WO2011045402A1

WO2011045402A1 - Autism-associated functional polymorphisms in slc25a12 gene

Info

Publication number: WO2011045402A1
Application number: PCT/EP2010/065483
Authority: WO
Inventors: Antonio M. Persico; Federica Lombardi
Original assignee: Persico Antonio M; Federica Lombardi
Priority date: 2009-10-15
Filing date: 2010-10-14
Publication date: 2011-04-21

Abstract

The present invention relates to a method of determining the presence of or predisposition to autism, or to an autism spectrum disorder in a subject, the method comprising detecting the presence of single nucleotide polymorphism (SNP) rs3765166 and/or rsl l757 of SLC25A12 gene, in a sample from said subject.

Description

Autism-associated functional polymorphisms in SLC25A12 gene

The present invention relates to a method for detecting the presence or predisposition to autism, by detecting two particular functional polymorphisms in SLC25A12 gene.

Background of the invention:

Autism is a developmental disorder characterized by impairments in social interaction and communication associated with repetitive patterns of interest or behavior (Filipek et al. 1999). Autism marks a severe clinical diagnosis within a spectrum of pervasive developmental disorders including Rett syndrome, Asperger syndrome and other non-specified developmental disorders.

Depending on the clinical criteria and the geographical location estimations of the prevalence of autism vary between 0.05 to 0.6% (Chakrabarti et al. 2001 ; Fombonne 2003). Autism shows a well established gender distortion with about four times as many males than females being affected (Fombonne et al. 2003). Monozygotic and dizygotic twin studies have shown that autism has a significant genetic component with monozygotic twin concordance rates as high as 91% if broad diagnostic criteria are applied. Autism does not follow a simple Mendelian inheritance pattern and this is thought to be due to the involvement of multiple genes (Veenstra-VanderWeele et al. 2004).

The diagnosis of autism is not unified and a number of distinct criteria are applied in different parts of the world. In many European countries diagnostic criteria like DSM-TV for psychiatric diseases are applied. The ADI-R and ADOS tests, mainly applied in the US, have become a kind of gold standard and are more and more implemented in Europe as well.

The ADI-R is a standardized, semi-structured clinical review for caregivers of children and adults (Lord et al. 1994). The interview contains 11 1 items and focuses on behaviors in three content areas: quality of social interaction, (e.g., emotional sharing, offering and seeking comfort, social smiling and responding to other children); communication and language (e.g., stereotyped utterances, pronoun reversal, social usage of language); and repetitive, restricted and stereotyped interests and behavior (e.g., unusual preoccupations, hand and finger mannerisms, unusual sensory interests). The measure also includes other items relevant for treatment planning, such as self-injury and over activity. Responses are, scored by the clinician based on the caregiver's description of the child's behavior. Questions are organized around content area, and definitions of all behavioral items are provided. Within the area of Communication, for example, "Delay or total lack of language not compensated by gesture" is further broken down into specific behavioral items: pointing to express interest, conventional gestures, nodding head, and head shaking. Similarly, within the area of Reciprocal Social Interaction, in lack of socio-emotional reciprocity and modulation to context includes the following behaviors: use of other's body, offers comfort, inappropriate facial expressions, quality of social overtures, and appropriateness of social response.

This interviewer-based instrument requires substantial training in administration and scoring. A highly trained clinician can administer the ADI-R to the parent of a 3- or 4-year old suspected of autism in approximately 90 minutes. The interview may take somewhat longer when administered to parents of older children or adults.

In a study of 51 autistic and 43 non-autistic mentally handicapped preschoolers, using similar procedures to the study described above, weighted kappas for inter-rater reliability (calculated using percent exact agreement) ranged from 0.62 to 0.96. Test-retest reliabilities, using intra- class correlations, were above .90 in all domains and sub-domains. A reliability study of the German form of the ADI-R with 22 individuals ages 5 to 29 (mean age = 13.5 years) demonstrated high levels of inter-rater reliabilities (intra-class correlations) for all three domains: Reciprocal social interaction = 0.75; Communication and language = 0.77; and Repetitive and stereotyped behaviors and interests = 0.80.

