KR101785290B1 - Production and application of a monoclonal antibody and the development of a competitive enzyme-linked immunosorbent assay(c-ELISA) for detection of severe fever with thrombocytopenia syndrome virus(SFTSV) - Google Patents

Abstract

The present invention relates to a monoclonal antibody for the diagnosis of a severe febrile platelet syndrome virus (SFTSV) infection, a hybridoma producing the same, and a diagnostic method for SFTSV infection using the monoclonal antibody, (NP), a hybridoma cell line KCTC18332P that produces the monoclonal antibody, and the serum of the monoclonal antibody and the subject animal are competitively reacted with the NP antigen and the level of binding of the monoclonal antibody is measured The present invention relates to a method for diagnosing an infection of SFTSV, which judges the presence or absence of an antibody against SFTSV in serum.
Using the monoclonal antibodies, hybridomas, diagnostic reagents, diagnostic kits or diagnostic methods of the present invention, the infection of SFTSV can be diagnosed safely, promptly and with high accuracy without being greatly affected by animal species. It is anticipated that SFTS can be prevented or delayed from livestock, pets, and wild animals that may be potential mediators of SFTSV, contributing significantly to public health and animal health.

Description

FIELD OF THE INVENTION The present invention relates to a method for diagnosing a severe febrile thrombocytopenic syndrome virus infection using a monoclonal antibody, a hybridoma producing the same, and a monoclonal antibody, Immunosorbent assay (c-ELISA) for detection of severe fever with thrombocytopenia syndrome virus (SFTSV)

The present invention relates to a monoclonal antibody for the diagnosis of a severe febrile platelet syndrome virus (SFTSV) infection, a hybridoma producing the same, and a diagnostic method for SFTSV infection using the monoclonal antibody, (NP), a hybridoma cell line KCTC18332P that produces the monoclonal antibody, and the serum of the monoclonal antibody and the subject animal are competitively reacted with the NP antigen and the level of binding of the monoclonal antibody is measured The present invention relates to a method for diagnosing an infection of SFTSV, which judges the presence or absence of an antibody against SFTSV in serum.

Severe Fever with Thrombocytopenia Syndrome Virus (SFTSV) was first detected in China in 2009 and showed platelet and leukopenia, fever, myalgia, and multiple organ dysfunction with an average infection rate of 12 %to be. Death cases have been reported in China, Japan and Korea.

The type of mediator or host animal responsible for Severe Fever with Thrombocytopenia Syndrome (abbreviated as SFTS) is unclear. In China, however, SFTSV in the ticks isolated from sheep, ( Haemaphysalis longicornis , small goose mite). Some patients have metastasized through human blood or secretions and have not been diagnosed with livestock, but there have been reports of antigens and antibodies to SFTSV in sheep, cattle, pigs, and chickens.

No vaccine has been developed for SFTS, and there is no clear treatment to prevent spread. Therefore, there is a need for research on the development of diagnostic kits and diagnostic reagents that can rapidly diagnose the infection of SFTSV in animals. There is currently a method of performing RT-PCR using the antigen detection method of SFTSV. The antibody detection method is an indirect immunofluorescence assay (IFA (fluorescence immunoassay) ), But it is difficult to judge the result because there are a lot of non-specific reactions according to the state of the sample, and it is difficult to perform in the general laboratory because it is necessary to directly deal with the virus. The double antigen sandwich ELISA using the nucleocapsid protein in the antibody test for SFTSV has been developed in China and other countries but it is difficult to obtain it from the domestic market because it is not industrialized.

Liu Q, He B, Huang SY, Wei F, Zhu XQ. Severe fever with thrombocytopenia syndrome, an emerging tick-borne zoonosis. Lancet Infect Dis. Aug 2014; 14 (8): 763-72.

Therefore, a main object of the present invention is to provide a method for efficiently diagnosing infection of SFTSV.

Another object of the present invention is to provide an antibody against SFTSV necessary for the above diagnostic method.

It is another object of the present invention to provide a hybridoma producing the antibody.

