KR101773340B1 - Primer set for detecting Ralstonia solanacearum biovar 2, and detection method using the same - Google Patents

Abstract

The present invention relates to a method for the treatment of Ralstonia sp. solanacearum ) biovar 2 and a detection method using the same. The use of the above composition can specifically detect Potato Pomarum pathogen microbicide 2, which can significantly reduce the time and expense required for the lace and bioabsorbing method of the pathogenic microbes. In addition, rapid and accurate diagnosis of Pseudomonas aeruginosa can contribute to environmentally friendly control through cultivation of resistant cultivars.

Description

(Primer set for detecting Ralstonia solanacearum biovar 2, and detection method using the same)

The present invention relates to a method for the treatment of Ralstonia sp. The present invention relates to a composition for detecting biovar 2, to a method for detecting biofilm 2 of pathogenic fungus pathomycetes using the same, and to a PCR kit for detecting biofilm 2 of potato fungus pathogen.

Bacterial wilt (Brown rot) is a disease that spreads widely from the tropics to the temperate, with the leaves and stems of the plants coming out above the ground being green. Add more than 50 and more than 450 kinds of crops such as potatoes, tomatoes, bananas, peanuts, branches, peppers and tobacco. The pathogen is Ralstonia solanacearum, a germ-negative, aerobic strain with at least one unipolar pattern. Symptoms of foot blight begin with the young leaves beginning to grow, and the whole of the host is wilted as it progresses. In the environment where the disease is likely to occur, the diseased host rapidly develops the disease, and the entire host is dying in a green state after 2 to 3 days after the first symptoms appear. If the infection is delayed or the environment does not match the onset condition, the symptoms of wilting do not appear, but the browning of the tuber of the potato tuber is decolored and the tuber tuber rotates brown during storage. It spreads through the infected tubers. In the unfavorable environment, it does not show the symptoms of wilting and it is latent in the tubers.

Ralstonia solanacearum, a pathogenic bacterium of foot-worm, survives in the rhizosphere of plants and invades through host wounds. It can survive for 4-5 years in diseased residues and penetrates to 70-80 cm in soil. The Ralstonia Solanacea room can be classified according to two classification systems.

First, race 1, 3, entering into crops or weeds, potato, cigarette, etc., depending on host range. Race 2, entering into bananas, race 3, mainly entering potatoes and tomatoes, race 4, breaking into mulberries, 5. The temperature and high soil humidity are important for the development of this disease, especially temperature, which has a significant effect on the onset. Race 1 has a high growth temperature of 32 ~ 34 ℃ and the lower the temperature, the lower the growth. On the other hand, race 3, which occurs only in potatoes and tomatoes, is the first to occur in the Andes region of South America. The optimum temperature for growth is 28 ~ 30 ℃, but the growth tends to become more active as temperature decreases.

Another classification system is classified into five biovars (ecological types) according to the use of three disaccharides (maltose, lactose, cellobiose) and three hexahydric alcohols (mannitol, sorbitol, dulcitol). Biovar 1 when three disaccharides and three hexahydric alcohols are not used as a carbon source, but using biovar 2, three disaccharides and three hexahydric alcohols when three disaccharide alcohols are not used In the case of biovar 3, three disaccharides are not used, but biovar 4 is used when three hexahydric alcohols are used, and biovar 5 is used when all three disaccharides are used and mannitol among three hexahydric alcohols is used (Non-patent Document 1 and Non-Patent Document 2). In Korea, race 1 (biovar 4) and race 3 (biovar 2) were found to exist in southern region and Jeju Island. The relationship between race and biovar is not relevant except for the relationship between race 3 and biovar 2, and there are many variation points between race and biovar.

Foot blight is one of the most important diseases in many parts of the world because it is difficult to control when it is caused by soil infectious disease and it is damaging. In Korea, since the occurrence in Jeju Island in 1998, it has recently become a serious problem because of the increased incidence in the potato cultivation zone in Yeonghongnam area. Therefore, much research has been conducted to develop a rapid diagnosis method of potato foot blight, and a patent for detecting a pathogenic pathogen (patent document 1) is also disclosed. However, there is a need for more accurate and rapid detection of specific race, specific bioflavonoid pathogens.

Thus, the present inventors have completed the present invention by producing a primer specific to potato Pomarum pathogen biotech 2.