The ADI-R is a semi-structured instrument for diagnosing autism in children and adults with mental ages of 18 months and above. The instrument has been shown to be reliable and to successfully differentiate young children with autism from those with mental retardation and language impairments. The revised version of the instrument has been tested primarily with parents of preschoolers presenting for the first time with possible autism. In this population, the algorithms based on DSM-IV and ICD-10 criteria have been shown to have high levels of sensitivity and moderate levels of specificity.

The greatest difficulty is in the over diagnosis of autism in young, severely mentally handicapped children. In one study, nearly 60% of the non-autistic children with no speech at all met criteria for autism in each of the three diagnostic areas. All of these children had mental ages below 18 months. Items concerning communication do not appear to be useful in differentiating autistic preschoolers from other severely language-delayed children. Further research is required to test the ability of the ADI-R to discriminate between children with autism and other pervasive developmental disorders. The utility of the instrument for monitoring treatment effects is unknown.

There is no drug therapy available for autism, although some autistic individuals have been treated with anti-depressants and/or antipsychotics for secondary symptoms. The main treatments proposed are based on intensive educational programs. If applied early enough, some studies show that as many as 50% of autistic children participating in those programs can be referred back to normal schooling and education. In a recent UK study the potential socio-economic benefit of early intensive treatment has been estimated to be as high as 1.8 million £ per patient over the life time of the patient.. The age at which the therapy is proposed is of significant importance. Ideally programs should start at 18 months age. As outlined above the ADI-R cannot be used for diagnosis under the age of 18 months. Indeed, the average age at diagnosis is 5 years in the US and 8 years in France, both for social and for infra-structural reasons, such as the availability of trained experts (in the US, only 10% of suspected autistic children have direct access to specialists able to carry out ADI-R) . A laboratory test would have a huge impact, because the test could be easily applied at any age (e.g. after birth) and could be used for diagnostic and prognostic purposes (for example, pre-screening of individuals for eligibility for an ADI-R, thereby substantially shortening the time from diagnosis to treatment).

Autism is highly influenced by genetic factors. Several genes associated with autism have been identified by academic groups and through in-house research efforts at IntegraGen SA (IntegraGen). International patent application WO2005/055807 discloses that the SLC25A12 gene on chromosome 2q24 and certain alleles thereof are related to susceptibility to autism. This gene is named after "Solute carrier family 25 member 12" and encodes a protein also known as Calcium-binding mitochondrial carrier protein (Aralarl) or calcium-dependent mitochondrial aspartate/glutamate carrier (AGCl). Palmieri et al, 2008 have further searched for polymorphism in the SLC25A12 gene correlated with biochemical parameters. Summary of the invention

The inventors have now identified two single-nucleotide polymorphisms (SNPs), namely rs3765166 and rsl l757, conferring autism risk (or conversely protection) in an independent and additive mode.

Alleles at each of these SNPs are significantly correlated with SLC25A12 mRNA levels in post-mortem temporocortical gray matter. Protective genotypes (C/C at SNP rs3765166; C/C and C/G at rsl l757) are each correlated with higher SLC25A12 mRNA levels. Protective genotypes at both SNPs confer additive increases in mRNA levels.

The invention provides a method of evaluating a subject for relative genetic risk for autism, or autism spectrum disorder in a subject, the method comprising determining the genotype of the subject at polymorphism sites rs3765166 (SEQ ID NO: 1) and/or rsl l757 (SEQ ID NO:2) of SLC25A12 gene, in a sample from said subject.

More particularly, detecting allele T of rs3765166 is indicative of the presence of or predisposition to autism, or to an autism spectrum disorder. Detecting two G alleles at rsl 1757 is indicative of the presence of or predisposition to autism, or to an autism spectrum disorder. Conversely, detecting two alleles C at SNP rs3765166 and/or at least one allele C at SNP rsl 1757 is indicative of a protection from autism, or from an autism spectrum disorder.

