KR101790769B1 - Primer Sets for Discrimination of Shiitake Mushroom Cultivar Comprising Sanjo-701, Sanjo-707, Sanjo-708 and Chamaram and Use Thereof - Google Patents

Primer Sets for Discrimination of Shiitake Mushroom Cultivar Comprising Sanjo-701, Sanjo-707, Sanjo-708 and Chamaram and Use Thereof Download PDF

Info

Publication number
KR101790769B1
KR101790769B1 KR1020160125769A KR20160125769A KR101790769B1 KR 101790769 B1 KR101790769 B1 KR 101790769B1 KR 1020160125769 A KR1020160125769 A KR 1020160125769A KR 20160125769 A KR20160125769 A KR 20160125769A KR 101790769 B1 KR101790769 B1 KR 101790769B1
Authority
KR
South Korea
Prior art keywords
sanjo
primer set
mushroom
sequence
size
Prior art date
Application number
KR1020160125769A
Other languages
Korean (ko)
Inventor
류호진
문수윤
정종욱
구창덕
이화용
Original Assignee
충북대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 충북대학교 산학협력단 filed Critical 충북대학교 산학협력단
Priority to KR1020160125769A priority Critical patent/KR101790769B1/en
Application granted granted Critical
Publication of KR101790769B1 publication Critical patent/KR101790769B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2531/00Reactions of nucleic acids characterised by
    • C12Q2531/10Reactions of nucleic acids characterised by the purpose being amplify/increase the copy number of target nucleic acid
    • C12Q2531/113PCR

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Botany (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 표고버섯 품종 산조 701호, 산조 707호, 산조 708호 및 참아람을 판별할 수 있는 표고버섯 품종 판별용 프라이머 세트 및 이를 이용하여 표고버섯 품종을 판별하는 방법을 제공한다. 본 발명을 이용하면 산림조합중앙회 산림버섯연구센터에서 개발한 표고 품종인 산조 701호, 산조 707호, 산조 708호, 참아람을 신속 정확하게 구분할 수 있으며, 이에 따라 국내로 유입되는 중국산 표고들을 효과적으로 구별할 수 있다. 또한, 본 발명을 이용하면 불법 유통된 종균으로부터 재배되고 있는 버섯을 확인하는 것이 가능하며, 상기 품종들의 수출시 본 균주들의 구별성을 확보할 수 있다. The present invention provides a primer set for discriminating mushroom cultivars capable of discriminating mushroom cultivars Sanjo 701, Sanjo 707, Sanjo 708 and Chora moth, and a method for discriminating mushroom cultivars using the primer set. By using the present invention, it is possible to quickly distinguish between high-grade varieties developed in Forestry Mushroom Research Center, Sanjo 701, Sanzo 707, Sanjo 708, and Zhou Aram, can do. In addition, it is possible to identify the mushroom cultivated from illegally circulated seeds using the present invention, and it is possible to ensure the discrimination of these strains upon export of the above varieties.

Description

표고버섯 품종 산조 701호, 산조 707호, 산조 708호 및 참아람 판별용 프라이머 세트 및 이의 용도{Primer Sets for Discrimination of Shiitake Mushroom Cultivar Comprising Sanjo-701, Sanjo-707, Sanjo-708 and Chamaram and Use Thereof}[0002] Primer sets for Discrimination of Shiitake Mushroom Cultivar Comprising Sanjo-701, Sanjo-707, Sanjo-708 and Chamaram and Use Thereof }

본 발명은 표고버섯 품종 산조 701호, 산조 707호, 산조 708호 및 참아람 판별용 프라이머 세트 및 이의 용도에 관한 것이다. The present invention relates to a primer set for discriminating mushroom cultivars Sanjo 701, Sanjo 707, Sanjo 708 and True Ara, and uses thereof.

전 세계적으로 버섯산업은 1990년대 후반 급속하게 증가하였고, 양송이, 느타리버섯, 표고, 목이, 팽이버섯류가 전 세계 버섯 생산의 약 95%를 차지하고 있다. 이중 표고는 약 17%를 차지하고 있다. 표고는 지리적으로 한국, 중국, 일본, 태국, 말레이시아, 인도네시아, 파푸아뉴기니, 오스트레일리아 및 뉴질랜드 등 아시아-오스트레일리아를 잇는 지역과 서쪽으로는 부탄, 네팔, 인도의 히말라야 지역까지 분포되고 있고, 한국, 중국, 일본, 대만 등 동아시아에서 많이 재배되고 있는 식용버섯이다. Globally, the mushroom industry has increased rapidly in the late 1990s, with mushrooms, oysters, shiitake, thorns, and top mushrooms accounting for about 95% of the world's mushroom production. Double elevations account for about 17%. The elevation is geographically distributed to Asia-Australia regions such as Korea, China, Japan, Thailand, Malaysia, Indonesia, Papua New Guinea, Australia and New Zealand and to the Himalayas in Bhutan, Nepal and India in the west, It is an edible mushroom grown in East Asia such as Japan and Taiwan.