Korean Patent Publication No. 2008-0095394

  He LY, Sequeira L & Kelman A. 1983. Characteristics of strains Pseudomonas solanacearum form China. Plant Disease. 67: 1357-1361.  Cho et al, Research in Plant Disease, Vol.17, no.2, pp.184-190 (2011)

SUMMARY OF THE INVENTION The object of the present invention is to provide a method for treating Ralstonia spp. solanacearum biovar 2 detection method.

Another object of the present invention is to provide a method for treating Ralstonia spp. solanacearum ) bioba 2 detection method.

It is another object of the present invention to provide a method for treating Ralstonia < RTI ID = 0.0 > solanacearum ) biovar 2 detection kit.

One embodiment of the present invention relates to a method of treating Ralstonia < RTI ID = 0.0 > solanacearum ) biovar 2, and more particularly to a primer set comprising the nucleotide sequence of SEQ ID NOS: 1 and 2; And a primer set consisting of the nucleotide sequences of SEQ ID NOS: 3 and 4, and a set of primers selected from the group consisting of Ralstonia solanacearum ) biovar 2.

As used herein, the term " Ralstonia & Solanacearum "is a pathogenic bacterium of the bacterial wilt or brown rot which can be classified according to two classification systems. Specifically, it can be classified into five kinds of race according to the host range, (Bioavar) can be classified into five types of biovar depending on whether three different saccharides (maltose, lactose, cellobiose) and three hexahydric alcohols (mannitol, sorbitol, dulcitol) The composition according to one embodiment of the present invention is characterized in that the composition of Ralstonia solanacearum bioba (R) is used as a carbon source, and three types of disaccharides are used as a carbon source, (biovar) 2 can be specifically detected.

The primer set consisting of the nucleotide sequences of SEQ ID NOS: 1 and 2 can specifically detect the gene consisting of the nucleotide sequence of SEQ ID NO: 5 and can produce an amplification product of 366 bp when PCR is performed.

The primer set consisting of the nucleotide sequences of SEQ ID NOS: 3 and 4 can specifically detect the gene consisting of the nucleotide sequence of SEQ ID NO: 6 and can produce an amplification product of 700 bp when PCR is performed.

The composition according to this embodiment may include a primer set consisting of the nucleotide sequences of SEQ ID NOS: 1 and 2, respectively, or a set of primers consisting of the nucleotide sequences of SEQ ID NOS: 3 and 4, and may include both of the two sets of primers .

As used herein, the term "primer " refers to a single-stranded oligonucleotide sequence complementary to a nucleic acid strand to be copied, and may serve as a starting point for the synthesis of a primer extension product. The length and sequence of the primer should allow the synthesis of the extension product to begin. The specific length and sequence of the primer will depend on the primer usage conditions such as temperature and ionic strength, as well as the complexity of the desired DNA or RNA target. Oligonucleotides used as primers can also include nucleotide analogs such as phosphorothioates, alkylphosphorothioates or peptide nucleic acids or they can contain an intercalating agent ). Preferably, the primer is a deoxyribonucleotide and is a single strand. The primers used in the present invention may include naturally occurring dNMPs (i.e., dAMP, dGMP, dCMP and dTMP), modified nucleotides or non-natural nucleotides. In addition, the primers may also include ribonucleotides.

The primers used in the present invention include a hybridization nucleotide sequence complementary to the target nucleic acid. The term "complementary" means that under certain annealing or hybridization conditions the primer or probe is sufficiently complementary to hybridize selectively to the target nucleic acid sequence and is substantially complementary and perfectly complementary , And preferably means completely complementary.

In addition, another embodiment of the present invention relates to a method of treating Ralstonia < RTI ID = 0.0 > solanacearum ) bioba 2 detection method, and more specifically,

1) extracting DNA from the sample;

2) preparing at least one primer set selected from the group consisting of a primer set consisting of the nucleotide sequences of SEQ ID NOs: 1 and 2 and a set of primers consisting of the nucleotide sequences of SEQ ID NOs: 3 and 4;

3) performing PCR (polymerase chain reaction) using the extracted DNA of step 1) as a template and using the primer set of step 2); And

4) detecting the amplification product generated by the PCR of step 3); and detecting the amplified product by Ralstonia solanacearum ) biovar 2 detection method.

The sample of step 1) above is a sample of Ralstonia < RTI ID = 0.0 > solanacearum ) Bioba 2 can be detected. Specifically, the sample can be a potato ( Solanum tuberosum L.), tomato ( Lycopersicon esculentum ), red pepper ( Capsicum annuum L.), branches ( Solanum melongena ), tobacco ( Nicotiana tabacum L.), and paprika ( Capsicum annuum var. angulosum ), and may be, for example, a potato, but is not limited thereto.