Legends to the Figures

Figure 1 is a graph that shows SLC25A12 mRNA levels measured by quantitative PCR in the post-mortem brains of subjects carrying the C/C genotype or the CT/TT genotypes at rs3765166 (intron 5, near exon 6). RNA levels are expressed as mean (+S.D.) ACt, a log measure inversely related to mRNA amounts (e.g., the lower the ACt, the higher the mRNA amount or gene expression level). Figure 2 is a graph that shows SLC25A12 mR A levels measured by quantitative PCR in the post-mortem brains of subjects carrying the GC/CC genotypes or the GG genotype at rsl 1757 (downstream exon 18). RNA levels are expressed as mean (+95% C.I.) ACt, as in Figure 1. Figure 3 is a graph that shows the additive effect of rs3765166 and rsl 1757 on SLC25A12 mRNA levels measured by quantitative PCR in post-mortem brains. The "protective" CC genotype at rs3765166 (intron 5, near exon 6) and GC/CC genotypes at rsl 1757 (downstream exon 18) are additively associated with higher mRNA levels (e.g., lower ACt). Conversely, the "risk" or "non-protective" alleles are additively associated with lower mRNA levels (e.g., higher ACt). P = "protective" genotype; NP= "non protective" genotype.

Detailed description of the invention

The invention thus provides a method of determining the presence of or predisposition to autism, or to an autism spectrum disorder in a subject, the method comprising detecting the presence of single nucleotide polymorphism (SNP) rs3765166 (at position 201 of SEQ ID NO: 1) and/or rsl 1757 (at position 301 of SEQ ID NO:2) of SLC25A12 gene, in a sample from said subject. More particularly, detecting allele T of rs3765166 and/or two G alleles at rsl 1757 is indicative of the presence of or predisposition to autism, or to an autism spectrum disorder. The invention further provides a method of determining whether a subject is protected from developing autism or an autism-spectrum disorder, which method comprises detecting two alleles C at SNP rs3765166 and/or at least one allele C at SNP rsl 1757, indicative of a protection from autism, or from an autism spectrum disorder.

Autism is typically characterized as part of a spectrum of disorders (ASDs) including Asperger syndrome (AS) and other pervasive developmental disorders (PPD). Autism is construed as any condition of impaired social interaction and communication with restricted repetitive and stereotyped patterns of behavior, interests and activities present before the age of 3, to the extent that health may be impaired. AS is distinguished from autistic disorder by the lack of a clinically significant delay in language development in the presence of the impaired social interaction and restricted repetitive behaviors, interests, and activities that characterize the autism-spectrum disorders (ASDs). PPD-NOS (PPD, not otherwise specified) is used to categorize children who do not meet the strict criteria for autism but who come close, either by manifesting atypical autism or by nearly meeting the diagnostic criteria in two or three of the key areas.

The invention provides diagnostic screening methods based on a monitoring of a particular gene in a subject. The subject may be at early, pre-symptomatic stage, or late stage. The subject may be any human male or female, preferably a child or a young adult. The subject can be asymptomatic.

The method is particularly useful when the subject is a sibling of an individual with autism or an autism-spectrum disorder, i.e. an individual already diagnosed with autism or an autism spectrum disorder. The likelihood that a sibling of a child with autism also develops autism is between 3 and 6 percent (Chakrabarti & Fombonne, 2001). This is approximately 20 times greater than the rate at which autism affects individuals who are not related to an affected individual. The method of the invention can be performed at any age after birth and used to pre-screen individuals requiring further assessment with the ADI-R, shortening the time from diagnosis to intervention. Since the method provides diagnostic risk estimates, it does not lend itself to be used in prenatal diagnosis.

