KR101747422B1 - Reagent for SNP-genotyping of a gene related with anticancer drug-metabolizing enzyme and signal transduction pathway, the kit comprising the same, and the method for the SNP-genotyping - Google Patents

Abstract

The present invention relates to a reagent containing a probe capable of genotyping a SNP of a gene related to an anti-malignant tumor agent, a genotyping kit containing the reagent, and an assay method using the reagent.

Description

TECHNICAL FIELD [0001] The present invention relates to an antitumor tumorigenic metabolizing enzyme and a signal transduction system related gene SNP genotyping reagent, a kit containing the SNP genotyping reagent, and a kit for genotyping and a method for analyzing the genotypic pathway of an anticancer drug-metabolizing enzyme same, and the method for the SNP-genotyping}

The present invention relates to an agent for predicting a drug response by using an anticancer agent Fluoropyrimidines (5-FU, Capecitabine), Thiopurine (Azathioprine, Mercaptopurine, Thioguanine), Tamoxifen, arsenic trioxide and a reagent for SNP genotyping and an SNP genotyping assay (5-FU, Capecitabine), Thiopurine (Azathioprine, Mercaptopurine, Thioguanine), Tamoxifen (5-FU), fluoxetine, lovastatin, pimozide, quetiapine, quinidine, risperidone, sotalol, thioridazine and ziprasidone. , arsenic trioxide is known to cause bone marrow suppression. Therefore, in order to prevent side effects in advance, the SNP genotyping analysis of the patient is performed, and when the drug is administered to the patient, it is checked in advance whether the side effects of the drug occur SNPs for genotyping and methods for analyzing SNP genotyping And, more particularly wherein it is for a malignant tumor The drug-metabolizing enzymes and signal transduction pathway Genotyping Kit and genotype analysis method using the same that includes the reagent that contains a probe capable of genotyping an SNP in the gene, it related to.

Single nucleotide polymorphism (SNP) has been actively studied for differences in single base pairs based on individual and racial diversity in order to clarify the linkage to disease after all the human genome sequences have been decoded. 99.9% of the human genes are identical, but genetic characteristics such as constitution, appearance, and disease are shown by individual and ethnic genetic characteristics due to differences in SNP and copy number variation (CNV) of 0.1-0.5% It is also known that SNP, CNV, etc. differ in the efficacy, drug efficacy, and response of drugs.

To identify SNPs with such individual differences, the present invention uses qPCR (quantification Realtime PCR). qPCR is an improvement of already well-known PCR technique. PCR means nucleic acid enzyme amplification. Because it can amplify a very small amount of sample in a large amount and its process is simple, Although it has been used basically, it has a limitation that it is impossible to quantify the amplified product. therefore. To solve this problem, qPCR, which is a method of continuously detecting the fluorescence by adding fluorescence to the amplified nucleic acid material, is introduced. By using the qPCR, it is possible to estimate the amount of the initial nucleic acid. We analyzed pathogen detection, analysis of gene expression, SNP analysis, and chromosome aberrations.

On the other hand, since the anticancer drug has a high tolerance to tolerance and toxicity, and it is resistant to more than half of the patients with the same disease, the selection using the appropriate therapeutic marker for the resistance and toxicity of the anti- It can lead to breakthrough progress. Therefore, studies on the therapeutic reactivity of individual anticancer drugs according to SNP genotypes have been actively and continuously carried out recently. However, due to the complex action of bioreactors related to specific drugs, the diversity of therapeutic agents and administration methods, The remarkable achievement is weak.

Prior art literature

- Patent literature

Patent Document 1 KR13812207 B1 (SNP for antimicrobial susceptibility prediction of anticancer drug)

Patent Document 2 KR2013-7004034 A (a method for identifying patients who are more likely to respond to chemotherapy)

DISCLOSURE OF THE INVENTION An object of the present invention is to overcome the problem that the anticancer drug side effects due to individual SNPs can not be confirmed on prescription and thus it is impossible to select a proper anticancer drug in the use of conventional anticancer drugs. Therefore, SNPs of TPMT, DYPD, F5 and KCNH2 The present invention provides a reagent for diagnostic analysis capable of accurately and quickly diagnosing genotyping.