버섯의 품종은 종균의 개념으로 유통된다. 우리나라 종자산업법에서 종자의 개념에 “종자”란 증식용·재배용 또는 양식용으로 쓰이는 씨앗, 버섯 종균(種菌), 묘목(苗木), 포자(胞子) 또는 영양체(營養體)인 잎·줄기·뿌리 등을 말한다.’고 명시하고 있다. 우리나라는 1997년 종자산업법을 시행하여 국내에서 신품종 육성자를 보호하려 하였고, 이어 2002년에 UPOV에 가입하였다. UPOV의 가입으로 우리나라는 외국 품종을 이용할 때 로열티를 지불하게 되고 이에 따라 많은 품종들이 개발되게 되었다. 현재 우리나라에서 2008년부터 2016년 6월 말까지 출원된 표고의 품종은 총 48개이고, 등록된 품종은 20개로 점차 증가할 것이라 판단된다. 이후 우리나라에서 종자산업법에서 식물신품종 보호법이 분리되어 식물신품종과 그 육성자의 권리를 체계적으로 보호하고 있다. Varieties of mushrooms are distributed in the concept of seed bacterium. In the Seed Industry Act of Korea, "seeds" in the concept of seeds are the seeds, mushroom seedlings, seedlings, spores or nutrients, which are used for propagation, cultivation or cultivation, · It refers to the root, etc. ". Korea adopted Seed Industry Act in 1997 to protect new breeders in Korea and joined UPOV in 2002. With the addition of UPOV, Korea will pay royalties when using foreign varieties, and many varieties have been developed accordingly. At present, the total number of varieties of highland applications filed from 2008 to the end of June 2016 in Korea will be 48, and the number of registered varieties will increase to 20. Since then, the Seed Industry Act of Korea has separated the new plant variety protection law systematically to protect the new plant variety and the rights of the grower.

현재 한중 FTA의 영향으로 중국산 표고의 수입이 증가하고 있고, 표고의 생산량보다 소비량이 많은 일본에서 중국산 표고보다 한국산을 선호하고 있어, 동북아 3국의 표고 시장이 급속히 변화하고 있다. 이에 따라 직접적인 버섯의 수출입 이외에 품종의 수출도 이루어 질 것으로 판단된다. 그리고 2010년 10월 제 10차 생물다양성협약 당사국 총회를 통해 나고야 의정서가 채택됨에 따라 각국은 현재 보유하고 있는 유전자원에 대한 보호를 강화할 것으로 생각된다. 따라서 현재 우리나라에서 보유하고 있는 표고 품종들에 대하여 정확히 판별하여 구분할 수 있는 기술이 절실하다.At present, imports from China are rising due to the effects of the Korea-China FTA. In Japan, which consumes more than the production of altitude, Korea is preferred to China, so the markets of the three countries in Northeast Asia are rapidly changing. As a result, it is expected that the export of varieties will be done in addition to direct import and export of mushrooms. The adoption of the Nagoya Protocol by the 10th Session of the Conference of the Parties to the Convention on Biological Diversity in October 2010 is expected to strengthen the protection of existing genetic resources. Therefore, there is an urgent need for technology that can accurately distinguish and distinguish highland cultivars currently held in Korea.

본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

대한민국 공개특허공보 10-2016-0098969Korean Patent Publication No. 10-2016-0098969

Won-Mok Park et al., The Korean Journal of Mycology Vol. 25, No 3, p176-190 Sep. 1997Won-Mok Park et al., The Korean Journal of Mycology Vol. 25, No. 3, p. 1997

본 발명자들은 표고버섯 가운데 산조 701호, 산조 707호, 산조 708호 및 참아람 품종을 신속하고 정확하게 판별할 수 있는 방법을 개발하고자 노력하였다. 그 결과, 표고버섯 산조 701호, 산조 707호, 산조 708호 및 참아람 품종을 구별 가능한 프라이머 세트를 제작하고, 이를 이용하여 PCR을 실시함으로써 시료(바람직하게는, 버섯톱밥배지, 버섯 종균, 버섯)로부터 상기 4종에 대한 표고버섯 품종을 판별할 수 있음을 규명함으로써 본 발명을 완성하게 되었다. The present inventors have sought to develop a method for quickly and accurately discriminating among the mushrooms of Sanjo 701, Sanjo 707, Sanjo 708, and True Arum. As a result, a primer set capable of distinguishing the mushroom's Sanjo 701, Sanjo 707, Sanjo 708, and Chama arum varieties was prepared and subjected to PCR using the same to obtain a sample (preferably, a mushroom sawdust medium, ) To identify the above-mentioned four kinds of mushroom cultivars, thereby completing the present invention.

따라서, 본 발명의 목적은 표고버섯 품종 판별용 프라이머 세트를 제공하는데 있다. Accordingly, it is an object of the present invention to provide a primer set for distinguishing mushroom cultivars.

본 발명의 다른 목적은 표고버섯 품종 판별용 키트를 제공하는데 있다. It is another object of the present invention to provide a kit for discriminating mushroom cultivars.

본 발명의 또 다른 목적은 표고버섯 품종 판별 방법을 제공하는데 있다. It is another object of the present invention to provide a method for discriminating mushroom cultivars.

본 발명의 다른 목적 및 이점은 하기의 발명의 상세한 설명 및 청구범위에 의해 보다 명확하게 된다. Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention and claims.

본 발명의 일 양태에 따르면, 본 발명은 서열목록 제1서열 및 제2서열의 제1프라이머 세트 및 서열목록 제3서열 및 제4서열의 제2프라이머 세트로 구성된 표고버섯 품종 판별용 프라이머 세트를 제공한다. According to one aspect of the present invention, there is provided a primer set for discriminating mushroom cultivars comprising a first primer set of Sequence Listing first sequence and a second sequence, and a second primer set of Sequence Listing 3 and Sequence Listing to provide.

