KR101762250B1 - Use of LRIG2 for Diagnosis or Treatment of Cancer - Google Patents
Use of LRIG2 for Diagnosis or Treatment of Cancer Download PDFInfo
- Publication number
- KR101762250B1 KR101762250B1 KR1020150108251A KR20150108251A KR101762250B1 KR 101762250 B1 KR101762250 B1 KR 101762250B1 KR 1020150108251 A KR1020150108251 A KR 1020150108251A KR 20150108251 A KR20150108251 A KR 20150108251A KR 101762250 B1 KR101762250 B1 KR 101762250B1
- Authority
- KR
- South Korea
- Prior art keywords
- gene
- lrig2
- endometrial cancer
- protein
- composition
- Prior art date
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/5011—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing antineoplastic activity
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57407—Specifically defined cancers
- G01N33/57411—Specifically defined cancers of cervix
Abstract
The present invention relates to the use of LRIG2 for the treatment or diagnosis of cancer. In particular, the present invention relates to a pharmaceutical composition for preventing or treating endometrial cancer, which comprises an LRIG2 (leucine-rich repeats and immunoglobulin-like domains 2) gene or a protein encoded by the gene as an active ingredient, A biomarker, a composition for diagnosing endometrial cancer, a kit for diagnosing endometrial cancer, and a method for screening a therapeutic agent for endometrial cancer.
Description
The present invention relates to the use of LRIG2 for the treatment or diagnosis of cancer.
Endometrial carcinoma is the most common gynecologic cancer, and when treated with young endometrial cancer, progesterone hormone therapy is selectively administered to preserve the possibility of pregnancy. However, the molecular basis for the effect of progesterone in these endometrial cancers is unknown.
On the other hand, Lrig2 (leucine-rich repeats and immunoglobulin-like domains 2), one of the Lrig family of transmembrane leucine-rich repeat proteins, is known to negatively regulate some carcinogenic receptor tyrosine kinases And has been found to be overexpressed in the uterus of mice. In addition, one of the Lrig family, Lrig1, is presented as a tumor suppressor, and its expression has been shown to be reduced in other tumor types.
A way to understand the molecular basis of cancer and develop effective therapies is to find the difference in gene expression between cancer cells and normal cells. Methods based on the assumption that steady - state mRNA levels differ between normal and malignant cells are used to find genes that are differentially expressed.
Among them, RNA interference (RNAi) is a very specific and efficient mechanism for suppressing gene expression. This is a mechanism in which a sense strand having a sequence homologous to the mRNA of a target gene and an antisense strand having a sequence complementary thereto (DsRNA) is introduced into a cell or the like to induce degradation of the mRNA of the target gene, thereby suppressing the expression of the target gene.
In addition, nanoparticles have been used as a promising tool in biomedical fields such as drug delivery, gene transfer, intracellular imaging, and phototherapy. In particular, gold nanomaterials have been used for a wide variety of applications including synthesis and ease of action, chemical stability, , And adjustable optical and electrical properties.
Thus, the present inventors confirmed the role of the Lrig2 gene in cancer using these molecular biological tools.
The present inventors have made an effort to develop a method for treating endometrial cancer. As a result, the present inventors confirmed the expression of Lrig2 in the endometrial cancer cell line treated with progesterone, which is used as a treatment for endometrial cancer hormone, and confirmed that the overexpression of Lrig2 reduced the viability of the endometrial cancer cell line The present invention has been completed.
Accordingly, it is an object of the present invention to provide a pharmaceutical composition for preventing or treating endometrial cancer.
Another object of the present invention is to provide a biomarker for diagnosing endometrial cancer.
It is still another object of the present invention to provide a composition for diagnosing endometrial cancer.
It is still another object of the present invention to provide a biomarker for the diagnosis of endometrial cancer.
Still another object of the present invention is to provide a kit for the diagnosis of endometrial cancer.
It is still another object of the present invention to provide a screening method for treating endometrial cancer.
According to one aspect of the present invention, there is provided a method for preventing endometrial cancer comprising an LRIG2 (leucine-rich repeats and immunoglobulin-
The most remarkable feature of the present invention is that the pharmaceutical composition of the present invention activates apoptosis of endometrial cancer cells by using LRIG2 gene or protein thereof as an active ingredient to specifically suppress the growth of endometrial cancer cells, To prevent or treat endometrial cancer.
The LRIG2 protein is preferably a protein encoded by the LRIG2 (leucine-rich repeats and immunoglobulin-like domains 2) gene of NCBI GenBank Gene ID 9860, though not particularly limited thereto.
According to a preferred embodiment of the present invention, the present invention provides a pharmaceutical composition for preventing or treating endometrial cancer, which comprises an LRIG2 gene-containing expression vector or a mammalian cell transduced with the expression vector as an active ingredient do.
The present invention can provide an expression vector for gene therapy expressing LRIG2. The expression vector is preferably a non-viral vector or a viral vector, and the viral vector may be an adenovirus vector, a retrovirus vector including a lentivirus, an adeno-associated virus vector, Herpes-simplex virus vector.
The present invention can provide a cell line into which the above expression vector has been transduced. In this case, the cell line is preferably a normal cell line or a cancer cell line, though not particularly limited thereto.
In addition, the pharmaceutical composition of the present invention further includes a pharmaceutically acceptable carrier, though not particularly limited thereto.
The pharmaceutically acceptable carriers to be contained in the pharmaceutical composition of the present invention are those conventionally used in the present invention and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, But are not limited to, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrups, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. It is not. The pharmaceutical composition of the present invention may further contain a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, etc., in addition to the above components. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington ' s Pharmaceutical Sciences (19th ed., 1995).
