KR101790770B1 - Primer Sets for Discrimination of Shiitake Mushroom Cultivar and Use Thereof - Google Patents

Abstract

The present invention relates to a method for producing a shiitake mushroom which has been developed by the National Forestry Research Institute, 2, No. 3, No. 2 and No. 2, and a primer set for discriminating mushroom cultivars capable of discriminating true tastes, and a method for discriminating mushroom cultivars using the primer set. By using the present invention, it is possible to quickly and accurately distinguish 15 varieties of shiitake mushroom, to protect the developed shiitake mushroom variety, to prevent distinction between strains and illegal distribution of the variety.

Description

{PRIMER SET FOR DISTILLATION OF SHIITAKE MUSHROOMS}

The present invention relates to a primer set for discriminating shiitake mushroom cultivars and uses thereof.

Shiitake mushrooms account for approximately 91% of domestic mushroom production in 2014, accounting for about 188.8 billion won. Its unique taste and fragrance has proven its medical value as an antiseptic and antiviral effect as well as being used as a cooking material for eastern and western countries . Domestic shiitake mushroom production and production have steadily increased, and in 2011, the production amounted to about 2,220 billion won, with 37,000 tons of production.

There are 49 shiitake mushroom varieties registered in domestic seed source, and 16 varieties applied by the National Forestry Academy account for about 33%. Therefore, it is very important to classify the varieties developed by the National Forestry Academy into the SSR markers, which is one of the most popular varieties of shiitake mushrooms in Korea.

Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

Korean Patent Publication No. 10-2016-0098969

Won-Mok Park et al., The Korean Journal of Mycology Vol. 25, No. 3, p. 1997

The inventors of the present invention have found that the present inventors have found that the shiitake mushroom cultivar No. 7, the forest No. 9, the forest No. 10, the summer incense, the autumn incense, the white incense incense, the Dasan incense, 2, ceiling 3, ridge 2, and true tastes. As a result, a primer set capable of distinguishing 15 varieties of shiitake mushroom was prepared, and PCR was performed using the primer set. Thus, 15 kinds of shiitake mushroom cultivars from the samples (preferably mushroom sawdust medium, mushroom seedlings, mushroom) The present invention has been completed.

Accordingly, it is an object of the present invention to provide a primer set for distinguishing mushroom cultivars.

It is another object of the present invention to provide a kit for discriminating mushroom cultivars.

It is another object of the present invention to provide a method for discriminating mushroom cultivars.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention and claims.

According to one aspect of the present invention, the present invention provides a primer set comprising a first set of primers of Sequence Listing first and second sequences, a second set of primers of Sequence Listing 3 and Sequence 4, , A fourth primer set of SEQ ID No. 7 and a fourth primer set of the eighth sequence, and a fifth primer set of the ninth and tenth sequences.

The inventors of the present invention have found that the present inventors have found that the shiitake mushroom cultivar No. 7, the forest No. 9, the forest No. 10, the summer incense, the autumn incense, the white incense incense, the Dasan incense, 2, No. 3, No. 2, No. 2 and No. 2, and true tastes. As a result, a primer set capable of distinguishing 15 varieties of the above mushroom was prepared, and PCR was performed using the same (Preferably, mushroom sawdust medium, mushroom seedlings, mushrooms) to identify the mushroom cultivars of the above 15 species.

As can be seen in the following examples, when the primer set of the present invention was used, the samples of the mushroom variety No. 7, the forest No. 9, the forest No. 10, the summer incense, the autumn incense, the white incense incense, It is easy and quick to distinguish the goodness and abundance, the ceiling 1, the ceiling 2, the ceiling 3, the ridge 2 and the true taste.

According to another aspect of the present invention, the present invention provides a primer set comprising a first primer set of Sequence Listing first and second sequences, a second primer set of Sequence Listing third and fourth sequence, a fifth sequence and a sixth sequence of Sequence Listing , A primer set of SEQ ID No. 7, a fourth primer set of SEQ ID No. 7 and a fifth primer set of SEQ ID No. 9 and 10, and a primer set for discriminating mushroom cultivars A discrimination kit is provided.

The kit of the present invention may further include a PCR reaction buffer solution of a DNA polymerase and a composition described above in order to facilitate the PCR reaction in addition to the first primer set to the fifth primer set, The components necessary for performing the electrophoresis can be further included in the kit of the present invention.