The diagnosis methods can be performed in vitro, ex vivo or in vivo, preferably in vitro or ex vivo. They use a sample from the subject. The sample may be any biological sample derived from a subject, which contains nucleic acids. Examples of such samples include fluids, tissues, cell samples, organs, biopsies, etc. Most preferred samples are blood, plasma, saliva, urine, seminal fluid, etc. The sample may be collected according to conventional techniques and used directly for diagnosis or stored. The sample may be treated prior to performing the method, in order to render or improve availability of nucleic acids or polypeptides for testing. Treatments include, for instant, lysis (e.g., mechanical, physical, chemical, etc.), centrifugation, etc. Also, the nucleic acids may be pre -purified or enriched by conventional techniques, and/or reduced in complexity. Nucleic acids may also be treated with enzymes or other chemical or physical treatments to produce fragments thereof. Considering the high sensitivity of the claimed methods, very few amounts of sample are sufficient to perform the assay.

The sample is preferably contacted with reagents such as probes, or primers in order to assess the presence of a SNP. Contacting may be performed in any suitable device, such as a plate, tube, well, glass, etc. In specific embodiments, the contacting is performed on a substrate coated with the reagent, such as a nucleic acid array. The substrate may be a solid or semisolid substrate such as any support comprising glass, plastic, nylon, paper, metal, polymers and the like. The substrate may be of various forms and sizes, such as a slide, a membrane, a bead, a column, a gel, etc. The contacting may be made under any condition suitable for a complex to be formed between the reagent and the nucleic acids of the sample.

The finding of a specific allele of SLC25A12 DNA in the sample is indicative of the presence of a genetic variant in the subject, which can be correlated to the presence, predisposition or stage of progression of autism, or an autism spectrum disorder. For example, an individual having a germ line mutation has an increased risk of developing autism, an autism spectrum disorder, or an autism-associated disorder. The determination of the presence of an altered gene locus in a subject also allows the design of appropriate therapeutic intervention, which is more effective and customized. Also, this determination at the pre-symptomatic level allows a preventive rehabilitation program to be applied.

Said SNPs may be detected by sequencing, selective hybridisation and/or selective amplification.

Sequencing can be carried out using techniques well known in the art, using automatic sequencers. The sequencing may be performed on the complete genes or, more preferably, on specific domains thereof, typically those known or suspected to carry deleterious mutations or other alterations.

Amplification is based on the formation of specific hybrids between complementary nucleic acid sequences that serve to initiate nucleic acid reproduction.

Amplification may be performed according to various techniques known in the art, such as by polymerase chain reaction (PCR), ligase chain reaction (LCR), strand displacement amplification (SDA) and nucleic acid sequence based amplification ( ASBA). These techniques can be performed using commercially available reagents and protocols. Preferred techniques use allele-specific PCR or PCR-SSCP. Amplification usually requires the use of specific nucleic acid primers, to initiate the reaction.

Nucleic acid primers useful for amplifying sequences from the gene or locus are able to specifically hybridize with a portion of the gene locus that flank a target region of said locus, said target region being altered in certain subjects having autism, an autism spectrum disorder, or an autism-associated disorder

Hybridization detection methods are based on the formation of specific hybrids between complementary nucleic acid sequences that serve to detect nucleic acid sequence alteration(s). A particular detection technique involves the use of a nucleic acid probe specific for wild type or altered gene, followed by the detection of the presence of a hybrid. The probe may be in suspension or immobilized on a substrate or support (as in nucleic acid array or chips technologies). The probe is typically labelled to facilitate detection of hybrids.