The pharmaceutical composition of the present invention can be administered orally or parenterally, preferably parenterally, and in the case of parenteral administration, it can be administered by intravenous injection, subcutaneous injection, local injection, muscle injection or the like.
The appropriate dosage of the pharmaceutical composition of the present invention may vary depending on such factors as formulation method, administration method, age, body weight, sex, pathological condition, food, administration time, route of administration, excretion rate, . On the other hand, the dosage of the pharmaceutical composition of the present invention is preferably 0.0001-100 mg / kg (body weight) per day.
The pharmaceutical composition of the present invention may be formulated into a unit dosage form by using a pharmaceutically acceptable carrier and / or excipient according to a method which can be easily carried out by those having ordinary skill in the art to which the present invention belongs. Or by intrusion into a multi-dose container. The formulations may be in the form of solutions, suspensions or emulsions in oils or aqueous media, or in the form of excipients, powders, granules, tablets or capsules, and may additionally contain dispersing or stabilizing agents.
According to another aspect of the present invention, there is provided a gene encoding a leucine-rich repeats and immunoglobulin-like domains 2 (NCBI GenBank Gene ID: 9860) gene or a protein encoded by the gene, Is inhibited in the endometrial cancer diagnosis.
As used herein, the term " diagnosis " means identifying the presence or characteristic of a pathological condition. For the purpose of the present invention, the diagnosis is to confirm the onset of endometrial cancer.
As used herein, the term "diagnostic biomarker, diagnostic marker, or diagnostic marker" is a substance that can differentiate endometrial cancer cells from normal cells and is capable of detecting endometrial cancer An organic biomolecule such as a polypeptide or a nucleic acid (for example, mRNA) showing a suppression pattern in a cell, a lipid, a glycolipid, a glycoprotein, a sugar (monosaccharide, a disaccharide, an oligosaccharide etc.), and the like.
For the purpose of the present invention, the endometrial cancer diagnosis marker is a gene which is expressed by LRIG2 (leucine-rich repeats and immunoglobulin-like domains 2) gene or a protein encoded by the gene and whose expression is inhibited in endometrial cancer cells. The selection and application of diagnostic markers that are significant in diagnosis determines the reliability of diagnostic results. Significant diagnostic markers are those markers that are highly reliable with high validity and consistency in repeated measurements. The endometrial cancer diagnosis markers of the present invention show the same results in repeated experiments with genes whose expression is always suppressed as a direct or indirect factor together with the onset of endometrial cancer, and the difference in expression level is very large when compared with the control group They are highly reliable markers with little chance of giving false results. Therefore, the diagnosis result based on the result of measuring the expression level of the significant diagnostic marker of the present invention can be reasonably reliable.
According to another aspect of the present invention, the present invention includes an agent for measuring the gene expression level of LRIG2 (leucine-rich repeats and immunoglobulin-
The gene expression level or protein expression level encoded by the gene is measured from a biological sample of a patient suspected of endometrial cancer.
As used herein, the term "biological sample" refers to a tissue sample, cell, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid or urine, which is differentiated from LRIG2 gene or protein expression level by the endometrial cancer marker Samples, and the like.
According to a preferred embodiment of the present invention, the agent for measuring the gene expression level comprises an antisense oligonucleotide, a primer pair or a probe that specifically binds to the mRNA of the gene.
That is, the level of gene expression in the biological sample can be confirmed by confirming the amount of mRNA.
In the present invention, the 'mRNA expression level measurement' measures the amount of mRNA by detecting the presence and expression level of the endometrial cancer marker gene in the biological sample in order to diagnose endometrial cancer. RT-PCR, competitive RT-PCR, real-time RTPCR, RNase protection assay (RPA), Northern analysis Northern blotting, DNA chips, and the like.
According to a preferred embodiment of the present invention, the agent for measuring the protein expression level comprises an antibody, a peptide or a nucleotide which specifically binds to the protein.
In the present invention, the 'measurement of protein expression level' is a process of confirming the presence and expression level of a protein expressed from a endometrial cancer marker gene in a biological sample in order to diagnose endometrial cancer. Preferably, The amount of the protein can be confirmed by using an antibody specifically binding to the protein.
Methods for this analysis include Western blot, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion, rocket, But are not limited to, immunoelectrophoresis, immunohistochemistry, immunoprecipitation assays, complement fixation assays, fluorescence activated cell sorters (FACS), protein chips, and the like. .
The present invention can provide an endometrial cancer diagnostic marker composition comprising a primer sequence specific for LRIG2 gene (forward primer of SEQ ID NO: 1: AAATGCAGCGGAATGGAATTAGC, reverse primer of SEQ ID NO: 2: CCCCTTGTTTACTCGTGTAAGGT).
The term "primer " of the present invention means a short nucleic acid sequence capable of forming a base pair with a complementary template with a short free 3-terminal hydroxyl group and functioning as a starting point for template strand replication.
Primers can initiate DNA synthesis in the presence of reagents and four different nucleoside triphosphates for polymerization reactions (i. E., DNA polymerase or reverse transcriptase) at appropriate buffer solutions and temperatures. The primer of the present invention is a sense and antisense nucleic acid having 7 to 50 nucleotide sequences as a marker gene-specific primer. Primers can incorporate additional features that do not alter the primer's basic properties that serve as a starting point for DNA synthesis.
The primers of the present invention can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences may also be modified using many means known in the art. Non-limiting examples of such modifications include, but are not limited to, methylation, "capping ", substitution of one or more natural nucleotides into homologues, and modifications between nucleotides, such as uncharged linkers such as methylphosphonate, phosphotriester, (E.g., phosphoramidate, carbamate, etc.) or charged linkages (e.g., phosphorothioate, phosphorodithioate, etc.). The nucleic acid can be in the form of one or more additional covalently linked residues such as a protein such as a nuclease, a toxin, an antibody, a signal peptide, a poly-L-lysine, an intercalator such as acridine, ), Chelating agents (e.g., metals, radioactive metals, iron, oxidizing metals, etc.), and alkylating agents. The nucleic acid sequences of the present invention can also be modified using labels that can directly or indirectly provide a detectable signal. Examples of labels include radioactive isotopes, fluorescent molecules, biotin, and the like.