본 발명자들은 표고버섯 가운데 산조 701호, 산조 707호, 산조 708호 및 참아람 품종을 신속하고 정확하게 판별할 수 있는 방법을 개발하고자 노력하였고 그 결과, 표고버섯 산조 701호, 산조 707호, 산조 708호 및 참아람 품종을 구별 가능한 프라이머 세트를 제작하고, 이를 이용하여 PCR을 실시함으로써 시료(바람직하게는, 버섯톱밥배지, 버섯 종균, 버섯)로부터 상기 4종에 대한 표고버섯 품종을 판별할 수 있음을 규명하였다. The present inventors have made efforts to develop a method for quickly and accurately discriminating among the shiitake mushrooms Sanjo 701, Sanjo 707, Sanjo 708, and True Arum varieties. As a result, (Preferably, mushroom sawdust medium, mushroom seedlings, mushrooms) by preparing a primer set which can discriminate between the four kinds of the mushroom species and the true arum variety, and conducting PCR using the same. Respectively.

하기 실시예에서 확인하는 바와 같이, 본 발명의 프라이머 세트를 이용하면 시료로부터 표고버섯 품종 산조 701호, 산조 707호, 산조 708호 및 참아람을 쉽고 빠르게 판별할 수 있다. As can be seen from the following examples, the primer set of the present invention can be used to easily and quickly identify the mushroom cultivars Sanjo 701, Sanjo 707, Sanjo 708 and Chamaele from the sample.

본 발명의 다른 양태에 따르면, 본 발명은 서열목록 제1서열 및 제2서열의 제1프라이머 세트 및 서열목록 제3서열 및 제4서열의 제2프라이머 세트로 구성된 프라이머 세트를 포함하는 표고버섯 품종 판별용 키트를 제공한다. According to another aspect of the present invention, the present invention provides a primer set comprising a primer set consisting of a first primer set of Sequence Listing first and second sequences and a second primer set of Sequence Listing 3 and Sequence Listing A discrimination kit is provided.

본 발명의 키트는 제1프라이머 세트 및 제2프라이머 세트 이외에 PCR 반응을 용이하게 수행할 수 있기 위해 DNA 중합효소 및 상기에서 기재한 조성의 PCR 반응 완충용액이 추가로 포함될 수 있으며, PCR 산물의 증폭 여부를 확인할 수 있는 전기영동 수행에 필요한 구성성분들이 본 발명의 키트에 추가로 포함될 수 있다.The kit of the present invention may further comprise a DNA polymerase and a PCR reaction buffer solution of the composition described above in order to facilitate the PCR reaction in addition to the first primer set and the second primer set, The components necessary for performing the electrophoresis can be further included in the kit of the present invention.

본 발명의 다른 양태에 따르면, 본 발명은 다음 단계를 포함하는 표고버섯 품종 판별 방법을 제공한다:According to another aspect of the present invention, the present invention provides a method of identifying a mushroom cultivar comprising the steps of:

(a) 시료로부터 DNA를 추출하는 단계; (a) extracting DNA from a sample;

(b) 추출된 DNA를 주형으로 서열목록 제1서열 및 제2서열의 제1프라이머 세트 및 서열목록 제3서열 및 제4서열의 제2프라이머 세트로 구성된 프라이머 세트를 이용하여 PCR을 실시하는 단계; 및(b) performing PCR using the extracted DNA as a template using a primer set composed of a first primer set of Sequence Listing first sequence and a second sequence and a second primer set of Sequence Listing 3 and Sequence Listing; ; And

(c) PCR 산물의 크기를 분석하여 표고버섯의 품종을 판별하는 단계. (c) Analyzing the size of the PCR product to determine the variety of shiitake mushroom.

상기 (a) 단계에서 DNA의 추출은 당업계에서 통상적으로 사용되는 페놀/클로로포름 추출법, SDS 추출법(Tai et al., Plant Mol. Biol. Reporter, 8: 297-303, 1990), CTAB 분리법(Cetyl Trimethyl Ammonium Bromide; Murray et al., Nuc. Res., 4321-4325, 1980) 또는 상업적으로 판매되는 DNA 추출 키트를 이용하여 수행할 수 있다.The extraction of DNA in step (a) can be carried out by a conventional phenol / chloroform extraction method, SDS extraction method (Tai et al., Plant Mol. Biol. Reporter, 8: 297-303, 1990), CTAB separation method Trimethyl Ammonium Bromide; Murray et al., Nuc. Res., 4321-4325, 1980) or commercially available DNA extraction kits.

표고버섯 품종 판별을 위해 DNA를 추출하는 시료는 표고버섯 배지, 표고버섯 종균, 표고버섯일 수 있다. Samples to extract DNA for shiitake cultivar discrimination can be shiitake medium, shiitake mushroom, and shiitake mushroom.