In a most preferred embodiment, the presence of said SNP(s) is determined by DNA chip analysis. Such DNA chip or nucleic acid microarray consists of different nucleic acid probes that are chemically attached to a substrate, which can be a microchip, a glass slide or a microsphere-sized bead. A microchip may be constituted of polymers, plastics, resins, polysaccharides, silica or silica-based materials, carbon, metals, inorganic glasses, or nitrocellulose. Probes comprise nucleic acids such as cDNAs or oligonucleotides that may be about 10 to about 60 base pairs. To determine the alteration of the genes, a sample from a test subject is labelled and contacted with the microarray in hybridization conditions, leading to the formation of complexes between target nucleic acids that are complementary to probe sequences attached to the microarray surface. The presence of labelled hybridized complexes is then detected. Many variants of the microarray hybridization technology are available to the man skilled in the art (see e.g. the review by Kidgell&Winzeler, 2005 or the review by Hoheisel, 2006). The examples illustrate the present invention without limiting its scope. EXAMPLE : Identification of two autism-associated functional SNPs Materials and methods 1) Subjects

Peripheral blood DNA was extracted from leukocytes belonging to 15 unaffected siblings of autistic patients, all previously genotyped (see Palmieri et al, 2008). These DNA samples were aliquoted (40 ng/μΐ) and used for SLC25A12 DNA sequencing assays. Subjects were selected on the basis of their haplotype at three SNPs located in haplotype block 1 (rs 17499593, rsl7581284, rs7586207), and three other SNPs located in haplotype block 2 (rs2271758, rs3770445, rs6724337), with haplotype blocks defined according to the Hapmap Project (www.hapmap.org), as previously described (Palmieri et al., 2008). Eight individuals carry the "protective" haplotype, three the "risk" haplotype and four are heterozygotes. Following the identification of two putative functional SNPs (see below), genomic DNA was extracted from post-mortem temporocortical gray matter of 12 autistic individuals and 10 controls for SNP genotyping, while RNA was extracted from the same tissue specimens of 8 autistic subjects and 9 controls, and cDNA was used for transcript quantification.

2) DNA sequencing of SLC25A12 exons and exon/intron boundaries

All the 18 exons and exon-intron junctions of the human SLC25A12 gene were screened for polymorphisms/mutations by DNA sequencing in 15 unaffected siblings of autistic patients. Primers used to amplify exon 6 and part of exon 18, which contain SNPs rs3765166 and rsl 1757, respectively, are:

a) exon 6 (rs3765166):

5'-CCTTCCTTCCTTTCCAAACC-3'-F (SEQ ID NO: 3) and 5'- CTGGAGGCAATCCAGGAC-3 '-R (SEQ ID NO:4)

b) exon 18 (rs 1 1757):

5 '-TCCT AGTTTGTTTTCCATTCTGG-3 '-F (SEQ ID NO: 5) and 5'- GCGAACCCGATCATGAGTTA-3 '-R (SEQ ID NO: 6) Polymerase chain reaction (PCR) was performed in a 25 μΐ volume, containing 60 ng of genomic DNA, 100 μΜ dNTPs, 0.4 μΜ of each primer, 0.5 U of Taq polymerase and a buffer containing MgC12 at a final concentration of 1.5 mM, 10 mM Tris-Hcl (pH 8,3) and 50 mM KC1 (Takara). A 297 bp exon 6 amplicon was obtained as follows: initial denaturation at 95°C (5 min), followed by 35 cycles at 95°C (30 s), 59°C (30s), 72°C (30s) and by a final extension at 72°C (7 min). The same PCR condition was performed to obtain a 494 bp exon 18 fragment, except for the extension time that was increase to 1 minute. All PCR products were purified by QIAquick PCR purification kit (Qiagen), and DNA sequencing was performed using the CEQ8000 DNA sequencer (Beckman-Coulter, Fullerton, CA, USA).

3) Genotyping

Post-mortem temporocortical gray matter genomic DNA of 12 autistic subjects and 10 controls was genotyped by allele-specific restriction digest. PCR was performed as described above. Exon 6 PCR products were digested overnight. Following an overnight digestion with 5U of AlwNI (New England Biolabs) at 37°C and an inactivation step at 65°C for 20 min, the exon 6 PCR product was run in 1% agarose, obtaining two bands (225 bp and 73 bp) for the "C" allele and a single 297 bp band for the T allele. Exon 18 PCR fragments were digested using 5U of Tsp45I at 65°C for 4 hours. PCR product was run in 1% agarose, revealing the "G" allele as a single 494 bp band, and the "C" allele as two bands, sized 262 bp and 232 bp.