In addition, the present invention can provide an endometrial cancer diagnostic marker composition comprising an antibody specific for the protein of LRIG2 gene.
In the present invention, "antibody" means a specific protein molecule directed against an antigenic site. The antibody refers to an antibody that specifically binds to a marker protein, and includes both a polyclonal antibody, a monoclonal antibody, and a recombinant antibody.
Since the endometrial cancer marker protein has been identified as described above, the production of an antibody using the endometrial cancer marker protein can be easily performed using techniques well known in the art.
Polyclonal antibodies can be produced by methods well known in the art for obtaining sera containing antibodies by injection of the above endometrial cancer marker protein antigen into an animal and blood sampling from the animal. Such polyclonal antibodies can be prepared from any animal species host, such as goats, rabbits, sheep, monkeys, horses, pigs, small dogs, and the like.
Monoclonal antibodies can be obtained from the hybridoma method (see Kohler and Milstein (1976) European Journal of Immunology 6: 511-519), or the phage antibody library (Clackson et al, Nature, 352: 624 Biol., 222: 58, 1-597, 1991) techniques. The antibody prepared by the above method can be separated and purified by gel electrophoresis, dialysis, salt precipitation, ion exchange chromatography, affinity chromatography, and the like.
The antibodies of the present invention also include functional fragments of antibody molecules as well as complete forms with two full-length light chains and two full-length heavy chains. A functional fragment of an antibody molecule refers to a fragment having at least an antigen binding function, and includes Fab, F (ab ') 2, F (ab') 2 and Fv.
According to another aspect of the present invention, there is provided a kit for diagnosing endometrial cancer comprising the composition for diagnosing endometrial cancer according to the present invention.
According to a preferred embodiment of the present invention, the kit is an RT-PCR kit, a DNA chip kit or a protein chip kit.
In addition, the endometrial cancer diagnostic kit may further comprise one or more other component compositions, solutions, or devices suitable for the assay method.
For example, the diagnostic kit may include a diagnostic kit including essential elements necessary for performing a reverse transcription-polymerase reaction. The RT-PCR kit contains the respective primer pairs specific for the marker gene. The primer is a nucleotide having a sequence specific to the nucleic acid sequence of each marker gene, and has a length of about 7 bp to 50 bp, more preferably about 10 bp to 30 bp. It may also contain a primer specific for the nucleic acid sequence of the control gene. Other reverse transcription polymerase reaction kits may be used in combination with test tubes or other appropriate containers, reaction buffers (varying in pH and magnesium concentration), deoxynucleotides (dNTPs), enzymes such as Taq polymerase and reverse transcriptase, DNAse, RNAse inhibitor DEPC DEPC-water, sterile water, and the like.
In addition, the kit may be a diagnostic kit comprising essential elements necessary for performing a DNA chip. The DNA chip kit may include a substrate to which a cDNA or oligonucleotide corresponding to a gene or a fragment thereof is attached, and reagents, preparations, enzymes, and the like for producing a fluorescent-labeled probe. The substrate may also comprise a cDNA or oligonucleotide corresponding to a control gene or fragment thereof.
In addition, the kit may be a diagnostic kit characterized by comprising essential elements necessary for performing ELISA. ELISA kits contain antibodies specific for the marker protein. Antibodies are monoclonal antibodies, polyclonal antibodies or recombinant antibodies with high specificity and affinity for each marker protein and little cross reactivity to other proteins. The ELISA kit may also include antibodies specific for the control protein. Other ELISA kits can be used to detect antibodies that can bind a reagent capable of detecting the bound antibody, such as a labeled secondary antibody, chromophores, an enzyme (e. G., Conjugated to an antibody) Other materials, and the like.
In another aspect, the present invention provides a method for providing information for diagnosing endometrial cancer using the endometrial cancer diagnostic composition or the endometrial cancer diagnostic kit.
For example, the present invention provides a method for diagnosing endometrial cancer, comprising: measuring mRNA levels from a biological sample of a suspected endometrial cancer patient using a primer specific for the LRIG2 gene; And comparing the mRNA level with a mRNA level of a normal control sample. The present invention also provides a method for providing information for diagnosing endometrial cancer.
The process of separating mRNA from a biological sample can be carried out using known processes, and the level of mRNA can be measured by various methods.
Through these detection methods, it is possible to compare the amount of mRNA expression in the normal control group and the mRNA expression level in the suspicious endometrial cancer patients, and to determine whether the expression level of mRNA in the endometrial cancer marker gene is increased, It is possible to diagnose the actual endometrial cancer of the suspected patient.
Measurement of mRNA expression level is preferably performed using a reverse transcriptase polymerase reaction method or a DNA chip using a primer specific to a gene used as an endometrial cancer marker.
The above reverse transcriptase-polymerase reaction can be confirmed by the electrophoresis after the reaction and the band pattern and the thickness of the band can be confirmed, so that the expression level and mRNA expression level of the gene used as a marker for endometrial cancer diagnosis can be confirmed and compared with the control group, It is possible to easily diagnose the occurrence. On the other hand, a DNA chip uses a DNA chip in which a nucleic acid corresponding to the endometrial cancer marker gene or a fragment thereof is attached to a glass-like substrate at a high density. The DNA chip separates the mRNA from the sample and labels the end or inside thereof with a fluorescent substance CDNA probes can be prepared and hybridized to DNA chips to detect the onset of endometrial cancer.