또한, 상기 (b) 단계에서 PCR은 PCR 반응에 필요한 당업계에 공지된 여러 성분을 포함하는 PCR 반응 혼합액을 이용하여 수행될 수 있다. 상기 PCR 반응 혼합액에는 분석하고자 하는 버섯에서 추출된 DNA와 본 발명에서 제공되는 프라이머쌍 이외에 적당량의 DNA 중합효소, dNTP, PCR 완충용액 및 물(dH2O)을 포함한다. 상기 PCR 완충용액은 트리스-HCl(Tris-HCl), MgCl2, KCl 등을 포함한다. 이 때 MgCl2 농도는 증폭의 특이성과 수량에 크게 영향을 주며, 바람직하게는 1.5-2.5 mM의 범위로 사용될 수 있다. 일반적으로 Mg2+가 과량인 경우는 비특이적인 PCR 증폭산물이 증가하고, Mg2 +가 부족한 경우 PCR 산물의 산출율이 감소한다. 상기 PCR 완충용액에는 적당량의 트리톤 X-100(Triton X-100)이 추가로 포함될 수도 있다. In the step (b), the PCR may be performed using a PCR reaction mixture containing various components known in the art necessary for the PCR reaction. In the PCR reaction mixture, an appropriate amount of DNA polymerase, dNTP, PCR buffer solution and water (dH 2 O) are contained in addition to the DNA extracted from the mushroom to be analyzed and the primer pair provided in the present invention. The PCR buffer comprises Tris -HCl (Tris-HCl), MgCl 2, KCl and the like. At this time, the MgCl 2 concentration greatly affects the specificity and yield of the amplification, preferably 1.5-2.5 mM. In general, an excess of Mg 2+ increases the yield of nonspecific PCR amplification products, and a decrease in the yield of PCR products when Mg 2 + is insufficient. The PCR buffer solution may further contain an appropriate amount of Triton X-100 (Triton X-100).

상기 프라이머 세트를 이용하여 실시하는 PCR 조건은 90 내지 97℃, 2 내지 7분간 반응하고 다시 90 내지 97℃에서 20초 내지 1분, 56 내지 60℃에서 20초 내지 1분, 72℃ 20초 내지 1분으로 30 내지 40 사이클로 증폭하고 72℃ 20분간 추가로 반응시켜 실시할 수 있으나, 당업자의 기술 수준에서 이해할 수 있는 통상의 방법에 따라 수행될 수 있어 특별히 제한하지는 않는다.The PCR conditions using the above primer set are 90 to 97 占 폚 for 2 to 7 minutes, followed by 20 to 1 minute at 90 to 97 占 폚, 20 to 1 minute at 56 to 60 占 폚, Amplified at 30 to 40 cycles in 1 minute, and further reacted at 72 ° C for 20 minutes. However, the reaction can be carried out according to a conventional method which is understood by a person skilled in the art and is not particularly limited.

상기 (c) 단계에서는 당업계에서 널리 공지된 방법에 따라 PCR 산물의 DNA를 크기별로 분리할 수 있다. 바람직하게는 아가로스 겔(agarose gel) 또는 폴리아크릴아미드 겔(polyacrylamide gel) 전기영동 또는 형광분석장치(ABI prism 3100 genetic analyzer-electropherogram)에 의해 확인할 수 있다. 이 때, 형광분석장치를 이용하기 위해서는 당업계에 공지된 형광 다이(dye)를 붙인 프라이머 세트를 이용하여 상기 (b) 단계에서 PCR을 수행한다.In the step (c), the DNA of the PCR product can be isolated by size according to a method well known in the art. Preferably by agarose gel or polyacrylamide gel electrophoresis or an ABI prism 3100 genetic analyzer-electropherogram. At this time, in order to use the fluorescence analyzer, PCR is performed in the step (b) using a primer set with a fluorescent dye known in the art.

표 2를 참조하여 설명하면, 서열목록 제1서열 및 제2서열의 제1프라이머 세트(RL-LE-002 프라이머 세트)를 이용하여 표고버섯 품종 산조 701호, 산조 707호, 산조 708호 및 참아람에 대해 PCR 증폭을 실시할 경우, 증폭된 PCR 산물은 각각 216 bp, 207/217 bp, 219/229 bp 및 207/217 bp의 크기를 나타낸다. 또한, 서열목록 제3서열 및 제4서열의 제2프라이머 세트(RL-LE-013 프라이머 세트)를 이용하여 표고버섯 품종 산조 701호, 산조 707호, 산조 708호 및 참아람에 대해 PCR 증폭을 실시할 경우, 증폭된 PCR 산물은 각각 193/199 bp, 189 bp, 191 bp 및 193/201 bp의 크기를 나타낸다.Using the first primer set (RL-LE-002 primer set) of the first and second sequences of the sequence listing, the mushroom cultivars Sanjo 701, Sanjo 707, Sanjo 708, and Cham When PCR amplification is carried out on aram, amplified PCR products show sizes of 216 bp, 207/217 bp, 219/229 bp and 207/217 bp, respectively. In addition, PCR amplification was performed on the mushroom cultivars Sanjo 701, Sanjo 707, Sanjo 708, and Chlamium using a second primer set (RL-LE-013 primer set) of Sequence Listing No. 3 and No. 4 sequences When performed, the amplified PCR products show sizes of 193/199 bp, 189 bp, 191 bp and 193/201 bp, respectively.