According to one aspect of the present invention, the present invention provides a hybridoma cell line KCTC18332P which produces a monoclonal antibody exhibiting immunoreactivity to a nucleoprotein (abbreviated as 'NP' hereinafter) of SFTSV having the amino acid sequence of SEQ ID NO: 1 do.

The hybridoma cell line of the present invention can be obtained by obtaining a large amount of NP of SFTSV using an Escherichia coli expression system and then using the obtained NP as an antigen to induce an immune response in a mouse and to immunize the immune B- .

The genetic information used here is the NCBI (Genbank) registration number HQ141612.1 (SEQ ID NO: 3) which encodes a part of the S segment region of SFTSV HB29 isolated from China in 2011. This sequence encodes NS (non-structural) proteins in the forward direction at nucleotides 29-907 and encodes the NP protein in the reverse direction at positions 965-1702 nucleotides. Of these, 738 nucleotide nucleotide sequences encoding NP were used (SEQ ID NO: 2). This NP is a protein that is expressed in viral proteins that constitute virions and can be easily found in host cells, which can cause a strong cell-mediated immune response in an infected host.

In the present invention, recombinant DNA technology was used to express the NP site. The whole DNA encoding the NP amino acid sequence of SFTSV is inserted into a protein expression vector, and E. coli is transformed with the recombinant expression vector formed therefrom. The resulting transformed E. coli is cultured under appropriate conditions to express the DNA, It is possible to produce the NP through the separation step.

Using the NP thus produced as an antigen, an immune response is induced in a mouse, and immunodeficient immunoreactive B cells derived from an immunized mouse are fused with myeloma cells to generate hybridomas. Hybridomas selectively recognizing double NPs are selected And the hybridoma cell line of the present invention was completed.

According to another aspect of the present invention, the present invention provides a monoclonal antibody produced from the hybridoma cell line KCTC18332P.

The monoclonal antibody of the present invention shows immunoreactivity specifically to the NP of SFTSV having the amino acid sequence of SEQ ID NO: 1. Therefore, the SFTSV existing in the sample can be detected easily.

To facilitate detection of SFTSV, it is preferable to bind a detection labeling substance to the monoclonal antibody of the present invention. In this case, various known labeling substances can be applied as the detection label according to the condition of the antigen-antibody binding reaction, the state of the detection target sample, the visualization method of detection, and the like.

According to another aspect of the present invention, the present invention provides a diagnostic reagent for SFTSV infection, which comprises the above monoclonal antibody. As described above, the monoclonal antibody of the present invention exhibits immunoreactivity specifically to NP of SFTSV and can easily detect SFTSV. Therefore, when the antibody is applied as an antibody to a virus diagnosis reagent, a reagent capable of effectively diagnosing infection with SFTSV . The SFTSV infection diagnostic reagent of the present invention may further include an additive that can be included in an ordinary antibody detection reagent for virus detection, such as an auxiliary substance for confirming antigen-antibody binding and maintaining the activity of the antibody.

According to another aspect of the present invention, there is provided an SFTSV infection diagnostic kit comprising the SFTSV infection diagnostic reagent. The SFTSV infection diagnosis kit of the present invention includes a kit for collecting serum or a diagnostic reagent to be tested, a reagent or device for confirming antigen-antibody binding, an antibody for detecting the presence or absence of virus from a biological sample A device, or a reagent that can be included in the diagnostic kit of the present invention.

According to another aspect of the present invention, there is provided a method for preparing a solid support, comprising: fixing a diagnostic antigen to a solid support; Reacting a monoclonal antibody conjugated with a serum and a detection label of an animal to be tested with a diagnostic antigen immobilized on the solid support; Washing and removing the monoclonal antibodies that are not antigen-antibody bound to the diagnostic antigen; And measuring the level of the detection marker of the monoclonal antibody bound to the diagnostic antigen by the antigen-antibody, wherein the diagnostic antigen is a protein having the amino acid sequence of SEQ ID NO: 1, and the monoclonal antibody is selected from the hybridoma cell line KCTC18332P A method for providing information on the diagnosis of SFTSV infection characterized by being a monoclonal antibody produced.

