KR101792813B1 - A composition and method for predicting of treatment response to attention-deficit hyperactivity disorder medicine - Google Patents

A composition and method for predicting of treatment response to attention-deficit hyperactivity disorder medicine Download PDF

Info

Publication number
KR101792813B1
KR101792813B1 KR1020160008895A KR20160008895A KR101792813B1 KR 101792813 B1 KR101792813 B1 KR 101792813B1 KR 1020160008895 A KR1020160008895 A KR 1020160008895A KR 20160008895 A KR20160008895 A KR 20160008895A KR 101792813 B1 KR101792813 B1 KR 101792813B1
Authority
KR
South Korea
Prior art keywords
subject
deficit hyperactivity
hyperactivity disorder
attention deficit
genotype
Prior art date
Application number
KR1020160008895A
Other languages
Korean (ko)
Other versions
KR20170102586A (en
Inventor
김붕년
김인향
박수빈
홍순범
김재원
정재훈
한덕현
Original Assignee
서울대학교병원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 서울대학교병원 filed Critical 서울대학교병원
Priority to KR1020160008895A priority Critical patent/KR101792813B1/en
Priority to PCT/KR2016/004969 priority patent/WO2017131293A1/en
Publication of KR20170102586A publication Critical patent/KR20170102586A/en
Application granted granted Critical
Publication of KR101792813B1 publication Critical patent/KR101792813B1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Pathology (AREA)

Abstract

To compositions and methods for predicting therapeutic responses to treatments for Attention Deficit Hyperactivity Disorder. One aspect relates to a method of treating a subject suffering from attention deficit hyperactivity disorder, comprising administering to a subject having an Attention Deficit Hyperactivity Disorder, a reagent capable of detecting the rs2284411 polymorphic site of a polynucleotide encoding a glutamate receptor (ionotropic, N-methyl D-aspartate 2B: GRIN2B) A composition for predicting responsiveness to treatment with phenidate is provided. Another aspect provides a method for predicting responsiveness to methylphenidate treatment in a subject with attention deficit hyperactivity disorder and a method for selecting a subject having a likelihood of responding to methylphenidate treatment among subjects with attention deficit hyperactivity disorder do.

Description

Technical Field [0001] The present invention relates to a composition and method for predicting therapeutic response to a treatment for attention deficit hyperactivity disorder

To compositions and methods for predicting therapeutic responses to treatments for Attention Deficit Hyperactivity Disorder.

Attention Deficit Hyperactivity Disorder (ADHD) is a neurodevelopmental disorder characterized by developmentally impaired attention deficit, hyperactivity, and / or impulsivity. The major pathophysiology of ADHD is abnormal dopamine and norepinephrine neurotransmission, and several candidate gene association studies have been performed on dopamine and norepinephrine related genes.

Methylphenidate (MPH) is the most widely prescribed primary drug for ADHD and has been shown to improve symptom and performance function performance with a response rate of 65-75%. Its main therapeutic mechanism is due to an increase in dopamine and norepinephrine in the prefrontal cortex and blockade of dopamine and norepinephrine transporters by increasing dopamine in the striatum. Despite its primary effect on the dopamine and norepinephrine systems, previous animal studies have shown that glutamatergic system, particularly N-methyl-D-aspartate, as another mechanism of MPH, aspartate: NMDA) receptors.

The GRIN2B gene is an NMDA receptor related gene, coding for the NR2B subunit. The GRIN2B gene is known to be associated with multiple developmental disorders and has been the target of pharmacogenetic studies of schizophrenia and bipolar disorder.

However, the relationship between the reactivity to methylphenidate and the GRIN2B gene has not been known so far.

One aspect provides a composition for predicting responsiveness to methylphenidate treatment in a subject having Attention Deficit Hyperactivity Disorder.

Another aspect provides a method for predicting responsiveness to methylphenidate treatment in subjects with attention deficit hyperactivity disorder.

Another aspect provides a method of selecting a subject having the potential to respond to methylphenidate treatment in a subject having an Attention Deficit Hyperactivity Disorder.

One aspect relates to a method of treating a subject suffering from attention deficit hyperactivity disorder, comprising administering to a subject having an Attention Deficit Hyperactivity Disorder, a reagent capable of detecting the rs2284411 polymorphic site of a polynucleotide encoding a glutamate receptor (ionotropic, N-methyl D-aspartate 2B: GRIN2B) A composition for predicting responsiveness to treatment with phenidate is provided.