따라서, 제1프라이머 세트에 의해 증폭된 PCR 산물의 크기가 216 bp이고 제2프라이머 세트에 의해 증폭된 PCR 산물의 크기가 193/199 bp인 경우, 표고버섯의 품종은 산조 701호, 제1프라이머 세트에 의해 증폭된 PCR 산물의 크기가 207/217 bp이고 제2프라이머 세트에 의해 증폭된 PCR 산물의 크기가 189 bp인 경우, 표고버섯의 품종은 산조 707호, 제1프라이머 세트에 의해 증폭된 PCR 산물의 크기가 219/229 bp이고 제2프라이머 세트에 의해 증폭된 PCR 산물의 크기가 191 bp인 경우, 표고버섯의 품종은 산조 708호, 제1프라이머 세트에 의해 증폭된 PCR 산물의 크기가 207/217 bp이고 제2프라이머 세트에 의해 증폭된 PCR 산물의 크기가 193/201 bp인 경우, 표고버섯의 품종은 참아람인 것으로 판별한다. Therefore, when the size of the PCR product amplified by the first primer set is 216 bp and the size of the PCR product amplified by the second primer set is 193/199 bp, the varieties of mushroom are Sanzo 701, the first primer When the size of the PCR product amplified by the set was 207/217 bp and the size of the PCR product amplified by the second primer set was 189 bp, the varieties of mushroom were amplified by Sanjo 707, the first primer set When the size of the PCR product was 219/229 bp and the size of the PCR product amplified by the second primer set was 191 bp, the size of the PCR product amplified by the first primer set in Sanjo 708, 207/217 bp and the size of the PCR product amplified by the second primer set is 193/201 bp, the varieties of shiitake mushrooms are judged to be true mushrooms.

본 발명의 특징 및 이점을 요약하면 다음과 같다:The features and advantages of the present invention are summarized as follows:

(ⅰ) 본 발명은 표고버섯 품종 산조 701호, 산조 707호, 산조 708호 및 참아람을 판별할 수 있는 표고버섯 품종 판별용 프라이머 세트 및 이를 이용하여 표고버섯 품종을 판별하는 방법을 제공한다. (I) The present invention provides a primer set for discriminating mushroom cultivars which can discriminate mushroom cultivars Sanjo 701, Sanjo 707, Sanjo 708 and Chamaele, and a method for distinguishing mushroom cultivars using the primer set.

(ⅱ) 본 발명을 이용하면 산림조합중앙회 산림버섯연구센터에서 개발한 표고 품종인 산조 701호, 산조 707호, 산조 708호, 참아람을 신속 정확하게 구분할 수 있으며, 이에 따라 국내로 유입되는 중국산 표고들을 효과적으로 구별할 수 있다.(Ii) By using the present invention, it is possible to quickly and accurately distinguish high-grade varieties San-no 701, San-o 707, San-708, and True Ara, developed by the Forestry Union Mushroom Research Center, Can be effectively distinguished.

(ⅲ) 또한, 본 발명을 이용하면 불법 유통된 종균으로부터 재배되고 있는 버섯 품종을 확인하는 것이 가능하며, 상기 품종들의 수출시 본 균주들의 구별성을 확보할 수 있다. (Iii) It is also possible to identify the mushroom cultivars cultivated from illegally circulated germs using the present invention, and to ensure the distinction of these strains upon export of the above varieties.

도 1은 프라이머 서열을 이용한 PCR 방법으로 표고버섯 품종 산조 701호, 산조 707호, 산조 708호 및 참아람을 결정할 수 있는 염기서열을 나타낸 것이다.
도 2는 본 발명의 프라이머 세트를 이용하여 PCR을 수행한 결과이다.
FIG. 1 shows the nucleotide sequences that can be determined by the PCR method using the primer sequence, in which the mushroom cultivars Sanjo 701, Sanjo 707, Sanjo 708 and Chora-aram were determined.
Fig. 2 shows the result of performing PCR using the primer set of the present invention.

이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

실시예Example

실시예 1: 표고버섯 품종 판별을 위한 프라이머 제작Example 1: Preparation of primers for discriminating shiitake mushroom cultivars

표고버섯 품종 산조 701호, 산조 707호, 산조 708호 및 참아람을 판별하기 위해 상기 4개 품종이 구분되는 염기서열을 찾았고, 이를 이용하여 프라이머를 제작하였다(도 1). In order to discriminate the mushroom cultivars Sanjo 701, Sanjo 707, Sanjo 708 and Chamaeleum, the four strains were identified and their primers were prepared (FIG. 1).

품종구분을 위한 프라이머 서열Primer sequences for breed identification 프라이머primer 서열(5’-3’)The sequence (5'-3 ') RL-LE-002FRL-LE-002F GTAGAGGGATACGCGAAGTAAGGTAGAGGGATACGCGAAGTAAG RL-LE-002RRL-LE-002R ACAATGGTCGTTCACAGTCGACAATGGTCGTTCACAGTCG RL-LE-013FRL-LE-013F CGTTGTGACTCGTGACCTCTCGTTGTGACTCGTGACCTCT RL-LE-013RRL-LE-013R CAGTCGTAGGATACCGCATAAGCAGTCGTAGGATACCGCATAAG

실시예 2: 제작된 프라이머를 이용한 표고버섯 품종 판별Example 2: Identification of mushroom cultivars using the prepared primers