The present invention also relates to a method for detecting an LRIG2 protein, comprising contacting an antibody specific to LRIG2 protein with a biological sample of a patient suspected of endometrial cancer to confirm the protein level by forming an antigen-antibody complex, The method comprising the steps of:
The process of separating proteins from biological samples can be carried out using known processes and protein levels can be measured by various methods.
Analysis methods for measuring protein levels include Western blotting, ELISA, radioimmunoassay, radial immunodiffusion, Oucheroton immunodiffusion, rocket immunoelectrophoresis, tissue immuno staining, immunoprecipitation assay, complement fixation assay, FACS, Protein chips, and the like.
Through these analytical methods, it is possible to compare the amount of antigen-antibody complex formed in the normal control group and the amount of antigen-antibody complex formed in the suspected endometrial cancer patients, and the expression level of the protein from the endometrial cancer marker gene Of the endometrial cancer in the endometrial cancer patients by judging whether the actual endometrial cancer can be diagnosed.
The term " antigen-antibody complex " as used herein refers to a combination of an endometrial cancer marker protein and an antibody specific thereto, and the amount of the antigen-antibody complex formed is quantitatively determined through the size of a signal of a detection label It is measurable.
Such detection labels may be selected from the group consisting of enzymes, chromophores, ligands, emitters, microparticles, redox molecules, and radioisotopes, but are not necessarily limited thereto. When an enzyme is used as the detection label, available enzymes include? -Glucuronidase,? -D-glucosidase,? -D-galactosidase, urease, peroxidase or alkaline phosphatase, acetylcholine Glucoamylase, terazo, glucose oxidase, hexokinase and GDPase, RNase, glucose oxidase and luciferase, phosphofructoketase, phosphoenolpyruvate carboxylase, aspartate aminotransferase, phosphoenolpyruvate decar ≪ / RTI > beta-lactamase, and the like. The minerals include, but are not limited to, fluorescein, isothiocyanate, rhodamine, picoeriterine, picocyanin, allophycocyanin, o-phthaldehyde, fluororescamine and the like. Ligands include, but are not limited to, biotin derivatives. Emitters include, but are not limited to, acridinium esters, luciferin, luciferase, and the like. Fine particles include, but are not limited to, colloidal gold, colored latex, and the like. Redox molecules include ferrocene, ruthenium complex compounds, Biology hydrogen, quinone, Ti ions, Cs ions, diimide, 1,4-benzoquinone, hydroquinone, K4 W (CN) 8, [Os (bpy) 3] 2+, [RU (bpy) 3] 2+ , [MO (CN) 8] 4-, and the like.
Measurement of protein expression levels is preferably performed using an ELISA method. ELISAs include direct ELISA using labeled antibodies that recognize the antigen attached to the solid support, indirect ELISA using labeled antibodies that recognize the capture antibody in a complex of antibodies recognizing the antigen attached to the solid support, A direct sandwich ELISA using another labeled antibody that recognizes an antigen in the complex of antibody and antigen, a method of reacting with another antibody recognizing an antigen in a complex of an antibody and an antigen attached to a solid support, Indirect sandwich ELISA using a secondary antibody, and various ELISA methods. More preferably, the antibody is attached to a solid support, the sample is reacted, and the labeled antibody recognizing the antigen of the antigen-antibody complex is adhered to produce an enzyme, or an antibody that recognizes the antigen of the antigen-antibody complex Is detected by a sandwich ELISA method in which a labeled secondary antibody is attached and the enzyme is developed. The extent of complex formation between the endometrial cancer marker protein and the antibody can be checked to confirm the onset of endometrial cancer.
In addition, preferably, Western blotting using one or more antibodies against the endometrial cancer marker is used.
The whole protein is separated from the sample, electrophoresed, the protein is separated according to the size, and then transferred to the nitrocellulose membrane to react with the antibody. The amount of the protein produced by the expression of the gene can be confirmed by confirming the amount of the antigen-antibody complex produced by using the labeled antibody to confirm the onset of endometrial cancer. The detection method comprises a method of examining the expression level of a marker gene in a control group and the expression level of a marker gene in a cell in which endometrial cancer has developed. The level of mRNA or protein may be expressed as the absolute (e.g., [mu] g / ml) or relative (e.g., the relative intensity of the signal) difference of the marker protein. Preferably, immunohistological staining is performed using one or more antibodies against the endometrial cancer marker.
In addition, preferably, one or more antibodies against the endometrial cancer markers are arranged at predetermined positions on the substrate to use protein chips immobilized at a high density. A method of analyzing a sample using a protein chip is a method of separating a protein from a sample, hybridizing the separated protein with a protein chip to form an antigen-antibody complex, reading the protein, It is possible to confirm the onset of endometrial cancer.
According to still another aspect of the present invention, the present invention provides a screening method of a therapeutic agent for endometrial cancer comprising the steps of:
(a) culturing cells transfected with LRIG2 (leucine-rich repeats and immunoglobulin-
(b) treating the cell with a candidate substance for increasing or inhibiting the expression of the protein encoded by the gene; And
(c) comparing the level of expression of said gene in said treated cells with a control.
The present invention relates to a method for culturing a cell in which up-regulated expression of a gene of the above-mentioned gene is cultured, treating the cell with an expression-suppressing or expression-increasing candidate substance and then treating the endometrial cancer diagnostic marker (protein, mRNA ) Expression level of the endometrial cancer-associated protein in the presence or absence of the endometrial cancer-associated protein.
Preferably, for screening, a method using a primer or a probe may be used as the degree of mRNA expression of an endometrial cancer diagnostic marker. Among them, RT-PCR is preferable. The therapeutic agent for endometrial cancer which reduces or increases the expression of the diagnostic marker as compared with the control can be selected and used for the treatment of endometrial cancer.