It is another object of the present invention to provide an oligonucleotide probe and a qPCR primer, NCI, capable of accurately detecting an anti-malignant tumor-associated SNP with high specificity and sensitivity.

Yet another object of the present invention is to provide a kit comprising the probe, the qPCR primer, NCI and a labeling means to analyze a genotype of a SNP associated with the anti-malignant tumor agent.

It is another object of the present invention to provide a method for analyzing variant allele genotypes by broke an ancestral allele of SNPs associated with the anti-malignant tumor agent using the NCI (Non Competitive Inhibitor).

It is another object of the present invention to provide a method for analyzing a genotype of a SNP associated with the anti-malignant tumor agent using the probe, the qPCR primer, and a marking means.

The present invention relates to a technique for analyzing an anti-malignant gene-related SNP that responds to a specific drug, and relates to a kit including a probe, a primer, an NCI, and a labeling means used in the analysis. In addition, the present invention provides a method for easily analyzing disease susceptibility and drug reactivity according to a genotype by analyzing genotypes of specific genes using a kit comprising the anti-malignant gene and a genotyping reagent for SNPs.

The kit comprises an oligonucleotide probe having the nucleotide sequence of SEQ ID NOs: 37 to 55, an oligonucleotide primer having the nucleotide sequences of SEQ ID NOS: 1 to 36, NCI having the nucleotide sequences of SEQ ID NOS: 56 to 73, and DNA amplified through the primer And a marking means for detecting the mark.

The primers include primers for TPMT gene amplification having the nucleotide sequences of SEQ ID NOS: 1 to 12, primers for amplifying the DPYD gene having the nucleotide sequences of SEQ ID NOS: 13 to 24, primers for amplifying the F5 gene having the nucleotide sequences of SEQ ID NOS: 25 to 26 And a primer for amplifying the KCNH2 gene having the nucleotide sequences of SEQ ID NOS: 27 to 36.

The primers can be complementary to sites specific to each gene using oligonucleotides having the nucleotide sequences of SEQ ID NOS: 1-36.

The labeling means for detecting the DNA is CY3, CY5, CY5.5, Bodipy, Alexa 488, Alexa 532, Alexa 546, Alexa 568, Alexa 594, Alexa 660, Rhodamine, TAMRA, FAM, FITC, Fluor OXYGEN 556, Oyster 645, Bodipy 630/650, Bodipy 650/665, Calfluor Orange 546, Calfluor red 610, Quasar 670, HEX, TEX, Orange, green 488X, Orange green 514X, HEX, TET, JOE, VIC, BHQ, BHQ1, MGB, ZEN and biotin.

The concentration of the probe is related to the sensitivity of the present invention, and 1 pmol or more is sufficient.

The kit utilizes a reagent capable of confirming SNP genotyping prior to administration of the drug, and can be used to determine whether or not to administer an anticancer agent suitable for the patient.

(A) amplifying a target gene of a sample by a single qPCR method using the primers selected from the sequence numbers 1 to 36; (b) hydrolyzing the TaqMan oligonucleotide probe; And (c) detecting the label of the TaqMan oligonucleotide probe. The present invention also provides a method for analyzing SNP genotypes.

The labeling means may be selected from the group consisting of CY3, CY5, CY5.5, Bodipy, Alexa 488, Alexa 532, Alexa 546, Alexa 568, Alexa 594, Alexa 660, Rhodamine, TAMRA, FAM, FITC, Fluor X, HEX, VIC, BHQ, BHQ1, HEX, Tet, JOE, Oyster 556, Oyster 645, Bodipy 630/650, Bodipy 650/665, Calfluor Orange 546, Calfluor red 610, Quasar 670, , MGB, ZEN, and biotin.

