate substance for degenerative brain disease therapeutic agent, wherein the expression level of the CrebA / CREB3L1 protein or mRNA of step 2) is increased compared to a control group not treated with the test substance,
The degenerative brain diseases include spinal cord motor neuron demonstration 1, 2, 6, 7 and 17, Machado-Joseph disease, Huntington's disease, dentate nucleus hypocotyledonous atrophy, X-linked spinal muscular atrophy 1, and amyotrophic lateral sclerosis &Lt; / RTI &gt;
The method according to claim 10, wherein the test substance in step 1) is selected from the group consisting of natural compounds, synthetic compounds, RNA, DNA, polypeptides, enzymes, proteins, ligands, antibodies, antigens, And the selected one is selected.
11. The method of claim 10, wherein the level of expression of the protein of step 2) is selected from the group consisting of immunoprecipitation, radioimmunoassay (RIA), enzyme immunoassay (ELISA), immunohistochemistry, RT-PCR, Western blotting, And flow cytometry (FACS). &Lt; Desc / Clms Page number 19 &gt;
11. The method of claim 10, wherein the mRNA expression level of step 2) is selected from the group consisting of reverse transcriptase polymerase chain reaction (RT-PCR), real-time PCR, next-generation sequencing, NGS). &lt; / RTI &gt;
delete

Images