According to another aspect of the present invention, the present invention provides a method of identifying a mushroom cultivar comprising the steps of:

(a) extracting DNA from a sample;

(b) the extracted DNA as a template, a first primer set of Sequence Listing 1 and Sequence Listing 2, a second primer set of Sequence Listing 3 and Sequence Listing 4, a second primer set of Sequence Listing 5 and Sequence Listing 3 primer sets, a fourth primer set of SEQ ID Nos. 7 and 8, and a fifth primer set of Ninth and 10th sequences to perform PCR using a primer set discriminating mushroom cultivar ; And

(c) Analyzing the size of the PCR product to determine the variety of shiitake mushroom.

The extraction of DNA in step (a) can be carried out by a conventional phenol / chloroform extraction method, SDS extraction method (Tai et al., Plant Mol. Biol. Reporter, 8: 297-303, 1990), CTAB separation method Trimethyl Ammonium Bromide; Murray et al., Nuc. Res., 4321-4325, 1980) or commercially available DNA extraction kits.

Samples to extract DNA for shiitake cultivar discrimination can be shiitake medium, shiitake mushroom, and shiitake mushroom.

In addition, in the step (b), the PCR may be performed using a PCR reaction mixture containing various components known in the art necessary for the PCR reaction. In the PCR reaction mixture, an appropriate amount of DNA polymerase, dNTP, PCR buffer solution and water (dH ₂ O) are contained in addition to the DNA extracted from the mushroom to be analyzed and the primer pair provided in the present invention. The PCR buffer comprises Tris -HCl (Tris-HCl), MgCl 2, KCl and the like. At this time, the MgCl ₂ concentration greatly affects the specificity and yield of the amplification, preferably 1.5-2.5 mM. In general, if the Mg ²⁺ and the excess will increase the non-specific PCR amplification products, and reduce the yield of a PCR product if the Mg ^{2 +} insufficient. The PCR buffer solution may further contain an appropriate amount of Triton X-100 (Triton X-100).

The PCR conditions using the above primer set are 90 to 97 占 폚 for 2 to 7 minutes, followed by 20 to 1 minute at 90 to 97 占 폚, 20 to 1 minute at 56 to 60 占 폚, Amplified at 30 to 40 cycles in 1 minute, and further reacted at 72 ° C for 20 minutes. However, the reaction can be carried out according to a conventional method which is understood by a person skilled in the art and is not particularly limited.

In the step (c), the DNA of the PCR product can be isolated by size according to a method well known in the art. Preferably by agarose gel or polyacrylamide gel electrophoresis or an ABI prism 3100 genetic analyzer-electropherogram. At this time, in order to use the fluorescence analyzer, PCR is performed in the step (b) using a primer set with a fluorescent dye known in the art.

A first primer set of Sequence Listing first sequence and second sequence of the present invention, a second primer set of Sequence Listing third sequence and fourth sequence, a third primer set of Sequence Listing 5 sequence and Sequence Listing, The fourth primer set of the seventh sequence and the eighth sequence, and the fifth primer set of the ninth sequence and the tenth sequence to produce the mushroom variety No. 7, the forest No. 9, the forest No. 10, the summer season and the autumn season When PCR amplification was carried out on the fractions of Baekhwa incense, Dasan incense, Suhyanggo, Cheonbaekgo, Bungyeongo, Ceiling 1, Ceiling 2, Ceiling 3, Ridge 2 and true taste, 2.

The size of PCR product amplified from each primer set is analyzed to determine the variety of shiitake mushroom.

The features and advantages of the present invention are summarized as follows:

(I) The present invention relates to a method for producing a mushroom, which is a mushroom cultivar developed by the National Forestry Academy, No. 7, Forest No. 9, Forest No. 10, Summer, Autumn, White Chrysanthemum, Dasan, The present invention provides a primer set for discriminating mushroom cultivars capable of discriminating between a mushroom, a hoof, a ceiling 2, a ceiling 3, a ridge 2, and a true taste, and a method for discriminating mushroom cultivars using the primer set.

(Ii) The present invention can be used to quickly and accurately distinguish 15 varieties of the mushroom, and to protect the developed mushroom cultivar and to prevent the distinction between the strains and illegal distribution of the varieties.