The term "glutamate receptor (ionotropic, N-methyl D-aspartate 2B: GRIN2B)" is a protein encoded by the GRIN2B gene and is also named N-methyl D-asphaltate receptor subtype 2B, NMDAR2B, or NR2B . The term "polynucleotide encoding glutamate receptor" can be named GRIN2B- encoding gene or GRIN2B gene. The term "rs2284411 polymorphism" means the SNP identified by the number 'rs2284411' in the NCBI single nucleotide polymorphism (SNP) database. The polymorphic site may be located at position 13713238 of chromosome 12. The polymorphic site means a site represented by [C / T], which is the 26 th nucleotide of the following nucleotide sequence.

ACTTTTTTCCCCTACTCTTGGTCCA [C / T] TTGATGCTCTCCTTTTATGCTCCTA (SEQ ID NO: 1)

Subjects with the Attention Deficit Hyperactivity Disorder (ADHD) may be subjects diagnosed according to the ADHD diagnostic criteria known in the art. The diagnostic criteria may be, for example, those described in the Diagnostic and Statistical Manual of Mental Disorders-Fourth Edition (DSM-IV). For example, the Korean version of the Kiddie-Schedule for Affective Disorders and Schizophrenia-Present and Lifetime Version (K-SADS-PL) can be used as an inspection tool for ADHD.

The methylphenidate may have the following formula. The methylphenidate may also be a drug named trade name Concerta, Methylin, Medikinet, Ritalin, Equasym XL, Quillivant XR, or Metadate.

Figure 112016008200775-pat00001

The reagent may be a primer set or a probe.

The primer set may comprise the oligonucleotides of SEQ ID NO: 2 and SEQ ID NO: 3. The primer set can be used to amplify a DNA fragment containing the rs2284411 polymorphic site as a template, or a part of genomic DNA comprising a polynucleotide encoding the glutamate receptor. The genotype of the polymorphic site can be determined through base sequence analysis of the amplified fragment. In addition, a primer extension reaction using an extension primer specific to the polymorphic site can be performed on the amplified fragment to determine the genotype of the site. The extension primer may be the oligonucleotide of SEQ ID NO: 4.

The probe may have a sequence complementary to a polynucleotide encoding the glutamate receptor or a polynucleotide consisting of a contiguous nucleotide including the polymorphic site as part of a complementary polynucleotide thereof. The genotype of the polymorphic site can be determined by a difference in stability of a duplex formed by hybridization with the probe or a difference in signal generation depending on hybridization with the probe.

In another aspect, there is provided a method of treating a subject suffering from attention deficit hyperactivity disorder comprising: obtaining a nucleic acid sample from a subject having an attention deficit hyperactivity disorder; Detecting a rs2284411 polymorphic site of a polynucleotide encoding a glutamate receptor (GRIN2B) in said sample to determine the genotype of said site; When the genotype is C / C, determining that the responsiveness of the subject to methylphenidate treatment is greater than that of a subject having an attention deficit hyperactivity disorder wherein the genotype is C / T or T / T A method for predicting responsiveness to methylphenidate treatment in a subject having attention deficit hyperactivity disorder.

In this method, the glutamate receptor (GRIN2B), the polynucleotide encoding it, the rs2284411 polymorphism, the subject with attention deficit hyperactivity disorder, and the methylphenidate treatment are as described above.

The sample may be obtained from the blood of the subject.

The detecting may be using a primer set or a probe specific for the polymorphic site. The primer set may comprise the oligonucleotides of SEQ ID NO: 2 and SEQ ID NO: 3. The method of determining the genotype of the site using the primer set or probe is as described above.

The detecting step may be performed by base sequence analysis, microarray analysis, allele-specific PCR analysis, PCR extension analysis, mass spectrometry, or a combination thereof.

Wherein the detecting step comprises using a nucleic acid sample obtained from the subject as a template and using a primer set capable of amplifying the polynucleotide or a polynucleotide complementary to the polymorphic site, ; And determining the sequence of the resulting amplification product.