The method of providing information on the diagnosis of SFTSV infection according to the present invention is to make the test serum and the diagnostic antibody competitively react with the antigen, and then determine whether the antibody against SFTSV exists in the test serum based on the concentration of the diagnostic antibody bound to the antigen How to check whether it is.

A method of directly detecting the binding between an antigen and an antibody present in a sample by adding an antibody to the sample may be used. However, since proper reaction conditions must be set according to the type of animal to be tested, . On the other hand, the method of the present invention can be applied to various kinds of animals to effectively diagnose SFTSV infection.

Using the monoclonal antibodies, hybridomas, diagnostic reagents, diagnostic kits or diagnostic methods of the present invention, the infection of SFTSV can be diagnosed safely, promptly and with high accuracy without being greatly affected by animal species. It is anticipated that SFTS can be prevented or delayed from livestock, pets, and wild animals that may be potential mediators of SFTSV, contributing significantly to public health and animal health.

Fig. 1 is a schematic diagram of an E. coli expression vector in which an NP gene of SFTSV is cloned.
Fig. 2 shows the result of overexpression and purification of NP used in the present invention (lane M: protein molecular weight size ladder, lane 1: whole protein of E. coli expressing recombinant NP, lane 2: 6 x histidine) Was confirmed by SDS-PAGE.
FIG. 3 is a graph showing the antigen binding of NP-specific monoclonal antibody (10G7 mAb) and rabbit polyclonal antibody (NP polyclonal Ab) used in the present invention and the anti-SFTSV polyclonal Ab (ProSci Inc., 1: 200) Immunostaining is the result of comparing antigen binding.
Fig. 4 shows immunostaining results showing antigen binding of the SFTSV-specific polyclonal antibody used in the present invention. Upper: FITC staining, lower: DAPI.
5 is a schematic diagram illustrating the principle of the SFTSV infection diagnosis method of the present invention.
FIG. 6 is a graph showing the degree of competition according to the concentration of SFTSV positive sera using the SFTSV infection diagnosis method of the present invention. FIG.

Hereinafter, the present invention will be described in more detail with reference to Examples. These embodiments are only for illustrating the present invention, and thus the scope of the present invention is not construed as being limited by these embodiments.

Example 1. NP gene cloning of SFTSV

The cDNA (SEQ ID NO: 3) of the nucleotide sequence of the S segment (NCBI accession number HQ141612) of SFTSV HB29 isolated in China was artificially synthesized by Bioneer (Korea), a domestic gene synthesis company. Among them, the nucleotide sequence encoding NP is 738 nucleotides corresponding to 965 to 1,702 of the S segment, and this sequence is shown in SEQ ID NO: 2.

PCR was performed to amplify the NP gene. For efficient binding to the protein expression vector, EcoRI was added at the 5'-end and HindIII was recognized at the 3'-end. And amplified using the primers shown in Table 1.

Primer sequence for NP gene amplification of SFTSV primer name sequence (5'-3 ') product size SF-NP-1 CTCGGAATTCACATGTCAGAGTGGTCC 735 bp (245 aa) SFTS-NP-735 CTTCAAGCTTCAGGTTCCTGTAAGCAG

PCR was carried out using a HotStar HiFidelity Polymerase Kit (QIAGEN, Germany). The PCR product was treated at 94 ° C for 5 minutes in the presence of the synthesized cDNA template, SF-NP-1 primer and SFTS-NP-735 primer, 30 sec at 58 [deg.] C for 45 sec, and 1 min at 72 [deg.] C for 25 cycles.

The PCR-amplified product is a synthetic gene encoding the nucleoside of SFTSV and has a cleavage site of EcoRI and HindIII. This was digested with EcoRI and HindIII and inserted into pET-30a (+), a protein expression vector. The pET-30a (+) / NP recombinant vector thus constructed has an Escherichia coli T7 promoter and is constructed so that six histidine-fused forms can be expressed. We confirmed the correct cloning using the gene sequence analysis service of Macrogen, the nucleotide sequence analysis company. The E. coli protein expression vector into which the NP gene is inserted is shown in Fig.