The method of the present invention determines the effectiveness of a therapeutic agent using the biomarkers described above, so redundant descriptions are omitted in order to avoid undue complexity of the present disclosure.
The invention also provides a method of producing an animal carcinoma model comprising the steps of:
(a) injecting cancer cells into an animal;
(b) preparing an AuNP-αRNA I-AS LRIG2 conjugate;
(c) injecting the conjugate of step (b) into the animal of step (a).
The present invention provides a method for efficiently producing an animal carcinoma model by targeting a specific gene with an AuNP-αRNA I-AS LRIG2 conjugate in order to further promote and increase the growth of cancer cells, thereby regulating the expression level.
In the present invention, the specific gene is an LRIG2 gene, and the suppression of the expression of the gene increases the growth of cancer cells.
Inhibition of the expression of the gene may be detected by siRNA (small interference RNA), shRNA (short hairpin RNA), miRNA (microRNA), ribozyme, DNAzyme, PNA (peptide nucleic acids) Antisense oligonucleotides, antibodies, aptamers, natural extracts, and chemicals.
More preferably an antisense oligonucleotide that binds specifically to the mRNA of the gene, an aptamer, a small interference RNA (siRNA), a short hairpin RNA (shRNA), or a miRNA (microRNA), most preferably an siRNA or an antisense oligonucleotide to be.
As used herein, the term "siRNA" refers to a small RNA fragment of 21-25 nucleotides in size produced by cleavage of a double-stranded RNA by a dicer and specifically binds to an mRNA having a complementary sequence to inhibit expression It says. For the purpose of the present invention, the expression of the gene is specifically inhibited by specifically binding to LRIG2 mRNA. siRNA can be chemically or enzymatically synthesized. The method for producing siRNA is not particularly limited, and methods known in the art can be used.
In the present invention, the siRNA is 5'-CUGAUACCGUCAGCCAACA-3 '(SEQ ID NO: 3) and 5'-UGUUGGUGACGGUAUCAG-3' (SEQ ID NO: 4).
As used herein, the term "antisense oligonucleotide" is a base sequence complementary to and inhibiting expression of the miRNA, including, but not limited to, antisense RNA, antisense DNA and antagonist mRNA.
The antisense oligonucleotide is used to make a conjugate of the invention as an antisense DNA sequence for LRIG2 (AS LRIG2).
According to a preferred embodiment of the present invention, the AuNP-αRNA I-AS LRIG2 conjugate of step (b) is described in SEQ ID NO: 5.
The AuNP-αRNA I-AS LRIG2 conjugate is a complex formed by binding an antisense sequence (AS LRIG2) to LRIG2 with a gold nanoparticle (AuNP).
In the present invention, the term "nanoparticle " means particles of various materials having a diameter of nano unit, and the nanoparticles are not particularly limited as long as they are nanoparticles.
In the present invention, the term "gold nanoparticle" refers to gold metal particles having a diameter of nano unit. Such a small particle size facilitates penetration of the nanoparticles of the present invention into a target cell, Enables penetration.
The term "alpha RNA I" used in referring to the conjugate in the present invention refers to a specific sequence serving to link the AuNP (gold particle) with AS LRIG2, and the sequence is included in the sequence described in SEQ ID NO:
That is, the AuNP-αRNA I-AS LRIG2 conjugate of the present invention (SEQ ID NO: 5: CGCTAGCAGAGCCGAGATTGTTGGCTGACGGTATCAG) is a complex composed of (i) gold particles (AuNP) + (ii) (Iii) an antisense sequence (AS LRIG2) for LRIG2 which is a target gene.
According to the present invention, it is possible to prevent or treat endometrial cancer by specifically inhibiting the growth of endometrial cancer cells by activating apoptosis of endometrial cancer cells using the LRIG2 gene or a protein thereof as an active ingredient .
Figure 1 shows the LRIG2-induced effect of cell death. Figure 1 A shows the transformation of Hec-1A and Ishikawa cells with LRIG2-GFP-encoding plasmids (50 or 100 ng) or siRNA. The cells were analyzed after 24 hours of transformation. Figure 1b shows the results of flow cytometric analysis of annexin V-positive apoptotic cells. Figure 1c shows activation of
Figure 2 shows LRIG2-induced cell death regulated by the BCL-2 family. Figure 2a shows Western blot analysis of the BCL-2 family in Hec-1A cells. Figure 2b shows the transformation of wild-type and knockout MEF cells for bak - / -, bax - / - and bax - / - / bak - / - with increased amounts of LRIG2-GFP, Cell viability was measured. Figure 2c shows co-transformation of Hec-1A cells with LRIG2-GFP and MCL-1 and cell viability after 24 hours of transformation.
Figure 3 shows LRIG2, which stops the cell cycle in Hec-1A. FIG. 3A shows the results of flow cytometry analysis of the cell cycle after transformation with LRIG2-GFP or LRIG2-specific siRNA. FIG. 3B shows the result of Western blot analysis using anti-p21 antibody to confirm the regulation of p21 protein expression by LRIG2 protein.
Figure 4 shows the effect of LRIG2 on cell cycle regulation by cell death and AKT signaling signaling. FIG. 4A shows the results of measuring the survival rate of Hec-1A cells transformed with LRIG2-GFP and treated with DMSO, LY294002, U0126, AG490 or SP600125 for 24 hours. FIG. 4B shows the results of measuring the cell cycle of Hec-1A cells transformed with LRIG2-GFP and treating the cells with LY294002. FIG. 4C shows the results of measuring the protein expression of Hec-1A cells transformed with LRIG2-GFP and treating the cells with LY294002.