The nucleotide sequence analysis can be performed by a conventional method for sequencing the nucleotide sequence for determination of the nucleotide sequence. The nucleotide sequence analysis can be performed using an automated gene analyzer. Microarray analysis can be performed using an array in which probes specific for the polymorphic sites are immobilized. In allele-specific PCR analysis, when a DNA fragment in which the SNP is located is amplified using a primer set including a primer designed with the base at the 3 'end at which the SNP is located, complementary binding is possible depending on the base at the SNP position Or the amplification reaction can not be performed normally or can not be performed.

The PCR extension assay first amplifies a DNA fragment containing a base in which a single nucleotide polymorphism is located into a pair of primers, inactivates all of the nucleotides added to the reaction by dephosphorylation and adds thereto an extension primer specific to the SNP, a dNTP mixture , Digoxinucleotide, reaction buffer, and DNA polymerase to perform a primer extension reaction. In the primer extension reaction, the position at which the extension reaction is terminated differs depending on the base where the polymorphism is located, so that the base can be determined by comparing the length of the extended product. When the extension primer or didyxin nucleotide is fluorescently labeled, fluorescence can be detected through a gene analyzer. If the extension primer or didyxin nucleotide is not labeled, SNP can be detected by measuring the molecular weight through MALDI-TOF (matrix assisted laser desorption ionization-time of flight).

In another aspect, there is provided a method of treating a subject suffering from attention deficit hyperactivity disorder comprising: obtaining a nucleic acid sample from two or more subjects having attention deficit hyperactivity disorder; Detecting the rs2284411 polymorphic site of the polynucleotide encoding the glutamate receptor (GRIN2B) from each of the samples to determine the genotype of the region; And selecting a subject having the genotype as a subject having a likelihood of responding to methylphenidate treatment to a subject having C / C, a subject having a likelihood of responding to methylphenidate treatment among subjects with attention deficit hyperactivity disorder Provides a method of selecting.

In this method, the glutamate receptor (GRIN2B), the polynucleotide encoding it, the rs2284411 polymorphism, the subject with attention deficit hyperactivity disorder, and the methylphenidate treatment are as described above.

The sample may be obtained from the blood of the subject.

The detecting may be using a primer set or a probe specific for the polymorphism. The primer set may comprise the oligonucleotides of SEQ ID NO: 2 and SEQ ID NO: 3. The method of determining the genotype of the site using the primer set or probe is as described above.

The detecting step may be performed by base sequence analysis, microarray analysis, allele-specific PCR analysis, PCR extension analysis, mass spectrometry, or a combination thereof. The respective analysis methods are as described above.

According to a composition according to one aspect and a method according to another aspect, the reactivity to methylphenidate treatment can be effectively predicted in a subject with attention deficit hyperactivity disorder.

According to a method of selecting according to another aspect, a subject having a likelihood of responding to methylphenidate treatment among subjects having attention deficit hyperactivity disorder can be effectively selected.

The present invention will be described in more detail with reference to the following examples. However, the following examples are provided to aid understanding of the present invention, and the scope of the present invention is not limited by these examples in any sense.

Example  1: Attention deficit hyperactivity disorder ADHD )in GRIN2B of rs2284411  Analysis of association between polymorphism and methylphenidate response

1.1. Subject

From August 2010 to August 2014, patients from 6 to 14 years of age were recruited from the outpatient ward of the Department of Child and Adolescent Psychiatry at Seoul National University Hospital. They were diagnosed with ADHD by a juvenile adolescent psychiatrist according to the criteria of the Diagnostic and Statistical Manual of Mental Disorders-Fourth Edition (DSM-IV). The Korean version of the Kiddie-Schedule for Affective Disorders and Schizophrenia-Present and Lifetime Version (K-SADS-PL) test confirmed ADHD diagnosis. Exclusion criteria for the ADHD group were: (1) an IQ of less than 70, (2) a genetic disorder, (3) brain trauma, organic brain disorder, seizures, (4) Autism spectrum disorder, communication disorder or learning disorder (5) Schizophrenia or other childhood onset psychotic disorder (6) Major depressive disorder Or bipolar disorder (7) Tourette's syndrome or chronic motor / vocal tic disorder (8) Obsessive-compulsive disorder (9) History of methylphenidate therapy that lasts for 1 year or more within 4 weeks. IQ was measured using the Korean Educational Development Institute's Wechsler Intelligence Scales for Children (KEDI-WISC). Written consent was obtained from the legal guardian of the participant and the study protocol was approved by the Clinical Trials Board of Seoul National University Hospital (IRB No. 1206-054-414).