Example 2. NP expression and purification

BL21 (DE3), which is an Escherichia coli for expressing proteins, was transformed with the recombinant pET-30a (+) / NP vector and agitated at 25 ° C for 20 hours under the condition of 0.2 mM IPTG (Isopropyl-β-D-thio-galactoside) And cultured to overexpress NP. The culture was centrifuged at 2,500 rpm for 20 minutes. The supernatant was discarded and only the E. coli pellet was collected and suspended evenly in a solution of 20 mM sodium phosphate, 500 mM NaCl, 8 M Urea, 20 mM Imidazole (pH 7.4). After sonication, the overexpressed NP was purified using Ni-NTA Agarose (QIAGEN). Purified NP was buffer exchanged with 1 × PBS using Slide-A-Lyzer Dialysis Cassettes (Thermo). The protein expression pattern is shown in Fig.

Example 3. Production of monoclonal and polyclonal antibodies for the development of the SFTS antibody enzyme immunoassay

To prepare the monoclonal antibody, immunization was performed by intraperitoneally injecting 100 μg of each of the NPs into two mice (Balb / C mice), and the immunization was carried out four times in total. After the immune response, the degree of antigen binding of the NP polyclonal antibody in the mouse was confirmed by ELISA. Clones that specifically started to produce monoclonal antibodies with high antibody reactivity and only specific to NP protein were selected, and hybridoma cells were cultured in a large amount, followed by using an antibody in the medium. The antigen specificity of the monoclonal antibody was demonstrated by immunostaining as shown in Fig.

In order to obtain polyclonal positive serum of SFTSV, eight mice were immunized by intraperitoneal injection of 50 μg of inactivated SFTSV each for a total of three times. The degree of antigen binding of the SFTSV polyclonal antibody in the mice obtained after the immune response was confirmed by immunostaining (see FIG. 4).

The method of immunological staining of infected cells of SFTSV is as follows. Vero E6 cells cultured in 10% FBS and DMEM medium were washed with 1 × DPBS, and SFTSV of 10 MOI was inoculated into DMEM medium containing 2% FBS. After 7 days, the cells were collected on a multitest slide (12 well, Mp Biomedical) , Then fixed with acetone and stored at -20 ° C. After blocking with 5% horse serum in PBS, the primary antibody diluted 1:50 was treated in the same solution. Cells were washed with PBS and then diluted 1: 500 with Fluorescein-labeled antibody to mouse IgG (KPL, USA) and washed with PBS. Nuclei were stained with DAPI (4 ', 6-diamidino-2-phenylindole, dihydrochloride, Invitrogen, USA) and cells were observed using a Nikon ECLIPSE (TE2000-U, Japan) fluorescence microscope.

The characteristics of the monoclonal antibody-producing cell line for SFTSV NP selected through experiments are shown in Table 2.

Characterization of monoclonal antibodies against SFTSV Monoclonal antibody Isotype Western blot * Indirect immunohistochemistry * 10G7 IgG2a, kappa + +

*: Use of SFTSV infected cells.

Example 4. Binding of monoclonal antibody to HRP protein for competitive ELISA

IgG of the prepared monoclonal antibody was purified, and HRP (horseradish peroxidase) protein was conjugated.

For this, 2 ml of the medium containing the monoclonal antibody was buffer-exchanged with 1 × PBS using Slide-A-Lyzer Dialysis Cassettes (Thermo) and purified using Protein G Agarose Purification Kit (KPL, USA). After washing with 1 × PBS, protein G and IgG with 0.2 M Glycine (pH 3) were extracted and neutralized with 1.5 M Tris-Cl (pH 8.0). The extracted IgG was buffer exchanged with 40 mM HEPES (pH 8.4) and reacted with EZ-Link TMPlusactivated HRP (Thermo scientific, USA) to allow binding of HRP protein and IgG. 100 μl of NaBH ₄ solution (4 mg / ml) as a reducing agent was added to terminate the fusion reaction, followed by buffer exchange with 1 × PBS.

Example 5. Competitive ELISA method for diagnosis of SFTSV antibody

The competitive ELISA method developed for the diagnosis of SFTSV antibodies is shown in Fig.