More specifically, the target probe to be bound to the target gene is a TaqMan probe having the nucleotide sequence of SEQ ID NOS: 37 to 55, and MGB or BHQ is preferably bound to the 3 'end.

 The SNP genotyping method of the present invention comprises analyzing 19 types of variant SNP gene-inserted plasmid vectors as positive control clones, and analyzing SNP ancestral genes using NCI oligonucleotides having the nucleotide sequences of SEQ ID NOS: and < RTI ID = 0.0 > a < / RTI >

The method for obtaining a sample of the present invention can be applied to a method selected from a blood vessel or Buccal swab (ball mucosal cells). The SNP gene analysis method of the present invention will be described in more detail. The analysis method comprises the following nine steps.

1. Preparation of standard and control specimens

We refer to reports from other countries, including the US and the United States, to determine the SNP types of anti-malignant tumor-associated genes that should be included in the new kit. As a result, the related genes were identified as TPMT, DYPD, F5, and KCNH2. Accordingly, the inventors of the present invention invented a qPCR kit capable of analyzing all of 19 SNPs Respectively. For this purpose, the standard and control specimens corresponding to SNPs of each gene were prepared by synthesizing mini Gene.

2. DNA Isolation

An appropriate method was established from the various samples obtained in the above step 1 to isolate DNA.

3. Single qPCR

Oligonucleotide primers for amplifying a total of 19 SNP alleles of the four genes of TPMT, DYPD, F5 and KCNH2 were devised and qPCR conditions were established. The qPCR was performed by single PCR , And each condition was established by varying the concentration ratio of primers corresponding to each gene.

4. Securing clones

A clone containing a DNA fragment containing each SNP was synthesized. The clone was used as a standard and a control sample when establishing the reaction conditions of the SNP Genotyping kit of the present invention.

5. Probe design

We have designed 19 types of vairant SNP probes related to anti - malignant tumors and oligonucleotide probes which can be identified as hydrolysis reactions in the qPCR process according to the sequence database and the foreign database in Korean SNP genotyping analysis.

6. NCI (Non Competitive Inhibitor) Design

All 18 types of ancestral SNPs related to anti-malignant tumors, according to the SNP genotype analysis of Koreans, and the foreign-related databases. NCI and oligonucleotides that bind only to the ancetral template without interfering with the response of the variant SNP probe to the qPCR process NCI was designed.

7. Fabrication of 96 well plate grid

A grid was designed in a 96-well plate to select the order to facilitate the analysis of the probes and NCI designed in steps 5 and 6 above.

8. Establish reaction and analysis conditions in qPCR instrument

The SNP gene was amplified by a single PCR using a standard sample prepared by combining one or two clones of each type of SNP obtained in the above step 4 and various concentrations and analyzed by a realtime PCR instrument Appropriate conditions were established.

9. Clinical sample analysis using qPCR kit

After the PCR was performed in step 3, a single qPCR was performed on the DNA of clinical specimens having SNPs and their types confirmed by a sequencing reaction, and analyzed by realtime PCR equipment. Thus, the sensitivity, specificity and reproducibility of the SNP genotype analysis kit of the present invention were analyzed, and the optimal conditions of the kit of the present invention for the diagnosis of SNP genotype were re-established.

In addition, the kit comprising the probe, the primer and the labeling means of the present invention can be used as a kit for extracting DNA extracted by a commercial product (manual method or automated method), which is a reagent for extracting DNA from a specimen such as blood or buccal swab 2) a plasmid DNA clone to be used as a positive control in the amplification of the SNP gene; 3) an oligonucleotide probe for SNP genotyping and NCI; and 3) a plasmid DNA clone to be used as a positive control at the time of amplification of the qPCR of the four genes of TPMT, DYPD, F5 and KCNH2 ('ALL IN ONE') which contains all of the reaction solutions necessary for the qPCR reaction using the kit.