1.2. Methylphenidate  Definition of administration and treatment response

This study was conducted as part of a two-year longitudinal study. Participants were prescribed methylphenidate or atomocetin after breakfast once daily. Participants included in this study were participants in the open-label trial of methylphenidate and evaluated treatment response for 6 months. Participants visited the clinic and conducted interviews with children and adolescent psychiatrists at 2, 4, 6, 8, 16, and 24 weeks to adjust medications. The initial dose was fixed for 2 weeks and then increased by the judgment of a psychiatrist based on the subjects 'and parents' reports until a satisfactory response was achieved. The maximum dose was 72 mg and the final dose was set in the range of 0.7 to 1.5 mg / kg.

To assess changes in ADHD symptoms before and after methylphenidate treatment, a Korean version of the ADHD Rating Scale-IV (ADHD-RS) and Clinical Global Impression - Improvement (ADHD) CGI-I) scale was applied to the patients. The ADHD-RS is an 18-item scaled by 0 to 3 scales with a total score ranging from 0 to 54. The nine items assessed attention deficit symptoms and the remaining nine items targeted hyperactivity - impulsivity symptoms. The CGI-I scale is a widely used measure for assessing symptom improvement by physicians, with a range of 7 representing 'highly improved' to 7 representing 'very aggravated'. All assessors were unaware of the GRIN2B genotype.

The Korean version of the continuous performance test (CPT), referred to as an attention diagnostic system (ADS), was performed before and after treatment as an objective tool to assess treatment response. Omission error (measurement of carelessness), which measures the number of non-response, commission error (measurement of impulsivity), which measures the number of false responses, response time ), And the standard deviation of response time (measurement of response time variability), which represents the standard deviation of the response time of the correct response, is shown by the adjusted T score for the age. A lower T score indicates better performance.

Four different criteria for treatment response were applied according to post-treatment changes in ADHD-RS and CGI-I scores during the 6-month evaluation period. As the first criterion, subjects with a reduction of more than 40% in the ADHD-RS score were defined as excellent responders and the remaining subjects were defined as low responders. ADHD-RS attention, hyperactivity-impulsivity, and total scores were analyzed to identify improved symptom domains. As a second criterion, subjects with a CGI-I score of 2 or less in the 6-month evaluation period were classified as excellent responders, and subjects with a score of 3 to 7 were classified as low responders. As a third, more stringent criterion, subjects with a CGI-I score of less than 2 with a reduction of more than 40% in the ADHD-RS score were classified as excellent responders and the remaining subjects as low responders. As a fourth criterion, for the treatment response measured by CPT, subjects with a 10% or greater decrease in each variable were classified as excellent responders and the remaining subjects were classified as low responders.

1.3. Genotype analysis

Genomic DNA was extracted from the blood of the frozen patient using the G-DEX II genomic DNA extraction kit (Intron, Korea). 5 'ACG TTG GAT GAT GAC ATC ATC AGT GTC TGC (SEQ ID NO: 2) and 5' ACG TTG GAT GCA TGA CTT TTT TCC CCT ACT C (SEQ ID NO: 2) prepared using Assay Designer 3.1 (Sequenom, Inc.) (SEQ ID NO: 3) was used to amplify a DNA fragment containing the rs2284411 polymorphic site of GRIN2B. The nucleotides added for the PCR reaction were inactivated by dephosphorylation using 0.3 U of shrimp alkaline phosphatase and added with 5 uM of rs2284411 specific extension primer (5 'GCA TAA AAG GAG AGC ATC: SEQ ID NO: 4) of GRIN2B, The primer extension reaction was performed by adding digoxinucleotide, reaction buffer, and Thermosequenase enzyme (Sequenom, CA). The primer extension reaction was performed at 95 ° C for 2 minutes, followed by 55 cycles consisting of 94 ° C for 5 seconds, 52 ° C for 5 seconds, and 72 ° C for 5 seconds. Reaction by-products were de-chlorinated with SpectroCLEAN (Sequenom, Inc.) and dispensed to SpectroCHIP (Sequenom, Inc.) using SpectroJET (Sequenom, Inc.). The rs2284411 polymorphism of GRIN2B was detected by analyzing primer extension products using a chip-based MALDI-TOF mass spectrometry platform (Sequenom, Inc., California, USA).