1 μg / ml of NP antigen dissolved in 50 mM carbonate-bicarbonate buffer (pH 9.6) was coated on a 96 well ELISA plate (Polysorp; Nunc, Rochester, NY, USA) for 16 hours or longer at 4 ° C. The plates were washed twice with PBST (phosphate-buffered saline with 0.05% Tween 20) and blocked with PBST supplemented with 5% horse serum for one hour at room temperature. Samples and positive sera were diluted to 1/1, 1/2, 1/5, 1/10, 1/20, 1/100, 1/500 using Blocking Buffer, and then 50 쨉 l per well were dispensed. At the same time, the conjugate conjugated with HRP protein to the mAb was diluted to 1: 200, 1:50, and then added in an amount of 50 μl per well, followed by reaction at 37 ° C for 1 hour. After the reaction was completed, the ELISA plate was washed 5 times with PBST, and 100 μl of TrueBlue ™ Substrate (KPL, USA) was dispensed and color reaction was performed at 37 ° C for 20 minutes. After that, 1.25 M sulfuric acid solution was dispensed per 100 쨉 l per well to discontinue the color reaction and measure the absorbance at 450 nm. As a result of the reaction, the percent inhibition (PI) was calculated as PI = ((1- (test serum OD / negative serum OD)) 100). The results are shown in FIG. 6 and repeated three times.