Figure 5 shows reduced LRIG2 expression in endometrial cancer tissues. FIG. 5A shows the result of immunoprecipitation analysis using anti-LRIG2 antibody after preparing the same amount of protein extracted from FFPE tissue of normal endometrium (n = 10) and endometrial cancer tissue (n = 10). FIG. 5B shows a comparison of the levels of LRIG2 protein expression between normal endometrium and endometrial cancer.
Figure 6 shows that the size of the tumor is increased on the non-bovine LRIG2 knockdown state. Figure 6a schematically shows the synthesis of scrambled siRNA and functionalized AuNPs conjugated to LRIG2. Figure 6b shows the size of each tumor (mm 3 ) (length x width 2 x pi / 6) after injecting AuNP-RNAI-Scrambled siRNA and AuNP-RNAI-LRIG2 into the xenografts of the mice for 4 weeks Figure 6c shows the result of measuring the tumor weight at the time of sacrifice (after 30 days of transplantation) Data are expressed as mean ± SEM and asterisk indicates statistical significance compared to the corresponding control (n = 6, respectively) Figure 6d shows the results of Western blot analysis of the protein levels of LRIG2 in the tumor. The actual size of a representative tumor is shown.
It will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the spirit or scope of the present invention as defined by the appended claims. It will be obvious to you.
Experimental Methods and Materials
Cell culture and reagents
Endometrial adenocarcinoma cell line, Hec-1A (ATCC, Manassas, VA) and Ishikawa cell (Dae-Shik Suh) were cultured in McCoy'5A modified medium and DMEM / F12 (Dulbecco's modified Eagle? Medium / F12). Mouse embryo fibroblasts (MEFs) of bax - / -, bak - / -, bax - / -, bak - / - (bax knockout, bak knockout, bax / And wild-type cells were obtained from CB Thompson (University of Pennsylvania, PA, USA) and cultured in DMEM (Dulbecco's modified Eagle? Medium) medium. The medium contained 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. The reagents used for cell culture were purchased from Caisson Laboratories. Anti-LRIG2 antibodies were purchased from Abcam.
Plasmid Construct
Plasmids encoding LRIG2-GFP were obtained from Hakan Hedman (Umea University, Sweden).
RNA interference
Endogenous LRIG2 was amplified using a specific oligonucleotide (Bioneer) of 5'-CUGAUACCGUCAGCCAACA-3 '(SEQ ID NO: 3) and 5'-UGUUGGUGACGGUAUCAG-3' (SEQ ID NO: 4), and 5'-CCUACGCCACCAAUUUCGU -3 'and 5'-ACGAAAUUGGUGGCGUAGG-3' were used as a control group. Sense and antisense oligonucleotides are annealed in the presence of an annealing buffer (Bioneer).
Cell survival rate
50-100 ng of LRIG2-GFP plasmid and 100 nM of siRNA and 200 nM were transfected into Hec-1A cells, Ishikawa cells and MEFs cells (1 x 10 4 ) using MicroPorator MP-100 (Digital Bio Technology) . Twenty-four hours after transfection of Hec1-A and Ishikawa cells, cell viability was measured using the CellTiter-Glo assay kit (Promega) according to the manufacturer's instructions.
Annexin For V-positive cells Flow cell Analysis of Measurement Method (Flow cytometry analysis)
As previously reported (Kim JH, oncogene), anexin V-positive cell apoptotic cells were detected.
Cytochrome ( Cytochrome ) c emission
Using MicroPorator MP-100, Hec-1A cells (1 x 10 7 ) were transfected with LRIG2-GFP or a public vector plasmid. Using the digitonin-based method (Kim JH, oncogene) already disclosed by the present inventors, the cytoplasmic and heavy membrane fractions were separated and Western blot was analyzed with appropriate antibodies.
Western Blot analysis
Hec-1A (2 x 10 6 ) cells were transfected with 3 μg of pEGFP-N1 and LRIG2-GFP plasmids using MicroPorator MP-100. Twenty-four hours after transfection, cell lysates were prepared using NP-40 (Sigma) lysis buffer and SDS-PAGE was performed for immunoblotting with equal amounts of whole antibodies. Membranes were detected using ChemiDoc TM XRS + System Imager (Bio-Rad Laboratories). Relative expression (%) was calculated based on the protein concentration of immunoprecipitates, as determined by OptiQuant software (Bio-Rad Laboratories).
Cell cycle analysis
Cell cycle analysis was detected, such as the KIM JH (Journal of Reproduction and Development).
Human endometrial tissue
A formalin-fixed paraffin-embedded (FFPE) block section (10 μm thick) of endometrial tissues obtained from 10 patients with endometrial cancer obtained from 10 patients with endometrial cancer and 10 patients with control uterine fibroids Respectively. This section was reviewed by a pathologist and obtained from the Bio-Resource Center of Asan Medical Center, Seoul.
Protein extraction of human endometrial tissue and Immune sedimentation
Total protein was extracted from FFPE normal endometrial and endometrial cancer tissue sections. FFPE tissue protein extracts were extracted using Qproteome FFPE tissue kit (Qiagen) according to the manufacturer's instructions. Total protein was immunoprecipitated.
Conjugate Produce
- Preparation of nanoparticles
Citrate-stabilized gold nanoparticles (13 nm) and oligonucleotide-functionalized particles were prepared according to the previously disclosed method (Jae-Hong Kim, Chem. Commun., 46, 4151-4153 , 2010; Rosi et al., 2006; Ryou et al., 2010).
- AuNP -αRNA I-AS LRIG2 Conjugate Produce
The AuNP-alpha RNA I-AS LRIG2 conjugate, a complex of siRNA sequences for LRIG and gold nanoparticles bound according to methods known in the art, was prepared as follows.