4) Splicing analysis:

SNP rs3765166 is located 3 bp upstream of the beginning of exon 6, within to the intron 5 splice site (see Results). It could thus influence exon/intron splicing through exon 6 skipping or intron 5 retention in the RNA transcript. To assess this hypothesis the inventors designed three different primers were designed: exon 4-5 '-ATGTGCTCCAGATTCCATGT-3 '-F (SEQ ID NO: 7) exon7-5 '-CTTGTGCCAGCTAGAGTG-3 '-R (SEQ ID NO:8); intron5-5 '- AAAGCGAAGG ACAC AGAAG-3 ' -R (SEQ ID NO:9). PCR reactions were performed using 100 ng di cDNA, 100 μΜ dNTPs, 0.4 μΜ of each primer (primer pairs: exon 4-for/exon 7 rev; exon 4-for/intron5-rev), 0.5U taq polymerase and PCR buffer containing MgC12 (1.5 mM final concentration), 10 mM Tris-Hcl (pH 8,3), 50 mM Kcl (Takara). PCR reactions were carried out at 95°C (5 min), followed by 35 cycles at 95°C (30 s), 58°C (30s), 72°C (lm) and by a final extension at 72°C (7 min).

5) Expression analysis by real-time PCR

Total RNA was extracted from eight autistic subjects and nine controls using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to standard methods and RNA quality was checked using a Bioanalyzer (Agilent, Santa Clara, CA, USA). Reverse transcription was performed using the QuantiTect reverse Transcription Kit (Qiagen, Hilden, Germany), employing random hexamers as primers. All amplification reactions were performed in triplicate using 96-well PCR plates (Biorad) on a iQ5 Multicolor Real-Time PCR Apparatus according to a standard (2-ΔΔΟ: SYBR Green protocol (Biorad, Hercules, CA, USA). Beta- actin was used as normalizer. The following primers were designed: SLC25al2-5 '- ACTGCATTTTGGGCATAACC-3 '-F (SEQ ID NO: 10) and SLC25A12- 5 'TTCCTCCAGCTGCTGAAACT -3 ' -R (SEQ ID NO: 1 1); Beta-actin 5'- AGCCTCGCCTTTGCCGA-3'-F (SEQ ID NO: 12) and 5 '-GCGCGGCGATATCATCA-3 '-R (SEQ ID NO: 13). PCR was performed in a 20 μΐ volume, containing 10 ng of cDNA, 0.3 μΜ of each primer and (IX) SYBR Premix Ex Taqll (Perfect Real Time, Takara). PCR conditions: 95°C (3min), followed by 40 cycles at 95°C (10s), 59°C (30s); melting curve analysis were performed at 60°C (10s) repeated for 71 times. Temperature change is equal to 0.5 (end temperature at 95°C).

Results

1) Identification of two functional SNPs in tight linkage disequilibrium with the SLC25A12 haplotype conferring autism protection/risk:

Based on prior results, 15 unaffected siblings were selected according to their SLC25A12 haplotype defined at SNPs rsl7499593, rsl7581284, rs7586207, rs2271758, rs3770445, and rs6724337. This sample includes eight individuals carrying the "protective" haplotype (i.e., preferentially transmitted from heterozygous parents to unaffected brothers and sisters of autistic children), three carrying the opposite, "risk", haplotype, and four heterozygotes subjects. DNA sequencing of all the 18 exons and exon-intron junctions of the human SLC25A12 gene detected two potentially functional SNPs, rs3765166 and rsl l757 located in exon 6 and exon 18, respectively, both in tight linkage disequilibrium with the six SNPs used to mark the protective/risk haplotypes. In particular, rs3765166 (C/T) is positioned in intron 5, only 3 bp upstream of the beginning of exon 6, immediately adjacent to the intron 5/exon6 splice site. This SNP could thus influence the splicing process, as suggested by software -based predictions (Genscan software at http://genes. mit.edu/GENSCAN.html). Instead, rsl l757 is located in exon 18, 739 bp downstream of the translation stop codon. According to 3'UTR in silico analyses, this SNP generates or conversely eliminates a possible binding site for the mRNA binding factor CUGBP1-A. This SNP could thus conceivably influence mRNA stability.