Fig. 1 shows the PCR method using the primer sequence. As a result, the PCR method using the primer sequence was carried out in the same manner as in Example 1, except that the mushroom cultivar No. 7, the forest No. 9, the forest No. 10, the summer incense, the autumn incense, Ceiling No. 2, Ceiling No. 3, Ridge No. 2, and the base sequence that can determine the true taste.
Figure 2 shows fragment analysis results of 15 varieties of shiitake mushroom against the primer set.
(c) RL-LE-006 ceiling 1 (168bp), (d) RL-LE-006, RL-LE-006, RL-LE-006, RL-LE-006, and RL-LE- RL-LE-009 Forest # 9 (RL-LE-008), (ii) RL-LE- RL-LE-009 (15 / 15bp), (k) RL-LE-009 Forest 10 (159bp) 193bp), (n) RL-LE-011 (194bp), and (o) RL-LE-014 Forest No. 7 (185bp).

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

Example

Example 1: Preparation of primers for discriminating shiitake mushroom cultivars

This study was carried out to investigate the effects of mushroom cultivars on the growth of mushroom cultivated forests in Korea. In order to discriminate the ceiling 3, the ridge 2, and the true taste, a base sequence distinguishing the above 15 varieties was searched and a primer was prepared using this (Fig. 1).

Primer sequences for breed identification primer The sequence (5'-3 ') RL-LE-006F CTCTGGATAAGAACGCAAGC RL-LE-006R CAGTGTTCTCCAGTCCGAGTC RL-LE-008F AAGCTCTCATATGTTGGGGG RL-LE-008R AACGACGAGTGGGTTAGGTAG RL-LE-009F GTCAGTGAGGAGTTGGATGTTC RL-LE-009R AGTGCTCTGGTCAAACCAA RL-LE-011F GTGCTACACCAGGGATAAGACT RL-LE-011R GTCGTCTTCGATTTCTAGCG RL-LE-014F ACTGGCTCTCAGACTGTGTTCT RL-LE-014R CAACACCTGTACTTGAGCTGC

Example 2: Identification of mushroom cultivars using the prepared primers

The mushroom cultivars cultivated in the PDB medium were found to be the most suitable for the cultivation of mushroom cultivar No. 9, Forest 10, summer season, autumn season, Baekhwa incense, Dasan incense, Suhyanggo, 2, and mycelium of the true flavor were filtered through the microracs and washed with PBS buffer (NaCl 135 mM, KCl 2.7 mM, Na ₂ HPO ₄ 4.3 mM, KH ₂ PO ₄ 1.4 mM) and the water was removed with a kitchen towel. The dried hyphae were frozen in liquid nitrogen and finely ground in a mortar, and the genomic DNA was extracted using the GeneAll® GenEx ™ Plant kit. 500 μl of PL buffer was added to the mycelium transferred to the tube, heated at 65 ° C for 10 minutes, and mixed well using a pipette. After centrifugation at 13,000 rpm for 1 minute, the supernatant was removed and transferred to a new tube. The PP buffer was added to the supernatant by 1/3 of the supernatant and mixed well using a Vortex. After standing on ice for 5 minutes, centrifugation was carried out at 13,000 rpm for 5 minutes. The supernatant was removed and transferred to a new tube. The same volume of PCI (phenol: Chloroform: isoamylalcohol = 25: 24: 1) was added and the mixture was inverted. After centrifugation at 13,000 rpm for 10 minutes, the supernatant was separated, transferred to a new tube, and mixed with the same amount of isopropanol. They were left on ice for 10 minutes and then centrifuged at 13,000 rpm for 1 minute. After removal of the supernatant, 1 ml of 70% ethanol was added to shake the DNA pellet and centrifuged at 13,000 rpm for 1 minute. The supernatant was removed and centrifuged once more at 13,000 rpm for 1 minute. The remaining ethanol was removed, and the DNA pellet was dried at room temperature for 5 minutes. Then, 100 μl of RE buffer was added to dissolve the DNA pellet. PCR was carried out using 20 ng of the extracted genomic DNA as a template using the primer prepared in the present invention. The PCR was carried out by amplifying 35 cycles at 95 ° C for 3 minutes, again at 95 ° C for 30 seconds, at 58 ° C for 30 seconds, at 72 ° C for 30 seconds, and further at 72 ° C for 20 minutes.

It was confirmed that the 15 varieties were distinguished by the primers (Fig. 2). Table 2 shows the sizes of the PCR products amplified by the primer sets according to the respective cultivars. The representative varieties of the respective primers were shown (Fig. 2).