In the above step 2), the primer set consisting of the nucleotide sequences of SEQ ID NOS: 1 and 2 can specifically detect the gene consisting of the nucleotide sequence of SEQ ID NO: 5; The primer set consisting of the nucleotide sequences of SEQ ID NOS: 3 and 4 can specifically detect a gene comprising the nucleotide sequence of SEQ ID NO: 6.

In the step 2), either one of primer sets consisting of the nucleotide sequences of SEQ ID NOS: 1 and 2 or a nucleotide sequence of SEQ ID NOS: 3 and 4 can be prepared, or both primer sets can be produced.

The PCR in the above step 3) may be a PCR (polymerase chain reaction) or a multiplex PCR. Specifically, PCR may be performed using a pair of primer sets. In the case of using two sets of primers simultaneously, ) PCR, but is not limited thereto.

The PCR in the step 3) may be performed at an annealing temperature of 58 to 62 ° C, preferably at an annealing temperature of 60 ° C, but is not limited thereto. The PCR reaction conditions can be performed under ordinary conditions. For example, the initial denaturation may be performed once at 96 ° C for 5 minutes, followed by denaturation (96 ° C for 15 seconds), annealing (60 ° C), and annealing (15 sec.) And extension (72 sec. At 30 sec.) For a total of 25 cycles, followed by a final expansion reaction at 72 for 5 min. For example, the primer set consisting of the nucleotide sequences of SEQ ID NOS: 1 and 2 and the primer set consisting of the nucleotide sequences of SEQ ID NOS: 3 and 4 may all be the same annealing temperature at 60 ° C during PCR, The detection efficiency can be excellent.

Wherein the amplification product of step 4) comprises an amplification product of 366 bp amplified by a primer set consisting of the nucleotide sequences of SEQ ID NOS: 1 and 2; A 700 bp amplification product amplified by a primer set consisting of the nucleotide sequences of SEQ ID NOS: 3 and 4; Or the 366 bp and 700 bp amplification products.

In one embodiment of the present invention, PCR was carried out by using the two primer sets simultaneously or individually, and as a result, only the potato pharmerm pathogen biobar 2 was specifically detected (Figs. 3 to 5). In addition, it was confirmed that the pathomatic pathomycetes collected from foreign countries were not amplified, so that it was found that only the bio-bar 2 foot-dried pathogens collected in Korea could be specifically detected (FIG. 6).

The term "amplification reaction" as used herein refers to a reaction to amplify a nucleic acid molecule. A variety of amplification reactions have been reported in the art, including polymerase chain reaction (PCR) (US Pat. Nos. 4,683,195, 4,683,202 and 4,800,159), reverse-transcription polymerase chain reaction (RT-PCR) (Sambrook et al., Molecular Cloning. (LCR) (see, for example, A Laboratory Manual, 3rd Ed. Cold Spring Harbor Press (2001)), Miller, HI (WO 89/06700) and Davey, C. et al (EP 329,822) 17,18), Gap-LCR (WO 90/01069), repair chain reaction (EP 439,182), transcription-mediated amplification (TMA) 19 (WO 88/10315) (US Ser. No. 6,410, 276), self-sustained sequence replication (20) (WO 90/06995), selective amplification of target polynucleotide sequences (U.S. Patent No. 6,410,276), consensus sequence priming polymerase chain The consensus sequence primed polymerase chain reaction (CPPCR) (U.S. Patent No. 4,437,975), random (US Pat. Nos. 5,413,909 and 5,861, 245), nucleic acid sequence based amplification (NASBA) (U.S. Patent No. 5,130,238, 5,409,818, 5,554,517 and 6,063,603), strand displacement amplification (21,22) and loopmediated isothermal amplification (21,22). (LAMP) 23, but is not limited thereto. Other amplification methods that may be used are described in U.S. Patent Nos. 5,242,794, 5,494,810, 4,988,617 and U.S. Patent No. 09 / 854,317.

Yet another embodiment of the present invention provides a PCR kit for detection of Ralstonia solanacearum biovar 2 comprising the above composition.

The PCR kit may further comprise a PCR reaction mixture. The PCR reaction mixture may include any of well-known in the art and include, but is not limited to, dNTPs, DNA polymerases and buffers, and the like.