1.4. Statistical analysis

The GRIN2B genotypes were divided into two groups due to the scarcity of recessive genotypes: C / C group and C / T + T / T group. The two groups were between demographic characteristics and clinical characteristics were compared using the exact test (Fisher's exact test) of the χ 2 test or Fisher for independent t- test and categorical variables (categorical variables) for continuous variables. We used the GRIN2B T / T + C / T genotype as the primary predictor and the age, sex, IQ, baseline CGI-S score, baseline ADHD-RS total score , Multivariate logistic regression analysis was performed using the final methylphenidate dose. Changes in the total score of ADHD-RS, attention score, and variables of hyperactivity-impulsivity score and continuous performance test (CPT) were compared between the genotypic groups using independent t-test. All statistical analyzes were performed using SPSS (version 22.0; SPSS Inc., Chicago, IL, USA) and the statistical significance was defined as a p-value of 0.05 (2-tailed).

1.5. result

Of the 110 ADHD patients, 75 patients (age 8.84 ± 2.23 years, 64 males and 11 females) were included in the final analysis, of which 73 completed the ADHD-RS before and after treatment. The mean final methylphenidate dose at the 6-month follow-up was 28.14 ± 12.31 mg and the mean total ADHD-RS score was significantly reduced from 24.85 ± 11.03 to 14.48 ± 9.25 (p <0.001). There were 37 (49.3%) participants with a CGI-I score of 2 or less in the 6-month period, 38 participants (50.7%) with a total ADHD-RS total score decreased by more than 40%, and 19 participants (25.3% -RS total score and improvement in CGI-I. There was no significant difference in demographic characteristics and clinical characteristics between excellent responders and low responders to methylphenidate.

χ genetic analysis revealed that 54 had a C / C genotype, 19 had a C / T genotype, and 2 had a T / T genotype. C allele frequency was 0.847 and T allele frequency was 0.153. The GRIN2B polymorphism distribution had a goodness-of-fit with the predicted value of the Hardy-Weinberg equilibrium (p> 0.05). The baseline demographic characteristics and clinical characteristics according to the GRIN2B genotype are shown in Table 1 below. In the following Table 1, SD represents the standard deviation, NOS represents the case where the specificity is not specified, and MPH represents methylphenidate.

characteristic C / C (n = 54) T / C + TT (n = 21) t or χ 2 p Age (years), average (SD) 8.96 (2.22) 8.52 (2.30) -0.76 0.448 Sex (male ), N (%) 47 (87.0) 17 (81.0) 0.45 0.474 IQ, average (SD) 108.72 (15.07) 103.34 (13.57) -1.40 0.489 ADHD subtype, N (%) 4.53 0.209 Predominantly inattentive type 15 (27.8) 9 (42.9) Predominantly hyperactive-impulsive type 3 (5.6) 0 (0) Mixed type 31 (57.4) 8 (38.1) NOS 5 (9.3) 4 (19.0) CGI-S score, mean (SD) 4.76 (0.78) 4.33 (0.66) -2.22 0.029 ADHD-RS score, mean (SD)  Total score 26.56 (10.21) 20.48 (12.10) -2.20 0.031  Attention deficit subscore 15.91 (5.50) 12.24 (4.69) -2.70 0.009  Hyperactivity subscore 10.65 (5.99) 8.24 (8.54) -1.38 0.171 Baseline CPT Variation Score Missing error 75.48 (19.17) 67.95 (19.51) -1.49 0.142 False alarm 66.83 (16.81) 65.55 (21.20) -0.24 0.811 Reaction time 59.62 (15.50) 56.75 (13.27) -0.73 0.468 Reaction time standard deviation 55.62 (10.34) 47.95 (8.29) -2.97 0.004 Mean initial MPH dose 15.60 (6.03) 13.00 (4.71) -1.52 0.133 Mean final MPH dose 29.08 (11.17) 25.90 (14.73) -0.99 0.325

As shown in Table 1, there were no significant differences in age, sex, IQ, subtype distribution, or final methylphenidate dose between the C / C and C / T + T / T groups. However, the C / C group had a higher baseline CGI-S score, an ADHD-RS total score, and an ADHD-RS attention score. These scores were included in the following logistic regression analysis. There was also a significant difference in CPT response time standard deviation between the two groups.