PDB 배지에서 배양한 표고버섯 품종 산조 701호, 산조 707호, 산조 708호 및 참아람의 균사를 미라클로스에 여과시킨 후 PBS 버퍼(NaCl 135 mM, KCl 2.7 mM, Na2HPO4 4.3 mM, KH2PO4 1.4 mM)를 부어 씻어내고 키친타올로 물기를 제거하였다. 건조된 균사를 액체질소에 얼려 막자사발로 곱게 갈은 후 GeneAll® GenEx™ Plant kit를 이용해 Genomic DNA를 추출하였다. 튜브에 옮겨 담은 균사에 PL버퍼 500 μl를 넣고 65℃에서 10분간 가열해준 후 파이펫을 이용해 잘 섞어주었다. 13,000 rpm으로 1분간 원심분리한 후 상층액을 분리하여 새 튜브로 옮겨준 후 PP 버퍼를 상층액의 1/3만큼 넣고 볼텍서를 이용해 잘 섞어주었다. 얼음에서 5분간 방치 후 13,000 rpm으로 5분간 원심분리하였다. 상층액을 분리하여 새 튜브로 옮기고 동량의 PCI(phenol : Chloroform : isoamylalcohol = 25 : 24: 1)를 넣어준 후 뒤집어 섞어주었다. 13,000 rpm에서 10분간 원심분리한 후 상층액을 분리하여 새 튜브에 옮기고, 동량의 이소프로파놀을 넣어준 후 뒤집어 섞어주었다. 얼음에 10분간 방치 후 13,000 rpm에서 1분간 원심분리하였다. 상층액을 제거한 후 70% 에탄올 1 ml를 넣어 DNA 펠렛을 살짝 띄우고 13,000 rpm에서 1분간 원심분리하였다. 상층액을 제거한 후 13,000 rpm에서 1분간 한 번 더 원심분리하였다. 남은 에탄올을 전부 제거하고 DNA 펠렛을 상온에서 5분간 건조시킨 후, RE 버퍼 100 μl를 넣어 DNA 펠렛을 녹였다. 추출한 Genomic DNA 20 ng을 주형으로 본 발명에서 제작한 프라이머를 이용하여 PCR을 수행하였다. PCR은 95℃에서 3분, 다시 95℃에서 30초, 58℃에서 30초, 72℃에서 30초로 35사이클을 증폭한 후, 추가로 72℃에서 20분간 반응시킴으로써 수행되었다. The mushroom cultivars cultured on PDB medium were filtered through Miaclaus, and then washed with PBS buffer (NaCl 135 mM, KCl 2.7 mM, Na 2 HPO 4 4.3 mM, KH 2 PO 4 1.4 mM) was poured out and the water was removed with a kitchen towel. The dried hyphae were frozen in liquid nitrogen and finely ground in a mortar, and the genomic DNA was extracted using the GeneAll® GenEx ™ Plant kit. 500 μl of PL buffer was added to the mycelium transferred to the tube, heated at 65 ° C for 10 minutes, and mixed well using a pipette. After centrifugation at 13,000 rpm for 1 minute, the supernatant was removed and transferred to a new tube. The PP buffer was added to the supernatant by 1/3 of the supernatant and mixed well using a Vortex. After standing on ice for 5 minutes, centrifugation was carried out at 13,000 rpm for 5 minutes. The supernatant was removed and transferred to a new tube. The same volume of PCI (phenol: Chloroform: isoamylalcohol = 25: 24: 1) was added and the mixture was inverted. After centrifugation at 13,000 rpm for 10 minutes, the supernatant was separated, transferred to a new tube, and mixed with the same amount of isopropanol. They were left on ice for 10 minutes and then centrifuged at 13,000 rpm for 1 minute. After removal of the supernatant, 1 ml of 70% ethanol was added to shake the DNA pellet and centrifuged at 13,000 rpm for 1 minute. The supernatant was removed and centrifuged once more at 13,000 rpm for 1 minute. The remaining ethanol was removed, and the DNA pellet was dried at room temperature for 5 minutes. Then, 100 μl of RE buffer was added to dissolve the DNA pellet. PCR was carried out using 20 ng of the extracted genomic DNA as a template using the primer prepared in the present invention. The PCR was carried out by amplifying 35 cycles at 95 ° C for 3 minutes, again at 95 ° C for 30 seconds, at 58 ° C for 30 seconds, at 72 ° C for 30 seconds, and further at 72 ° C for 20 minutes.

상기 프라이머들에 의해 산조 701호, 산조 707호, 산조 708호 및 참아람이 구분되는 것을 확인할 수 있었다(도 2). 각 품종에 따라 프라이머 세트에 의해 증폭된 PCR 산물의 크기는 표 2와 같다. It was confirmed by the above primers that Sanjo 701, Sanjo 707, Sanjo 708 and True Aram were distinguished (Fig. 2). Table 2 shows the sizes of the PCR products amplified by the primer sets according to the respective cultivars.

PCR 산물의 크기 (사이즈 단위는 base pair (bp)임)Size of PCR product (size unit is base pair (bp)) 품종kind RL-LE-002 프라이머 세트RL-LE-002 Primer Set RL-LE-013 프라이머 세트RL-LE-013 primer set 산조 701호Sanjo 701 216216 193/199193/199 산조 707호Sanjo 707 207/217207/217 189189 산조 708호Sanjo 708 219/229219/229 191191 참아람True Arama 207/217207/217 193/201193/201

이상으로 본 발명의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현 예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the present invention. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