The use of the composition according to one embodiment of the present invention can specifically detect the potato footmilk pathogen bioba 2, thereby greatly reducing the time and expense required for the lace and bioabsorbing method of the pathogenic bacteria . In addition, rapid and accurate diagnosis of Pseudomonas aeruginosa can contribute to environmentally friendly control through cultivation of resistant cultivars.

FIG. 1 is a diagram showing a base sequence and a primer position (red) of a gene amplified by the 18890 F and R primer sets according to an embodiment of the present invention.
FIG. 2 is a diagram showing a base sequence and a primer position (red) of a gene amplified by the 18920 F and R primer sets according to an embodiment of the present invention.
FIG. 3 is a diagram showing the results of PCR amplification using the 18890 F and R primer sets according to an embodiment of the present invention.
4 is a diagram showing the results of PCR amplification using 18920 F and R primer sets according to an embodiment of the present invention.
FIG. 5 is a diagram showing the results of multiple PCR amplification using 18890 F and R primer sets and 18920 F and R primer sets simultaneously according to an embodiment of the present invention.
FIG. 6 is a diagram showing the results of multiple PCR amplification using 18890 F and R primer sets and 18920 F and R primer sets simultaneously according to an embodiment of the present invention.

Hereinafter, the present invention will be described in more detail in the following Examples. It should be noted, however, that the following examples are illustrative only and do not limit or limit the scope of the present invention. It will be understood by those of ordinary skill in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims.

< Example  1> Potato Foot sprout pathogen Biobar  2 specific primer  making

Potato Parmerm's pathogen ( Ralstonia Solanacearum ). A primer specific to Biobar 2 was prepared.

Specifically, genome sequencing of Ralstonia solanacearum SL2029 (race 3, biovar 2) causing potato wilt disease was conducted. The CLgenomics ver. (GMI1000, CFBP2957, CMR15, FQY_4, Po82 and PSI07) and SL2029, which were previously sequenced, were analyzed by using the 1.51 program. Based on the comparison of nucleotide sequence analysis, 300 genes that exist only in SL2029 were selected. Among the 300 selected genes, gene size of 200 bp or less was excluded. We then used NCBI's BLASTX and BLASTN programs to select genes that are not homologous to other pathomycetes. After selecting the last two genes out of homologous genes, primers specific to the selected genes were prepared (Table 1). The gene sequences specifically detected by the 18890 F and R primer sets are shown in SEQ ID NO: 5, and the gene sequences and the positions of the primers are shown in Fig. In addition, the gene sequence specifically detected by the 18920 F and R primer sets is shown in SEQ ID NO: 6, and the gene sequence and the positions of the primers are shown in FIG.

SEQ ID NO: designation primer  Kinds The base sequence (5 '- &gt; 3') PCR  Product size (bp) One 18890 F Forward ATGAACGTCGCCTTCGCCTA 366
2 18890 R Reverse TCATGTCTGCACCCTCTGGA 3 18920 F Forward ATGCTGGCTAAGGGCGTCCA 700
4 18920 R Reverse GCGACTCGACGTTCGTTAGC

< Example  2> One primer  Using a set PCR  black

In order to confirm whether each of the primers prepared in Example 1 specifically detected the potato footmarum pathogen biotechnology 2, PCR was carried out using widely collected pathogenic pathogens in Korea. Table 2 shows the types of Pseudomonas aeruginosa used in the experiment.

For PCR reaction, 1 μl of gDNA, 10 pmol of primer, 5 × Go Taq Flexi Buffer, 25 mM MgCl ₂ , 0.2 mM each dNTP and 2.5 units of Go Taq DNA polymerase (Promega, USA) The final total volume was 50 ul.

PCR amplification was performed using a C1000 Touch Thermal Cycler (BioRad, USA). The initial thermal denaturation reaction was performed at 96 ° C for 5 minutes and 25 cycles at 96 ° C for 15 seconds, 60 ° C for 15 seconds, and 72 ° C for 30 seconds Respectively. The final expansion reaction was carried out at 72 ° C for 5 minutes.

As a result of PCR analysis using primers 18890 F and R and 18920 F and R, respectively, only 16 strains of Biobar, including SL 2029 (race 3, biovar 2), were found to be specific (FIGS. 3 and 4).