Table 2 below shows the results of a logistic regression analysis examining the association between the therapeutic response and the GRIN2B genotype. All results were adjusted for age, sex, IQ, baseline CGI-S score, baseline ADHD-RS total score, and final methylphenidate dose. In Table 2 below, a OR is an abbreviation for the odds ratio and adjusted for age, sex, IQ, baseline CGI-S score, baseline ADHD-RS total score, and final methylphenidate dose. IA is the abbreviation of carelessness score, and HI is abbreviation of hyperactivity - impulsivity score. ADHD-RS data included 53 C / C and 20 T / C + TT subjects.

Reaction criterion C / C (n = 54),
N (%) T / C + TT (n = 21)
, N (%) OR (95% CI) a p ADHD-RS, IA = 40% 35 (66.0) 5 (25.0) 5.27 (1.52 - 18.33) 0.009 ADHD-RS, HI = 40% 32 (60.4) 6 (30.0) 4.31 (1.17-15.81) 0.028 ADHD-RS, total = 40% 33 (62.3) 5 (25.0) 4.35 (1.23-15.42) 0.023 CGI-I ≤ 2 33 (61.1) 4 (19.0) 8.83 (1.72-45.47) 0.009 ADHD-RS, IA = 40% and CGI-I &lt; = 2 19 (35.8) 1 (5.0) 14.18 (1.37-146.21) 0.026 ADHD-RS, HI = 40% and CGI-I &lt; = 2 0 (0.00) 6 (30.0) . 0.977 ADHD-RS, total = 40% and CGI-I &lt; = 2 18 (34.0) 1 (5.0) 9.03 (1.02-79.99) 0.048 CPT Missing Error = 10% 35 (67.3) 9 (45.0) 1.62 (0.47-5.52) 0.442 CPT false alarm error = 10% 39 (75.0) 12 (60.0) 2.75 (0.76-9.98) 0.123 CPT reaction time = 10% 28 (53.8) 9 (45.0) 0.73 (0.195-2.75) 0.644 CPT reaction time standard deviation = 10% 34 (65.4) 5 (25.0) 10.77 (2.28-50.83) 0.003

As shown in Table 2, the ADHD-RS total score (OR 4.35, 95% CI 1.23-15.42, p = 0.023), attention score (OR 5.27, 95% CI 1.52-18.33, p = 0.009) Based on sex scores (OR 4.31, 95% CI 1.17-15.81, p = 0.028), the C / C genotype was associated with better treatment response after 6 months of methylphenidate treatment compared to the C / T + T / T genotype . There was also a significant association between the GRIN2B genotype and the CGI-I score during the post-treatment evaluation period (OR 8.83, 95% CI 1.72-45.47, p = 0.009).

(OR 14.18, 95% CI 1.37-146.21, p = 0.026) and improved scores on CGI-I and ADHD-RS total scores (OR C / C genotype showed a higher response rate than the C / T + T / T genotype. However, there was no significant association between the GRIN2B genotype and response rates using the CGI-I and ADHD-RS hyperactivity score criteria. Of the response rates defined by the improvement in CPT score, GRIN2B showed a significant correlation with the improvement in response time standard deviation (OR 10.77, 95% CI 2.28-50.93, p = 0.003).

Table 3 below shows the results of comparing post-treatment changes in ADHD-RS scores between the GRIN2B genotypes.

Variance C / C (n = 53), N (%) T / C + TT (n = 21), N (%) t Cohen's d p ADHD-RS, mean (SD)  carelessness -7.77 (5.64) -1.25 (7.12) 4.10 0.97 <0.001  Hyperactivity - impulsivity -5.25 (4.92) -0.45 (9.83) 2.77 0.66 0.007  all -13.02 (9.73) -1.70 (15.49) 3.73 0.89 <0.001 CPT, mean (SD)  Missing error -15.12 (20.49) -9.10 (20.66) 1.11 0.27 0.275  False alarm -12.31 (14.49) -11.45 (15.91) 0.22 0.05 0.827  Reaction time -8.02 (15.19) -3.35 (14.77) 1.18 0.28 0.243  Reaction time standard deviation -10.02 (11.04) 1.05 (10.33) 3.88 0.93 <0.001

As shown in Table 3, the ADHD-RS total score (p <0.001), attention score (p <0.001), hyperactivity-impulsivity score (p = 0.007), and the response time standard deviation of CPT (p <0.001).