Size of PCR product kind RL-LE-006
Primer set RL-LE-008
Primer set RL-LE-009
Primer set RL-LE-011
Primer set RL-LE-014
Primer set Forest 7 168/173 153 - 193 185 Forest No. 9 170/185 135/153 142/159 192 179/216 Forest 10 171 154 159 194 185 Summer incense 169/185 136/156 160 171/193 173 Autumn 168/183 136/155 160 191 177/183 Incense 170/184 154 160 194 178/187 Versatile incense 170 155 160/171 192 187 Suego 171/177 154 160/172 192 175/187 A thousand bucks 169/183 154 159 191 186 Abundance 171/174 154 159 193 186 Ceiling 1 168 154 161/173 193 186 Ceiling 2 170 151 160 194 178/186 Ceiling 3 170/173 154 161/173 194 185 Ridge 2 168 134/152 162/174 194 176/185 A real taste 183 137/156 160 193 185

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the present invention. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

<110> Chungbuk National University Industry-Academic Cooperation Foundation <120> Primer Sets for Discrimination of Shiitake Mushroom Cultivar and          Use Thereof <130> PN160321 <160> 10 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> RL-LE-006F <400> 1 ctctggataa gaacgcaagc 20 <210> 2 <211> 21 <212> DNA <213> RL-LE-006R <400> 2 cagtgttctc cagtccgagt c 21 <210> 3 <211> 20 <212> DNA <213> RL-LE-008F <400> 3 aagctctcat atgttggggg 20 <210> 4 <211> 21 <212> DNA <213> RL-LE-008R <400> 4 aacgacgagt gggttaggta g 21 <210> 5 <211> 22 <212> DNA <213> RL-LE-009F <400> 5 gtcagtgagg agttggatgt tc 22 <210> 6 <211> 19 <212> DNA <213> RL-LE-009R <400> 6 agtgctctgg tcaaaccaa 19 <210> 7 <211> 22 <212> DNA <213> RL-LE-011F <400> 7 gtgctacacc agggataaga ct 22 <210> 8 <211> 20 <212> DNA <213> RL-LE-011R <400> 8 gtcgtcttcg atttctagcg 20 <210> 9 <211> 22 <212> DNA <213> RL-LE-014F <400> 9 actggctctc agactgtgtt ct 22 <210> 10 <211> 21 <212> DNA <213> RL-LE-014R <400> 10 caacacctgt acttgagctg c 21

Claims (4)

A first primer set of the first sequence and second sequence, a second primer set of the third sequence and the fourth sequence, a third primer set of the fifth sequence and the sixth sequence, a seventh sequence of the seventh sequence And a fourth primer set of the eighth sequence and a fifth primer set of the ninth sequence and the tenth sequence, wherein the mushroom cultivar is selected from the group consisting of Forest 7, Forest 9, Forest 10 , At least one mushroom selected from the group consisting of summer aroma, autumn aroma, white scent, Dasan scent, suyogeo, bloom, bloom, ceiling 1, ceiling 2, ceiling 3, Characterized in that the primer set is a cultivar.
delete A first primer set of the first sequence and second sequence, a second primer set of the third sequence and the fourth sequence, a third primer set of the fifth sequence and the sixth sequence, a seventh sequence of the seventh sequence And a primer set consisting of a fourth primer set of the eighth sequence and a fifth primer set of the ninth sequence and the tenth sequence, wherein the mushroom cultivar is selected from the group consisting of Forest 7, Forest 9 1, 2, 3, 2, and 2, which are selected from the group consisting of forests 10, summer 10, autumn leaves, white birch, vermicelli, A kit for distinguishing mushroom cultivars characterized by being a mushroom varieties.
The forests are divided into seven areas including the following steps: Forest 7, Forest 9, Forest 10, Summer, Autumn, Baekhwa, Dasan, Method for discriminating one or more kinds of mushroom cultivars selected from the group consisting of Ridge 2 and true taste:
(a) extracting DNA from a sample;
(b) the extracted DNA as a template, a first primer set of Sequence Listing 1 and Sequence Listing 2, a second primer set of Sequence Listing 3 and Sequence Listing 4, a second primer set of Sequence Listing 5 and Sequence Listing 3 primer set, a fourth primer set of the seventh sequence and the eighth sequence, and a fifth primer set of the ninth sequence and the tenth sequence; And
(c) Analyzing the size of the PCR product to determine the variety of shiitake mushroom.

Images