< Example  3> 2 primer  Multiple simultaneous sets PCR  black

Multiplex PCR was carried out using the two primer sets prepared in Example 1 to confirm whether bio-bar 2 of Pseudomonas aeruginosa can be accurately detected and discriminated. The kinds of the Pseudomonas aeruginosa used in the experiment were the same as those used in Example 2.

PCR reaction solution 1 ul of gDNA, 10 pmol 18890 F and R primers, 18920 F and R primers, 5 pmol, 5X Go Taq Flexi Buffer , 25 mM MgCl 2, of 0.2 mM each dNTP, 2.5 unit of Go Taq DNA Polymerase (Promega, USA) was added and sterilized water was added to make a final total volume of 50 μl.

PCR amplification was performed using a C1000 Touch Thermal Cycler (BioRad, USA). The initial thermal denaturation reaction was carried out at 96 ° C for 5 minutes, and at 25 cycles of 96 ° C for 15 seconds, 60 ° C for 15 seconds, and 72 ° C for 30 seconds Respectively. The final expansion reaction was carried out at 72 ° C for 5 minutes.

As a result of multiplex PCR analysis using the primers 18890 F and R produced with 18990 F and R, only 16 strains of Biobar, including SL 2029 (race 3, biovar 2), among the domestic pathogenic pathogens in Korea, Specific amplification (Fig. 5).

< Example  4> Potatoes Foot sprout pathogen Biobar  2 detection specificity test

In order to confirm the detection specificity of a primer set prepared in Example 1, Bio-Bar 2 domestic foot diamond pathogens 16 strain, foreign foot diamond pathogens four strains, janto Pseudomonas (Xanthomonas) in 6 strains, Pseudomonas (Pseudomonas) in Multiple PCR was performed on 9 strains. Table 3 shows the types of strains used in the experiments. The multiplex PCR conditions were the same as in Example 3 above.

As a result, it was confirmed that only 2 strains of 16 strains of P. aeruginosa pathobacteria including Pseudomum tuberculosis SL2029 (race 3, biovar 2) were specifically amplified. In addition, it was confirmed that the pathomatic pathomycetes (17 to 20 strains) collected from foreign countries such as Indonesia and Cyprus were not amplified, so that it was possible to easily and quickly distinguish the bio-bar 2 of the putnamarum pathogen collected in Korea (FIG. 6) .

<110> Republic of Korea <120> Primer set for detecting Ralstonia solanacearum biovar 2, and          detection method using the same <130> P15R12D1210 <160> 6 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 18890 F <400> 1 atgaacgtcg ccttcgccta 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 18890 R <400> 2 tcatgtctgc accctctgga 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 18920 F <400> 3 atgctggcta agggcgtcca 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 18920 R <400> 4 gcgactcgac gttcgttagc 20 <210> 5 <211> 366 <212> DNA <213> Ralstonia solanacearum <400> 5 atgaacgtcg ccttcgccta tcgcatcgac ggccgcggcc gcaccgccga ggcggagaac 60 gatgacgcgc acctgcgcga cctgatcgag cagcttctct tcaccatgcc gggcgaacgc 120 gtgaaccggc cggatttcgg ctgcggcctg atgcagctgg tgtttgcgct aaacagcacc 180 gagctggccg cgaccgtgca ggcgctggtg caaggcgcgc tgcagcaatg gctgggccac 240 ctgatgcgca tcgacgaggt cagtgccgcc gccgccgatg cgacgctcac cgtcagcgtg 300 cgctacacgg tgctgcgcac gcaggcttcg aagatcgcca gcttcgtcca gagggtgcag 360 acatga 366 <210> 6 <211> 1143 <212> DNA <213> Ralstonia solanacearum <400> 6 atgctggcta agggcgtcca gctcagcctg ctgatcgggc cggtcattcc ggtgccggtg 60 ccgcgcatcg tgctggatgc gctcgacagc gtcgaggtgc gcacagccgc cggcagcgcg 120 agcggctttc agctgaagtt ccagatcacg gcgcgctcgg agctgaatac gatcttcctg 180 atcgcggccg gcaccaacac ctcgatggcg acgccgccgc tgcgcgtgat gttgatcgtc 240 acgctgaacg gcacgccgca gcccctgttc gacggcgtga tgacgaatgt cgatgtgcag 300 gccggcagcc aggggcagcc cggcacgttg acggtcaccg gcgaagacgt caccaaggtg 360 atggacatgc aggacttcag cggcctgccc ttccctgcga tgcccgtcga ggcccgcgtc 420 gcgctgctgt gcgcgaagta cgcggcgttc ggcgtgatcc cgctgccggt tccgatcctg 480 ttccccgacg tgcagatccc gatcgacaag attcccgcgc agcaaggcac cgacctgcaa 540 tacatccagg agctggcgcg ccaggtcggc tacgtgttct acatcgaacc ggggccgacg 600 ccgggcacca acatcgcgta cttcgggcca gagatcaagg ttggcgtgcc gcagccggcg 660 ctgaacatcg acatggacgc gctaacgaac gtcgagtcgc tgaatttctc gttcgacccg 720 accaagggcg tgctgccggt ggtgttcatc cagaacccgc tcacgcgggt gccgatcccg 780 atcccgattc cgaacctgaa cccgctgcag ccgccgctcg gcgcgctgcc gacgccgatc 840 tcgaacctga agatcctgaa ggacaccgcg aagctgaacc cgatgcaggc gatctcgcgc 900 gggctggcgg aagccgcgaa gtcccaggac gcggtgaccg gccacggcgg cctgaatgtg 960 ctgcgctacg ggcgcgtact gaaagcgcgt ggactggtcg gcgtgcgcgg cgcgggcgtc 1020 gcctacgacg gtctctacta cgtgcagagc gtgaccagca cgctcaagcg cggcgagttc 1080 aagcagagct tcagcctcac gcgcaacgga ctcgtgtcga tcacccccag ggtgcctgta 1140 tga 1143