<110> SEOUL NATIONAL UNIVERSITY HOSPITAL <120> A composition and method for predicting treatment response to          attention-deficit hyperactivity disorder medicine <130> PN111974 <160> 4 <170> Kopatentin 2.0 <210> 1 <211> 51 <212> DNA <213> Homo sapiens <400> 1 acttttttcc cctactcttg gtccayttga tgctctcctt ttatgctcct a 51 <210> 2 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> amplify_F <400> 2 acgttggatg atgacatcat cagtgtctgc 30 <210> 3 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> amplify_R <400> 3 acgttggatg catgactttt ttcccctact c 31 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> extension <400> 4 gcataaaagg agagcatc 18

Claims (13)

In a subject with Attention Deficit Hyperactivity Disorder who is Korean, including a reagent capable of detecting the rs2284411 polymorphic site of a polynucleotide encoding a glutamate receptor (ionotropic, N-methyl D-aspartate 2B: GRIN2B) A composition for predicting responsiveness to dating therapy. 2. The composition of claim 1, wherein the reagent is a primer set or a probe. 3. The composition of claim 2, wherein the primer set comprises an oligonucleotide of SEQ ID NO: 2 and SEQ ID NO: 3. Extracting a nucleic acid from a sample obtained from a subject suffering from Attention Deficit Hyperactivity Disorder;
Detecting a rs2284411 polymorphic site of a polynucleotide encoding a glutamate receptor (GRIN2B) in said sample to determine the genotype of said site;
When the genotype is C / C, determining that the responsiveness of the subject to methylphenidate treatment is greater than that of a subject having an attention deficit hyperactivity disorder wherein the genotype is C / T or T / T A method for predicting responsiveness to methylphenidate treatment in a subject having attention deficit hyperactivity disorder. 5. The method of claim 4, wherein the sample is obtained from blood of the subject. 5. The method of claim 4, wherein said detecting comprises using a primer set or probe specific for said polymorphic site. 7. The method of claim 6, wherein the primer set comprises an oligonucleotide of SEQ ID NO: 2 and SEQ ID NO: 3. 5. The method of claim 4, wherein the detecting is performed by sequencing, microarray analysis, allele-specific PCR analysis, PCR extension analysis, mass spectrometry, or a combination thereof. 5. The method of claim 4,
Performing a PCR using a nucleic acid sample obtained from the subject as a template and using a primer set capable of amplifying a polynucleotide or a complementary polynucleotide including the polymorphic site; And
And determining the sequence of the resulting amplification product. Extracting a nucleic acid from a sample obtained from two or more subjects having an attention deficit hyperactivity disorder;
Detecting the rs2284411 polymorphic site of the polynucleotide encoding the glutamate receptor (GRIN2B) from each of the samples to determine the genotype of the region; And
Selecting a subject having a likelihood of responding to methylphenidate treatment to a subject having an attention deficit hyperactivity disorder comprising the step of selecting said subject as having a likelihood that said genotype will respond to methylphenidate treatment How to. 11. The method of claim 10, wherein the sample is obtained from the blood of the subject. 11. The method of claim 10, wherein said detecting uses a primer set or a probe specific for said polymorphism. 13. The method of claim 12, wherein the primer set comprises an oligonucleotide of SEQ ID NO: 2 and SEQ ID NO: 3.
KR1020160008895A 2016-01-25 2016-01-25 A composition and method for predicting of treatment response to attention-deficit hyperactivity disorder medicine KR101792813B1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
KR1020160008895A KR101792813B1 (en) 2016-01-25 2016-01-25 A composition and method for predicting of treatment response to attention-deficit hyperactivity disorder medicine
PCT/KR2016/004969 WO2017131293A1 (en) 2016-01-25 2016-05-12 Composition and method for predicting treatment response to therapeutic agent for attention deficit hyperactivity disorder

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020160008895A KR101792813B1 (en) 2016-01-25 2016-01-25 A composition and method for predicting of treatment response to attention-deficit hyperactivity disorder medicine

Publications (2)

Publication Number Publication Date
KR20170102586A KR20170102586A (en) 2017-09-12
KR101792813B1 true KR101792813B1 (en) 2017-11-02