<110> Chungbuk National University Industry-Academic Cooperation Foundation <120> Primer Sets for Discrimination of Shiitake Mushroom Cultivar Comprising Sanjo-701, Sanjo-707, Sanjo-708 and Chamaram and Use Thereof <130> PN160320 <160> 4 <170> KopatentIn 2.0 <210> 1 <211> 22 <212> DNA <213> RL-LE-002F <400> 1 gtagagggat acgcgaagta ag 22 <210> 2 <211> 20 <212> DNA <213> RL-LE-002R <400> 2 acaatggtcg ttcacagtcg 20 <210> 3 <211> 20 <212> DNA <213> RL-LE-013F <400> 3 cgttgtgact cgtgacctct 20 <210> 4 <211> 22 <212> DNA <213> RL-LE-013R <400> 4 cagtcgtagg ataccgcata ag 22 <110> Chungbuk National University Industry-Academic Cooperation Foundation <120> Primer Sets for Discrimination of Shiitake Mushroom Cultivar          Comprising Sanjo-701, Sanjo-707, Sanjo-708 and Chamaram and Use          Thereof <130> PN160320 <160> 4 <170> Kopatentin 2.0 <210> 1 <211> 22 <212> DNA <213> RL-LE-002F <400> 1 gtagagggat acgcgaagta ag 22 <210> 2 <211> 20 <212> DNA <213> RL-LE-002R <400> 2 acaatggtcg ttcacagtcg 20 <210> 3 <211> 20 <212> DNA <213> RL-LE-013F <400> 3 cgttgtgact cgtgacctct 20 <210> 4 <211> 22 <212> DNA <213> RL-LE-013R <400> 4 cagtcgtagg ataccgcata ag 22

Claims (5)

서열목록 제1서열 및 제2서열의 제1프라이머 세트 및 서열목록 제3서열 및 제4서열의 제2프라이머 세트로 구성된 표고버섯 품종 판별용 프라이머 세트로서 상기 표고버섯 품종은 산조 701호, 산조 707호, 산조 708호 및 참아람으로 이루어진 군에서 선택되는 1종 이상의 표고버섯 품종인 것을 특징으로 하는 프라이머 세트.
A first primer set of Sequence Listing first sequence and a second sequence; and a second primer set of Sequence Listing 3 and Sequence Listing, wherein the mushroom cultivar is selected from the group consisting of Sanjo 701, Sanjo 707 Wherein said at least one mushroom cultivar is at least one selected from the group consisting of Pseudomonas sp.
삭제delete 서열목록 제1서열 및 제2서열의 제1프라이머 세트 및 서열목록 제3서열 및 제4서열의 제2프라이머 세트로 구성된 프라이머 세트를 포함하는 표고버섯 품종 판별용 키트로서 상기 표고버섯 품종은 산조 701호, 산조 707호, 산조 708호 및 참아람으로 이루어진 군에서 선택되는 1종 이상의 표고버섯 품종인 것을 특징으로 하는 표고버섯 품종 판별용 키트.
A primer set comprising a first primer set of Sequence Listing first sequence and a second sequence and a second primer set of Sequence Listing third sequence and fourth sequence, wherein said mushroom cultivar is selected from the group consisting of Sanjo 701 The present invention relates to a kit for discriminating mushroom cultivars, which is a mushroom cultivar of at least one species selected from the group consisting of Cucumis sativum L., Sanjo 707, Sanjo 708 and True Arum.
다음 단계를 포함하는 산조 701호, 산조 707호, 산조 708호 및 참아람으로 이루어진 군에서 선택되는 1종 이상의 표고버섯 품종을 판별하는 방법:
(a) 시료로부터 DNA를 추출하는 단계;
(b) 추출된 DNA를 주형으로 서열목록 제1서열 및 제2서열의 제1프라이머 세트 및 서열목록 제3서열 및 제4서열의 제2프라이머 세트로 구성된 프라이머 세트를 이용하여 PCR을 실시하는 단계; 및
(c) PCR 산물의 크기를 분석하여 표고버섯의 품종을 판별하는 단계.
A method for distinguishing one or more kinds of mushroom cultivars selected from the group consisting of Sanjo 701, Sanjo 707, Sanjo 708, and True Aram including the following steps:
(a) extracting DNA from a sample;
(b) performing PCR using the extracted DNA as a template using a primer set composed of a first primer set of Sequence Listing first sequence and a second sequence and a second primer set of Sequence Listing 3 and Sequence Listing; ; And
(c) Analyzing the size of the PCR product to determine the variety of shiitake mushroom.
제 4 항에 있어서, 상기 단계 (c)에서 (i) 제1프라이머 세트에 의해 증폭된 PCR 산물의 크기가 216 bp이고 제2프라이머 세트에 의해 증폭된 PCR 산물의 크기가 193/199 bp인 경우, 표고버섯의 품종은 산조 701호이고, (ⅱ) 제1프라이머 세트에 의해 증폭된 PCR 산물의 크기가 207/217 bp이고 제2프라이머 세트에 의해 증폭된 PCR 산물의 크기가 189 bp인 경우, 표고버섯의 품종은 산조 707호이며, (ⅲ) 제1프라이머 세트에 의해 증폭된 PCR 산물의 크기가 219/229 bp이고 제2프라이머 세트에 의해 증폭된 PCR 산물의 크기가 191 bp인 경우, 표고버섯의 품종은 산조 708호이고, (ⅳ) 제1프라이머 세트에 의해 증폭된 PCR 산물의 크기가 207/217 bp이고 제2프라이머 세트에 의해 증폭된 PCR 산물의 크기가 193/201 bp인 경우, 표고버섯의 품종은 참아람인 것으로 판별하는 것을 특징으로 하는 방법. 5. The method according to claim 4, wherein in step (c) (i) when the size of the PCR product amplified by the first primer set is 216 bp and the size of the PCR product amplified by the second primer set is 193/199 bp (Ii) when the size of the PCR product amplified by the first primer set is 207/217 bp and the size of the PCR product amplified by the second primer set is 189 bp, (Iii) when the size of the PCR product amplified by the first primer set is 219/229 bp and the size of the PCR product amplified by the second primer set is 191 bp, (Iv) when the size of the PCR product amplified by the first primer set is 207/217 bp and the size of the PCR product amplified by the second primer set is 193/201 bp, Characterized in that the varieties of shiitake mushrooms are true Arabian.
KR1020160125769A 2016-09-29 2016-09-29 Primer Sets for Discrimination of Shiitake Mushroom Cultivar Comprising Sanjo-701, Sanjo-707, Sanjo-708 and Chamaram and Use Thereof KR101790769B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020160125769A KR101790769B1 (en) 2016-09-29 2016-09-29 Primer Sets for Discrimination of Shiitake Mushroom Cultivar Comprising Sanjo-701, Sanjo-707, Sanjo-708 and Chamaram and Use Thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020160125769A KR101790769B1 (en) 2016-09-29 2016-09-29 Primer Sets for Discrimination of Shiitake Mushroom Cultivar Comprising Sanjo-701, Sanjo-707, Sanjo-708 and Chamaram and Use Thereof