The AuNP-RNAI-AS LRIG2 carrier used in the present invention was prepared by binding a specific RNAI sequence to Gold colloid-15 nm (# EM.GC15) purchased from BBI Life Science, UK and containing a binding sequence complementary to the RNAI sequence LRIG2 antisense sequence. As an example, LRIG2 antisense DNA of 0.8 mM concentration was incubated in gold nanoparticles conjugated with 10 nM RNAI for 10 minutes at a temperature of 55 ° C. in 0.3 M NaCl buffer. After that, the supernatant was removed by centrifugation at 13,000 × g. The resulting AuNP-RNAI-LRIG2 antisense complex was directly injected into the tumor (~ 0.1 cm 3) as a carrier.
Animal studies
Hec-1A cells (2 x 10 6 ) were injected subcutaneously into BALB / c nu / nu immunodeficient 6 week old mice (Charles River Laboratories International, Inc., Japan) weighing 18-20 g. After 12 days of tumor cell transplantation, a control suspension suspended in PBS or an AuNP-aRNA I-AS LRIG2 conjugate (SEQ ID NO: 5) was injected every 2 days into the implanted tumor site. The weight of each mouse and the size of the tumor were measured daily. At 18 days after the first injection of the conjugate, the tumor-transplanted mice were sacrificed and the tumor was excised and measured.
Statistical analysis
Student-Newman-Keuls test (SAS) was used to perform multiple comparisons of values and Student? Test was used. The data were expressed as mean ± SEM, and p < 0.05 was considered statistically significant.
Example One: LRIG2 Induced by BAX - and BAK -Dependent mitochondrial cell death
The present inventors confirmed an increase in the expression of Lrig2 when treated with progesterone, which is used as an endometrial cancer hormone therapy, in endometrial cancer cell lines.
Thus, in order to investigate the function of LRIG2 in endometrial cancer cell lines, the present inventors analyzed survival rate of cancer cells. The results are shown in Fig.
Ectopic-expression of LRIG2 decreased cancer cell viability (Fig. 1A) and increased annexin V-positive cells (Fig. 1B).
In addition, to confirm whether LRIG2-mediated cell death was a caspase-dependent apoptotic response, activation of
In addition, we further investigated mitochondrial membrane integrity as an intermediate mediator capable of activating LRIG2-induced caspases. After overexpression of LRIG2, cytochrome c was released into the cytoplasm (Fig. 1d).
On the other hand, to confirm whether the pro- and anti-apoptotic components of the BCL-2 family are involved in determining cell death caused by LRIG2, we evaluated the protein level of the BCL-2 family (Fig. 2A). As a result, when overexpression of LRIG2, the expression of MCL-1, which is known as an anti-apoptotic gene, was decreased and the expression of BAX, BAK, which is known as a pro-apoptotic gene, was increased. It was confirmed that when LRIG2 was knocked down, the opposite tendency was shown.
In addition, the present inventors evaluated cell death responses in bax - / -, bak - / -, and bax / bak - / - MEF cells, respectively. LRIG2-induced cell death was completely blocked in bax-, bak- and bax / bak- deficient cells (Fig. 2b).
In addition, when MCL-1 is co-expressed with LRIG2, cell survival is reduced compared to LRIG2 alone (FIG. 2c).
These results indicate that BAX, BAK and MCL-1 are important mediators of LRIG2-induced cell death.
Example 2: LRIG2 Identify the abnormal cell cycle of protein
We overexpressed LRIG2 in Hec-1A cells and analyzed cell populations at different stages of the cell cycle by flow cytometry.
As shown in FIG. 3A, LRIG2 overexpression increased cell populations at the G0 / G1 stage whereas LRIG2 knockdown decreased cell populations at the G0 / G1 stage.
We also examined the protein level of p21, an important CDK (cyclin-dependent kinase) inhibitor that inhibits cell cycle progression by LRIG2. As shown in FIG. 3B, LRIG2 overexpression increased p21 expression, whereas LRIG2 knockdown decreased p21 expression.
Example 3: LRIG2 On by Cell death And AKT Signal transmission Signaling Confirmation of cell cycle regulation through
As shown in FIG. 4B, it was confirmed that LRIG2 overexpression arrests the cell cycle of G0 / G1 phase, but not after the AKT inhibitor (LY294002) treatment after LRIG2 overexpression.
Example 4: endometrial cancer In patients Down-regulated LRIG2 Confirmation of expression of
The molecular and cellular experimental results of the present invention suggest that LRIG2 is important for apoptosis of endometrial cancer cells. The present inventors investigated the expression of LRIG2 in endometrial cancer patients. Immunoprecipitation analysis shows clear expression of LRIG2 protein in endometrial tissue. Expression levels of LRIG2 were low or not detected in endometrial cancer tissues (Figures 5a and 5b).
Example 5: Tumor associated with inhibition of endometrial tumor growth As an inhibitor LRIG2
Based on these results, we confirmed whether siLRIG2 was successfully transferred into xenograft tumors using AuNP-DNA conjugates. Figure 6A shows this process.
Similar to the in vitro cell culture results, the size of the xenograft tumor injected with the AuNP-αRNA I-AS LRIG2 conjugate was significantly larger than the size of the tumor injected with the control conjugate (FIG. 6b). In addition, the weight of the tumor injected with the AuNP-αRNA I-AS LRIG2 conjugate was significantly increased by 46.9% (FIG. 6C). The present inventors confirmed Western blotting of LRIG2 expression of xenograft tumors injected with AuNP-αRNA I-AS LRIG2. The expression ratio of LRIG2 was decreased in AuNP-αRNA I-AS LRIG2 than in AuNP-αRNA I-AS control (FIG. 6d).