Family

ID=59398053

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020160008895A KR101792813B1 (en) 2016-01-25 2016-01-25 A composition and method for predicting of treatment response to attention-deficit hyperactivity disorder medicine

Country Status (2)

Country Link
KR (1) KR101792813B1 (en)
WO (1) WO2017131293A1 (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101157526B1 (en) * 2011-09-20 2012-06-22 서울대학교산학협력단 Snp for diagnosing adhd, microarray and kit comprising the same, and method of diagnosing adhd using thereof

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090253595A1 (en) * 2008-04-03 2009-10-08 Bj Services Company Surfactants for hydrocarbon recovery
ES2686300T3 (en) * 2010-08-24 2018-10-17 The Children's Hospital Of Philadelphia Association of recurrent rare genetic variations with attention deficit hyperactivity disorder (ADHD) and procedures for their use for diagnosis and treatment.
WO2012054681A2 (en) * 2010-10-21 2012-04-26 Mayo Foundation For Medical Education And Research Methods for selecting medications for treating patients having attention-deficit hyperactivity disorder

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101157526B1 (en) * 2011-09-20 2012-06-22 서울대학교산학협력단 Snp for diagnosing adhd, microarray and kit comprising the same, and method of diagnosing adhd using thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Park 등. Behavioral and Brain Functions. Vol. 9, No. 1, 페이지 1-8 (2013.01.07.)*

Also Published As

Publication number Publication date
KR20170102586A (en) 2017-09-12
WO2017131293A1 (en) 2017-08-03

Similar Documents

Publication Publication Date Title
CN102177251B (en) The isocitric dehydrogenase of glioblastoma and the hereditary change of other genes
US20210230693A1 (en) Diagnosis and prediction of autism spectrum disorder
EP3507384B1 (en) Methods and composition for the prediction of the activity of enzastaurin
O'Byrne et al. Association of folate receptor (FOLR1, FOLR2, FOLR3) and reduced folate carrier (SLC19A1) genes with meningomyelocele
EP3167080B1 (en) Genetic addiction risk analysis for rds severity index and kit
US20210212960A1 (en) Identification of seizure susceptibility region in wolf-hirschhorn syndrome and treatment thereof
MXPA06003828A (en) Use of genetic polymorphisms that associate with efficacy of treatment of inflammatory disease.
Cheon et al. Association between homozygosity of a G allele of the alpha-2a-adrenergic receptor gene and methylphenidate response in Korean children and adolescents with attention-deficit/hyperactivity disorder
JP2020089370A (en) Method for predicting onset of extrapyramidal symptoms (eps) induced by antipsychotic-based treatment
US20110091899A1 (en) Combination of risk alleles associated with autism
US20070065821A1 (en) Methods for the prediction of suicidality during treatment
Romero-Gutiérrez et al. Differences in MTHFR and LRRK2 variant’s association with sporadic Parkinson’s disease in Mexican Mestizos correlated to Native American ancestry
AU2005250142B2 (en) Biomarkers for the prediction of responsiveness to clozapine treatment
JP2010508029A (en) How to identify patients at risk of developing adverse events when treated with antidepressants
KR101792813B1 (en) A composition and method for predicting of treatment response to attention-deficit hyperactivity disorder medicine
CA3174572A1 (en) Compositions and methods for assessing the efficacy of inhibitors of neurotransmitter transporters
KR102110883B1 (en) Kmt2c snp marker for diagnosis of mental disorder
KR102650359B1 (en) SNP for drug hypersensitivity and diagnosis method using the same
WO2016123543A1 (en) Method for treating schizophrenia comprising administering lurasidone
KR20230134755A (en) A method of providing information for predicting a group at risk for Alzheimer&#39;s disease dementia or early onset of symptoms, a risk group for amnesia-type mild cognitive impairment and/or a PET-positive risk group for amyloid β deposition based on European population data
Bradley-Smith A population-based study of cognitive decline and peripheral inflammatory gene expression
US20100028868A1 (en) Responsiveness to Therapy for Liver Disorders
WO2011045402A1 (en) Autism-associated functional polymorphisms in slc25a12 gene

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
AMND Amendment
E601 Decision to refuse application
AMND Amendment
X701 Decision to grant (after re-examination)
GRNT Written decision to grant