According to the present invention, the drug reaction using the anti-malignant tumor agents Fluoropyrimidines (5-FU, Capecitabine), Thiopurine (Azathioprine, Mercaptopurine, Thioguanine), Tamoxifen, arsenic trioxide and the SNP genotyping reagent and SNP genotype Predictable Drugs SNPs associated with the actions of doxepin, fluoxetine, lovastatin, pimozide, quetiapine, quinidine, risperidone, sotalol, thioridazine and ziprasidone can all be identified and the diagnostic sensitivity and specificity of the SNP genotype are close to 100% (5-FU, Capecitabine), Thiopurine (Azathioprine, Mercaptopurine, Thioguanine), Tamoxifen, arsenic trioxide, and in particular, the SNP genotype analysis of the present invention The use of a reagent and a kit for using the same in a blood sample or a Buccal swab (ball mucosal cell) It is very useful for quickly and accurately analyzing the presence or absence of a SNP and its genotype.

In addition, since a large number of genes related to anti-malignant tumor agents can be examined, it is possible to replace the conventional sequencing method used for analyzing SNPs of one gene, and to reduce inspection costs, manpower and time, It is also useful when analyzing accurate genotypes related to anti-malignant tumor agents and applying them to customized anti-cancer drug screening.

Therefore, the present invention can reduce the use of expensive anticancer drugs by predicting adverse side effects of anti-malignant tumor agents, contribute greatly to enhancement of public health and welfare, and can make a great contribution economically, There is a useful effect.

1 is a schematic diagram showing a well plate grid of the SNP genotyping kit of the TPMT, DPYD, F5, and KCNH2 genes associated with the anti-malignant tumor agent of the present invention.
Figure 2 shows the TPMT-719A> G qPCR results of the present invention.
Fig. 3 shows the TPMT-460G > A qPCR results of the present invention.
Figure 4 shows the TPMT-238G > C qPCR results of the present invention.
Figure 5 shows the TPMT-828-1G> A qPCR results of the present invention.
Figure 6 shows the TPMT-539A> T qPCR results of the present invention.
Fig. 7 shows the TPMT-460A> T qPCR results of the present invention.
Fig. 8 shows DPDD-1601G > A qPCR results of the present invention.
Figure 9 shows DPYD-1627A> G qPCR results of the present invention.
Fig. 10 shows DPDD-2194G> A qPCR results of the present invention.
11 shows DPYD-85T> C qPCR results of the present invention.
Fig. 12 shows DPYD-1905 + 1G> A qPCR results of the present invention.
13 shows DPYD-1898C> del qPCR results of the present invention.
Fig. 14 shows the F5-1601G> A qPCR results of the present invention.
15 shows the KCNH2-1330C> qPCR results of the present invention.
16 shows the KCNH2-1330C> G qPCR results of the present invention.
17 shows the results of KCNH2-2690A> C qPCR of the present invention.
18 shows the KCNH2-2120G> T qPCR results of the present invention.
Fig. 19 shows the results of KCNH2-307 + 4589G> A qPCR of the present invention.
20 shows the results of KCNH2-2132 + 22G > A qPCR of the present invention.

The present invention relates to a method for rapidly and accurately analyzing the presence or absence of a SNP and a genotype of a gene associated with an anti-malignant tumor agent by obtaining a sample from a patient's blood or a Buccal swab (ball mucosal cell) before administering the drug, Useful SNP genotyping reagents, kits comprising them, and methods for analyzing SNP genotypes.

Hereinafter, the embodiments described below may be modified in various ways, and the scope of the present invention is not limited to the embodiments described below. The embodiments of the present invention are provided to enable those skilled in the art to more fully understand the present invention.