2) SNPs rs3765166 and rsl 17577, but not affection status, significantly influence SLC25A12 mRNA levels

Affection status does not significantly influence SLC25A12 mRNA levels in post-mortem neocortical tissues of 12 autistic patients and 10 controls (P = 0.612, n.s.), confirming previous results (Palmieri et al., 2008). Instead, regardless of affection status (i.e., both in autistic patients and in controls), rs3765166 (intr. 5) and rsl 1757 (3'UTR) significantly influence SLC25A12 mRNA levels (P=0.008 and 0.015). In particular, the "protective" C/C genotype at rs3765166 is associated with higher mRNA levels compared to the C/T and T/T genotypes. Therefore, the C allele at rs3765166 protects from autism, behaves recessively and is associated with higher SLC25A12 mRNA levels, while the T allele acts in dominant mode in decreasing mRNA levels (See Figure 1). Using mRNA extracted from these post-mortem tissues, the inventors have not detected a correlation between genotype at rs3765166 and PCR amplification intensity of intron 5 amplicon which would have suggested an obvious abnormality in RNA splicing.

The same analysis performed for SNP rsl 1757 (3'UTR) unveiled a significant association between the protective C/C and C/G genotypes with higher mRNA levels, implying that the protective C allele at rsl 1757 is dominant, while the G allele ("risk allele") is recessive in decreasing mRNA levels (see Figure 2). These results show that rs3765166 (intron 5) and rs 117577 (3'UTR) independently influence SLC25A12 mRNA levels in post-mortem brains. These different (recessive and dominant) effects on gene expression further support different, independent and additive functional roles for these two SNPs.

REFERENCES

Benayed R, Gharani N, Rossman I, et al. Support for the Homeobox Transcription Factor Gene ENGRAILED 2 as an Autism Spectrum Disorder Susceptibility Locus. Am J Hum Genet 2005; 77:851-68.

Bolton PF, Pickles A, Murphy M, Rutter M. Autism, affective and other psychiatric disorders: patterns of familial aggregation. Psychol Med 1998; 28:385-95.

Chakrabarti S, Fombonne E (2001) Pervasive developmental disorders in preschool children.

Jama 285:3093-3099

Dahmen G, Ziegler A. Generalized Estimating Equations in Controlled Clinical Trials:

Hypotheses Testing. Biometrical Journal 2004; 46:214-232.

Dawson G, Estes A, Munson J, Schellenberg G, Bernier R, Abbott R. Quantitative assessment of autism symptom-related traits in probands and parents: Broader Phenotype Autism Symptom Scale. J Autism Dev Disord 2007; 37:523-36.

Fenske E, Zalenski S, Krants P, McClannahand L. Age at intervention and treatment outcome for autistic children in a comprehensive intervention program. Special issue: Early intervention. Analysis and Intervention in Developmental Disabilities 1985; 5:49-58.

Filipek PA, Accardo PJ, Baranek GT, Cook EH, Jr., Dawson G, Gordon B, Gravel JS, Johnson CP, Kallen RJ, Levy SE, Minshew NJ, Ozonoff S, Prizant BM, Rapin I, Rogers SJ, Stone WL, Teplin S, Tuchman RF, Volkmar FR (1999) The screening and diagnosis of autistic spectrum disorders. J Autism Dev Disord 29:439-484

Flanders WD, Sun F, Yang Q (2001) New estimator of the genotype risk ratio for use in case- parental control studies. Am J Epidemiol 154:259-263 Fombonne E (2003) Epidemiological surveys of autism and other pervasive developmental disorders: an update. J Autism Dev Disord 33:365-382 Fombonne E, Cook EH (2003) MMR and autistic enterocolitis: consistent epidemiological failure to find an association. Mol Psychiatry 8:133-134

Hoheisel, Nature Reviews, Genetics, 2006, 7:200-210 Humphries SE, Cooper JA, Talmud PJ, Miller GJ. Candidate gene genotypes, along with conventional risk factor assessment, improve estimation of coronary heart disease risk in healthy UK men. Clin Chem 2007; 53:8-16.