Claims (9)

A primer set consisting of the nucleotide sequences of SEQ ID NOS: 1 and 2; And SEQ ID NO: 3 and a primer set comprising the nucleotide sequences of the 4; domestic comprising at least one primer set selected from the group consisting of potato pathogens foot diamond (Ralstonia solanacearum) Bio bar (biovar) 2 detecting composition. 2. The method according to claim 1, wherein the primer set consisting of the nucleotide sequences of SEQ ID NOS: 1 and 2 specifically detects a gene comprising the nucleotide sequence of SEQ ID NO: 5; And the primer set consisting of the nucleotide sequences of SEQ ID NOS: 3 and 4 specifically detects the gene consisting of the nucleotide sequence of SEQ ID NO: 6. The present invention also relates to a method for detecting the biovar 2 detection of Ralstonia solanacearum , / RTI &gt; 1) extracting DNA from the sample;
2) preparing at least one primer set selected from the group consisting of a primer set consisting of the nucleotide sequences of SEQ ID NOs: 1 and 2 and a set of primers consisting of the nucleotide sequences of SEQ ID NOs: 3 and 4;
3) performing PCR (polymerase chain reaction) using the extracted DNA of step 1) as a template and using the primer set of step 2); And
Domestic potato foot diamond pathogens (Ralstonia solanacearum) Bio bar (biovar) 2 detection method comprising a; 4) detecting the amplification product generated by PCR performed in the step 3). Sample, wherein step 1) according to claim 3, wherein the potato (Solanum tuberosum L.), tomatoes ( Lycopersicon esculentum ), peppers ( Capsicum annuum L.), branches ( Solanum melongena ), tobacco ( Nicotiana tabacum L.) and paprika ( Capsicum annuum var. angulosum ). 4. The method according to claim 3, wherein the primer set consisting of the nucleotide sequences of SEQ ID NOS: 1 and 2 specifically detects a gene comprising the nucleotide sequence of SEQ ID NO: 5; And the primer set consisting of the nucleotide sequences of SEQ ID NOS: 3 and 4 specifically detects the gene comprising the nucleotide sequence of SEQ ID NO: 6. [4] The method according to claim 3, wherein the PCR in step 3) is selected from the group consisting of PCR (polymerase chain reaction) and multiplex PCR. 4. The detection method according to claim 3, wherein the PCR in step 3) is performed at an annealing temperature of 58 to 62 占 폚. 4. The method according to claim 3, wherein the amplification product of step 4) comprises an amplification product of 366 bp amplified by a primer set consisting of the nucleotide sequences of SEQ ID NOs: 1 and 2; A 700 bp amplification product amplified by a primer set consisting of the nucleotide sequences of SEQ ID NOS: 3 and 4; Or the 366 bp and 700 bp amplification product. A PCR kit for detecting biovar 2 of a domestic potato pathomaru pathogen ( Ralstonia solanacearum ) comprising the composition of claim 1.

Images