<110> THE ASAN FOUNDATION
CHUNG ANG University industry Academic Cooperation Foundation
<120> Use of LRIG2 for Diagnosis or Treatment of Cancer
<130> ASAN1-119
<160> 5
<170> Kopatentin 2.0
<210> 1
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> LRIG2 forward primer
<400> 1
aaatgcagcg gaatggaatt agc 23
<210> 2
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> LRIG2 reverse primer
<400> 2
ccccttgttt actcgtgtaa ggt 23
<210> 3
<211> 19
<212> RNA
<213> Artificial Sequence
<220>
<223> LRIG2 siRNA
<400> 3
cugauaccgu cagccaaca 19
<210> 4
<211> 18
<212> RNA
<213> Artificial Sequence
<220>
<223> LRIG2 siRNA
<400> 4
Claims (10)
(a) culturing cells transfected with LRIG2 (leucine-rich repeats and immunoglobulin-like domains 2, NCBI GenBank Gene ID: 9860) gene;
(b) treating the cell with a candidate substance for increasing or inhibiting the expression of the protein encoded by the gene; And
(c) comparing the level of expression of said gene in said treated cells with a control.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020150108251A KR101762250B1 (en) | 2015-07-30 | 2015-07-30 | Use of LRIG2 for Diagnosis or Treatment of Cancer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020150108251A KR101762250B1 (en) | 2015-07-30 | 2015-07-30 | Use of LRIG2 for Diagnosis or Treatment of Cancer |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| KR20170015715A KR20170015715A (en) | 2017-02-09 |
| KR101762250B1 true KR101762250B1 (en) | 2017-08-14 |
Family
ID=58154452
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| KR1020150108251A KR101762250B1 (en) | 2015-07-30 | 2015-07-30 | Use of LRIG2 for Diagnosis or Treatment of Cancer |
Country Status (1)
| Country | Link |
|---|---|
| KR (1) | KR101762250B1 (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2022528045A (en) * | 2019-03-20 | 2022-06-08 | グッド ティー セルズ、 インコーポレイテッド | Composition for the prevention or treatment of cranial nerve system diseases |
| GB202016022D0 (en) * | 2020-10-09 | 2020-11-25 | Academia Sinica | Nanoparticle for anti-cancer peptides and uses thereof |
-
2015
- 2015-07-30 KR KR1020150108251A patent/KR101762250B1/en active IP Right Grant
Non-Patent Citations (1)
| Title |
|---|
| Camilla Holmlund et al., Gene, Vol. 332, pages 35-43 (2004년 공개)* |
Also Published As
| Publication number | Publication date |
|---|---|
| KR20170015715A (en) | 2017-02-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP2020022469A (en) | Methods and assays relating to circulating tumor cells | |
| KR101463182B1 (en) | Novel Biomarkers Indicative of Pancreatic Cancer Using Pancreatic Cancer Stem Cell Characteristics and Using Their Uses | |
| US9587239B2 (en) | Methods of identifying and treating glioblastoma | |
| JP2009507515A (en) | Marker for cancer diagnosis and method thereof | |
| EP2744917A2 (en) | Methods and compositions for the treatment and diagnosis of breast cancer | |
| KR101762250B1 (en) | Use of LRIG2 for Diagnosis or Treatment of Cancer | |
| KR101133243B1 (en) | Use of eIF3m for the Diagnosis and Treatment of Cancer | |
| US9274117B2 (en) | Use of SIRT7 as novel cancer therapy target and method for treating cancer using the same | |
| KR20110107768A (en) | Nlk as a marker for the diagnosis of hepatocellular carcinomas and as a therapeutic agent thereof | |
| JP2010508811A (en) | Diagnostic composition for hepatocellular carcinoma, diagnostic kit for hepatocellular carcinoma comprising the same, and diagnostic method for hepatocellular carcinoma | |
| JPWO2015137406A1 (en) | A method for differential evaluation of squamous cell lung cancer and lung adenocarcinoma | |
| KR20170052454A (en) | Biomarker composition for predicting sensitivity of sorafenib | |
| KR102055350B1 (en) | Biomarker for Diagnosis of Anticancer drug Resistance of Colon Cancer and Uses thereof | |
| KR102025005B1 (en) | Biomarker for early diagnosis of hepatocellular carcinoma in precancerous lesion and use thereof | |
| JP6839707B2 (en) | Prevention, diagnosis and treatment of cancers that overexpress GPR160 | |
| KR101150410B1 (en) | Use of S100P as a hepatocellular carcinomar diagnostic marker | |
| KR20190086131A (en) | Composition for treatment and predicting prognosis of head and neck squamous cell carcinoma | |
| KR102042332B1 (en) | TCIRG1 biomarker for diagnosing recurrent and prognosis of liver cancer and use thereof | |
| KR102238258B1 (en) | A novel biomarker for diagnosing liver cancer and a treating method using thereof | |
| KR102401005B1 (en) | A composition for preventing or treating high-risk endometriosis | |
| KR101385783B1 (en) | Deleted in breast cancer-1 as a marker for the diagnosis of hepatocellular carcinomas and as a therapeutic agent thereof | |
| US20190264292A1 (en) | Use of h2a.z.1 as a hepatocellular carcinoma biomarker | |
| KR20100129552A (en) | Composition for diagnosis and prognosis dertermining of liver cell cancer | |
| JP2005073548A (en) | UTILIZATION OF HNF-1beta FOR INSPECTING AND TREATING OVARIAN CLEAR CELL ADENOMATOUS CARCINOMA AND FOR SCREENING REMEDY | |
| KR20230140678A (en) | Pharmaceutical Composition for the Prevention or Treatment of Breast Cancer Comprising RBM15 inhibitors |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| A201 | Request for examination | ||
| E902 | Notification of reason for refusal | ||
| E701 | Decision to grant or registration of patent right |