Johnson CP, Myers SM. Identification and evaluation of children with autism spectrum disorders. Pediatrics 2007; 120: 1183-215.

Kidgell&Winzeler, Chromosome Research, 2005: 13:225-235

Lord C, Rutter M, Le Couteur A (1994) Autism Diagnostic Interview-Revised: a revised version of a diagnostic interview for caregivers of individuals with possible pervasive developmental disorders. J Autism Dev Disord 24:659-685

Lord C, Risi S, Lambrecht L, et al. The autism diagnostic observation schedule-generic: a standard measure of social and communication deficits associated with the spectrum of autism. J Autism Dev Disord 2000; 30:205-23.

Myers SM, Johnson CP. Management of children with autism spectrum disorders. Pediatrics 2007; 120: 1162-82. Palmieri L, et al, Altered calcium homeostasis in autism-spectrum disorders: evidence from biochemical and genetic studies of the mitochondrial aspartate/glutamate carrier AGC1. Molecular Psychiatry, 2008, 1-15.

Philippi A, Tores F, Carayol J, et al. Association of autism with polymorphisms in the paired- like homeodomain transcription factor 1 (ΡΓΓΧ1) on chromosome 5q31 : a candidate gene analysis. BMC Med Genet 2007; 8:74.

Ramoz N, Reichert JG, Smith CJ, et al. Linkage and association of the mitochondrial aspartate/glutamate carrier SLC25A12 gene with autism. Am J Psychiatry 2004; 161 :662-9.

Rogers S J. Empirically supported comprehensive treatments for young children with autism. J Clin Child Psychol 1998; 27: 168-79.

Schellenberg GD, Dawson G, Sung YJ, et al. Evidence for multiple loci from a genome scan of autism kindreds. Mol Psychiatry 2006; 1 1 :1049-60.

Veenstra-VanderWeele J, Cook EH, Jr. (2004) Molecular genetics of autism spectrum disorder. Mol Psychiatry 9:819-832

Weedon MN, McCarthy MI, Hitman G, et al. Combining information from common type 2 diabetes risk polymorphisms improves disease prediction. PLoS Med 2006; 3:e374. Ziegler A, Konig I. A statistical approach to genetic epidemiology: concepts and applications.

Weinheim: Wiley- VCH, 2006.

Claims

1. A method of evaluating a subject for relative genetic risk for autism, or autism spectrum disorder in a subject, the method comprising determining the genotype of the subject at polymorphism sites rs3765166 (at position 201 of SEQ ID NO: 1) and/or rsl l757 (at position 301 of SEQ ID NO:2) of SLC25A12 gene, in a sample from said subject.

2. The method of claim 1, wherein detecting allele T of rs3765166 is indicative of the presence of or predisposition to autism, or to an autism spectrum disorder.

3. The method of claim 1, wherein detecting two G alleles at rsl 1757 is indicative of the presence of or predisposition to autism, or to an autism spectrum disorder.

4. The method of claim 1, wherein detecting two alleles C at SNP rs3765166 and/or at least one allele C at SNP rsl 1757 is indicative of a protection from autism, or from an autism spectrum disorder.

5. The method of any of claims 1 to 4, wherein the subject is a sibling of an individual with autism or an autism-spectrum disorder.

6. The method of any one of claims 1 to 5, wherein said SNPs are detected by sequencing, selective hybridisation and/or selective amplification.