Korea Biotechnology Research Institute KCTC18332P 20141007

<110> REPUBLIC OF KOREA (Management: Ministry of Agriculture, Food and Rural Affairs, Animal and Plant Quarantine Agency) <120> Production and application of a monoclonal antibody and the          development of a competitive enzyme-linked immunosorbent          assay (c-ELISA) for detection of severe fever with          thrombocytopenia syndrome virus (SFTSV) <130> PA140911-C01 <160> 3 <170> Kopatentin 2.0 <210> 1 <211> 245 <212> PRT <213> Severe Fever with Thrombocytopenia Syndrome Virus (SFTSV HB29) <400> 1 Met Ser Glu Trp Ser Arg Ile Ala Val Glu Phe Gly Glu Gln Gln Leu   1 5 10 15 Asn Leu Thr Glu Leu Glu Asp Phe Ala Arg Glu Leu Ala Tyr Glu Gly              20 25 30 Leu Asp Pro Ala Leu Ile Ile Lys Lys Leu Lys Glu Thr Gly Gly Asp          35 40 45 Asp Trp Val Lys Asp Thr Lys Phe Ile Ile Val Phe Ala Leu Thr Arg      50 55 60 Gly Asn Lys Ile Val Lys Ala Ser Gly Lys Met Ser Asn Ser Gly Ser  65 70 75 80 Lys Arg Leu Met Ala Leu Gln Glu Lys Tyr Gly Leu Val Glu Arg Ala                  85 90 95 Glu Thr Arg Leu Ser Ile Thr Pro Val Val Ala Gln Ser Leu Pro             100 105 110 Thr Trp Thr Cys Ala Ala Ala Ala Leu Lys Glu Tyr Leu         115 120 125 Gly Pro Ala Val Met Asn Leu Lys Val Glu Asn Tyr Pro Pro Glu Met     130 135 140 Met Cys Met Ala Phe Gly Ser Leu Ile Pro Thr Ala Gly Val Ser Glu 145 150 155 160 Ala Thr Thr Lys Thr Leu Met Glu Ala Tyr Ser Leu Trp Gln Asp Ala                 165 170 175 Phe Thr Lys Thr Ile Asn Val Lys Met Arg Gly Ala Ser Lys Thr Glu             180 185 190 Val Tyr Asn Ser Phe Arg Asp Pro Leu His Ala Ala Val Asn Ser Val         195 200 205 Phe Phe Pro Asn Val Val Arg Lys Trp Leu Lys Ala Lys Gly Ile     210 215 220 Leu Gly Pro Asp Gly Val Ser Ser Arg Ala Gla Val Ala Ala 225 230 235 240 Ala Tyr Arg Asn Leu                 245 <210> 2 <211> 738 <212> DNA <213> Nucleoprotein (NP) gene cDNA of SFTSV HB29 <400> 2 atgtcagagt ggtccaggat tgcagtggaa tttggtgagc agcagctcaa tttgactgag 60 cttgaggatt tcgcaagaga gctggcctat gaaggccttg atcctgctct gatcatcaag 120 aagctgaagg agacaggtgg agatgattgg gtgaaggata cgaagttcat cattgtcttt 180 gccctgactc gaggcaataa gatcgtcaag gcatcaggga aaatgtcaaa ctcagggtct 240 aagaggttga tggcactcca agagaaatat ggactggttg agagggcaga aaccaggctc 300 tcaatcactc ctgtgagggt agcgcagagc cttcccacct ggacatgtgc agcagcagca 360 gccttaaagg agtatctccc agtggggcca gccgtcatga acctgaaggt tgagaattat 420 ccccctgaga tgatgtgcat ggcctttgga tccctgattc caactgcggg ggtatctgaa 480 gccacgacca agaccctgat ggaggcctac tctctgtggc aagatgcctt caccaagacc 540 atcaatgtga agatgcgtgg agccagcaag acagaagttt acaactcctt cagggaccct 600 ctccatgcag ctgtgaactc tgtcttcttt cccaatgatg ttcgggtgaa gtggctgaag 660 gccaagggaa tccttggccc agatggggtc cccagcagag ctgctgaggt tgctgctgct 720 gcttacagaa acctgtaa 738 <210> 3 <211> 1744 <212> DNA <213> S segment cDNA of SFTSV HB29 (Genbank: HQ141612.1) <400> 3 acacaaagac ccccttcatt tggaaaccat gtcgctgagc aaatgctcca acgttgacct 60 caaatctgta gcaatgaatg ctaacactgt taggcttgag ccttccctgg gagagtaccc 120 cactcttagg agagacctcg ttgaatgctc ttgtagtgtg ttgactttgt caatggtcaa 180 gaggatgggc aagatgacca acacagtatg gttgtttggc aaccccaaaa atcctcttca 240 tcagcttgag cctggacttg agcagctgtt agacatgtac tacaaggaca tgaggtgcta 300 ctcccagaga gaactgagtg ctcttaggtg gcctagtggg aagccatctg tatggttcct 360 acaggcagct cacatgttct tctccatcaa gaacagctgg gcaatggaaa ccggaagaga 420 gaactggcgg ggcctcttcc acaggataac aaaaggccaa aagtatcttt ttgaagggga 480 catgatattg gattctcttg aagccataga gaagcgaaga cttagacttg ggttgcctga 540 gattctgata actggactat ccccaattct ggatgtggcc ctcctccaga tagagtcact 600 tgcaaggcta agaggcatga gcttgaacca ccacttgttc acttcttcct cattgcgtaa 660 gcctctgtta gactgttggg atttcttcat tcctatccgc aaaaagaaga cagatggctc 720 atacagtgtc ttggatgagg atgatgagcc tggggtcctc cagggttacc catatctgat 780 ggcacactat ttaaataggt gcccattcca caacctcatc aggtttgatg aagaactgag 840 aactgcagcc ctgaacacca tttggggaag agattggcca gccattggtg acctcccgaa 900 ggaggtctaa ttttgtcgaa ttggatcatg gaatttagcc taattggata tgtcaaattg 960 ctgcttacag gtttctgtaa gcagcagcag caacctcagc agctctgctg gggaccccat 1020 ctgggccaag gattcccttg gccttcagcc acttcacccg aacatcattg ggaaagaaga 1080 cagagttcac agctgcatgg agagggtccc tgaaggagtt gtaaacttct gtcttgctgg 1140 ctccacgcat cttcacattg atggtcttgg tgaaggcatc ttgccacaga gagtaggcct 1200 ccatcagggt cttggtcgtg gcttcagata cccccgcagt tggaatcagg gatccaaagg 1260 ccatgcacat catctcaggg ggataattct caaccttcag gttcatgacg gctggcccca 1320 ctgggagata ctcctttaag gctgctgctg ctgcacatgt ccaggtggga aggctctgcg 1380 ctaccctcac aggagtgatt gagagcctgg tttctgccct ctcaaccagt ccatatttct 1440 cttggagtgc catcaacctc ttagaccctg agtttgacat tttccctgat gccttgacga 1500 tcttattgcc tcgagtcagg gcaaagacaa tgatgaactt cgtatccttc acccaatcat 1560 ctccacctgt ctccttcagc ttcttgatga tcagagcagg atcaaggcct tcataggcca 1620 gctctcttgc gaaatcctca agctcagtca aattgagctg ctgctcacca aattccactg 1680 caatcctgga ccactctgac atgatcactc ctttgcgtct ttcctttttt gggggtcttt 1740 gtgt 1744