Publications (1)

Publication Number Publication Date
KR101790769B1 true KR101790769B1 (en) 2017-10-27

Family

ID=60300468

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020160125769A KR101790769B1 (en) 2016-09-29 2016-09-29 Primer Sets for Discrimination of Shiitake Mushroom Cultivar Comprising Sanjo-701, Sanjo-707, Sanjo-708 and Chamaram and Use Thereof

Country Status (1)

Country Link
KR (1) KR101790769B1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102121145B1 (en) * 2019-03-07 2020-06-09 충북대학교 산학협력단 Development of CAPS marker for discrimination of ABL and its mutation for mycelial browning and use thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Lian-Hua Qin et al., FEMS Microbiol Lett, 257, pp112-116, 2006
Li-Zhong Fu et al., World J. Microbiol. Biotechnol., 26, pp709-716, 2010.
Ruiying Zhang et al., Appl. Microbiol. Biotechnol., 74, pp140-145, 2007.

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102121145B1 (en) * 2019-03-07 2020-06-09 충북대학교 산학협력단 Development of CAPS marker for discrimination of ABL and its mutation for mycelial browning and use thereof

Similar Documents

Publication Publication Date Title
US11926869B2 (en) Development of simple sequence repeat (SSR) core primer group based on whole genome sequence of pomegranate and application thereof
CN108660136B (en) Characteristic sequence, labeled primer and identification method of apocarya variety Davis
Garrido et al. Development of protocols for detection of Colletotrichum acutatum and monitoring of strawberry anthracnose using real‐time PCR
CN107557434B (en) Characteristic sequence, labeled primer and identification method of Carya illinoensis variety Van Deman
CN108330163B (en) Characteristic sequence, primer and identification method of apocarya variety Nacono and Sumner
Bunkoed et al. Sexual reproduction of Setosphaeria turcica in natural corn fields in Thailand
Ježić et al. Castanea sativa: genotype-dependent recovery from chestnut blight
Asl et al. Molecular characterization of environmental Cladosporium species isolated from Iran
KR101905980B1 (en) Primer Sets for Discrimination of Shiitake Mushroom Cultivar Comprising Hyanggo-808, Sanmaru-1 and Sanjo-705 and Use Thereof
KR101378161B1 (en) DNA markers for Ganoderma lucidum, primers for the markers, and method for discriminating Ganoderma lucidum
CN107119048A (en) Mulberry Femoral pseudoaneurysm rDNA and its application in mulberry Femoral pseudoaneurysm Molecular Detection
KR101971591B1 (en) SSR Markers for Cultivar Discrimination of Oak mushroom and use thereof
KR101790769B1 (en) Primer Sets for Discrimination of Shiitake Mushroom Cultivar Comprising Sanjo-701, Sanjo-707, Sanjo-708 and Chamaram and Use Thereof
KR101615433B1 (en) SNP marker for identifying the antlered form Ganoderma lucidum, and identifying method using the same
KR102163233B1 (en) SSR primer set for discriminating Agaricus bisporus cultivar Sae Jeong, Sae-Ah, Seolgang and uses thereof
KR101532566B1 (en) Primer for the Identification of Sesame Cultivar and Method for Identifying Sesame Cultivar
KR101271367B1 (en) SSR primer isolated from Lilum spp. and use thereof
Pereira et al. Heterokaryosis and diploid formation among Brazilian isolates of Macrophomina phaseolina
CN109706262A (en) Characteristic sequence, labeled primer and the identification method of thin shell mountain pecan Peach cultivars Davis
KR101219546B1 (en) Development of grain weevils resistive molecular markers in mung beans and uses thereof
KR20180075451A (en) Identification method the variety of Cherry Rootstock
KR101790771B1 (en) Primer Sets for Discrimination of Shiitake Mushroom Cultivar and Use Thereof
Riegel et al. Genetic diversity and virulence of Colletotrichum lupini isolates collected in Chile
Santamaria et al. Genetic characterization of Gremmeniella abietina var. abietina isolates from Spain
Békefi et al. Determination of incompatibility (S) genotypes of sweet cherries in the Hungarian gene-bank by a PCR-based method

Legal Events

Date Code Title Description
E701 Decision to grant or registration of patent right
GRNT Written decision to grant