Claims (10)

A hybridoma cell line KCTC18332P that produces a monoclonal antibody that specifically binds to the nucleoprotein of Severe Fever with Thrombocytopenia Syndrome Virus (SFTSV), which is represented by the amino acid sequence of SEQ ID NO: 1, The hybridoma cell line KCTC18332P, which is characterized in that the monoclonal antibody has an isotype of mouse IgG2a.
A monoclonal antibody produced from the hybridoma cell line of claim 1, which specifically binds to the nuclear protein of the severe febrile platelet poor syndrome virus represented by the amino acid sequence of SEQ ID NO: 1 and has the isotype of mouse IgG2a , Monoclonal antibody.
A reagent for diagnosing a severe febrile platelet deficiency syndrome virus infection, which comprises the monoclonal antibody of claim 2.
A kit for diagnosing a severe febrile platelet deficiency syndrome virus infection comprising the reagent for diagnosing severe febrile thrombocytopenic syndrome virus infection according to claim 3, wherein said kit is a competitive-enzyme linked immunosorbent assay (c-ELISA) &Lt; / RTI &gt;
(a) immobilizing a diagnostic antigen on a solid support;
(b) competitively reacting the diagnostic antibody bound with the serum and the detection label of the animal to be tested against the fixed diagnostic antigen;
(c) washing and removing the serum and the diagnostic antibody of the animal to be tested which has not reacted with the fixed diagnostic antigen; And
(d) determining the detection label level of the diagnostic antibody reacted with the immobilized diagnostic antigen, and then determining whether the subject is infected with Severe Fever with Thrombocytopenia Syndrome Virus (SFTSV) and,
The diagnostic antigen is a nucleoprotein of SFTSV represented by the amino acid sequence of SEQ ID NO: 1,
The serum of the subject animal is derived from an animal suspected of being infected with SFTSV,
Wherein the subject animal is an animal other than a human,
The diagnostic antibody is a monoclonal antibody produced from a hybridoma cell line KCTC18332P, which is a monoclonal antibody that specifically binds to the nuclear protein of SFTSV represented by the amino acid sequence of SEQ ID NO: 1 and has an isotype of mouse IgG2a A method for diagnosing a severe febrile platelet-poor syndrome virus infection in an animal (but not a human) using a competitive-enzyme linked immunosorbent assay (c-ELISA).
6. The diagnostic method according to claim 5, wherein the subject animal is at least one selected from the group consisting of livestock, pets, and wild animals.
6. The diagnostic method according to claim 5, wherein the animal to be examined is at least one selected from the group consisting of sheep, cow, dog, pig, chicken and mouse.
[Claim 6] The method according to claim 5, wherein the detection marker level of the diagnostic antibody reacted with the diagnostic antigen immobilized in the step (d) is measured and then calculated as the percent inhibition (PI) value of the detection marker using the following equation And determining whether the subject animal is infected with SFTSV based on the value of the degree of inhibition of the detection label.
(%) = [(1- (target animal serum-detected label value / negative serum-detected label value derived from an animal not infected with SFTSV) x 100]
9. The method according to claim 8, wherein when the SFTSV concentration is increased in the serum of the subject animal, the inhibition value of the detection marker of the diagnostic antibody against the immobilized diagnostic antigen increases and the SFTSV concentration in the serum of the subject animal decreases Wherein the inhibition value of the detection label of the diagnostic antibody against the immobilized diagnostic antigen is decreased.
9. The diagnostic method according to claim 8, wherein when the detection label of the diagnostic antibody is horseradish peroxidase, the detection label value is an absorbance value.

Images