Example 1 Preparation of Control Specimens and DNA Extraction

In the present invention, DNA was extracted using DNeasy Blood & Tissue kit (Qiagne, 69506). However, in order to perform the present invention, DNA can be extracted using commercial products. The DNA extraction method using this kit is as follows.

① Blood cells or ball mucous cells are collected in a centrifuge tube, centrifuged at 300 × g for 5 minutes, and loosened with 200 μl of PBS.

② Add 20 μl of Proteinas K.

Add 200 μl Buffer AL, vortex and incubate at 56 ° C for 10 minutes. Add 200 μl of Ethanol (96-100%) and mix by vortexing.

④ Transfer the mixture to a DNeasy Mini spin column in a 2 ml collection tube, and centrifuge at 8,000 rpm for 1 minute (remove the filtered solution in the collection tube).

⑤ Transfer the DNeasy Mini spin column to a new 2 ml collection tube, add 500 μl of Buffer AW1, and centrifuge at 8,000 rpm for 1 minute (remove the solution in the collection tube).

⑥ Transfer the DNeasy Mini spin column to a new 2 ml collection tube, add 500 μl of Buffer AW2, and centrifuge at 14,000 rpm for 3 minutes. (the solution filtered through the collection tube is removed).

⑦ Transfer the DNeasy Mini spin column to a new 2 ml collection tube and centrifuge at 14,000 rpm for 1 minute (remove the solution filtered on the collection tube).

⑧ Transfer the DNeasy Mini spin column to a clean 1.5 ml or 2 ml microcentrifuge tube, and drop 200 μl of Buffer AE directly onto the DNase membrane. After incubation at room temperature for 3 minutes, centrifuge at 8,000 rpm.

The criteria for the DNA thus extracted are as follows.

DNA or RNA exhibits the highest absorbance at a wavelength of 260 nm. Ultraviolet absorbed radiation is proportional to the amount of DNA. When the absorbance at a wavelength of 260 nm is 1.0, the concentration of ds-DNA is 50 μg / ml. Therefore, when the absorbance at a wavelength of 260 nm is 2.0 at the assumption of pure DNA, ds-DNA shows a concentration of 100 ug / ml. Materials that can interfere at similar wavelengths include proteins, phenol, etc., which exhibit the highest absorbance at 280 nm. When the interference substance is present, the ratio of absorbance at 260 nm wavelength and 280 nm wavelength (A260 / A280) can be used to confirm contamination with other substances. In the case of pure DNA without interference, the absorbance ratio (A260 / A280) of 260 nm and 280 nm is 1.8 or more. If this value is 2.0, it can be defined as 100% pure DNA (or RNA). In case of contamination with protein or phenol, the absorbance ratio (A260 / A280) of 260 nm wavelength and 280 nm wavelength is 1.8 or less. In this case, the quantification of the sample may not be accurate. When the absorbance at the wavelength is 1, the concentration of ds-DNA is 50 ㎍ / ml, ss-DNA is 33 ㎍ / ㎕, RNA is 40 ㎍ / ml and oligomer is 25-35 ㎍ / ml.

The purity of the extracted DNA should be measured within the range of 1.8-2.1 for the A260 / A280 ratio and 1.5-2 for the A260 / A230 ratio.

Example 2: Preparation of standard and control specimens

Plasmid DNA clones containing 18 ancestral SNPs and 19 variant SNPs of related genes to be standard substances for genotyping and genotyping were synthesized and prepared.

Example 3: Single qPCR

Related genes were amplified to examine the SNPs of four TPMT, DYPD, F5, and KCNH2 genes.

The oligonucleotide primer was first selected and designed for PCR amplification.

Oligonucleotide primers were first selected and designed for these PCR amplifications. First, SNP data from the variation viewer (data in dbSNP) and 1000 Genomes Browser (data from the 1000 Genome Project) were identified for each anti-malignant tumor-associated gene (http://www.sequenceontology.org). dbSNP includes all of the HapMap and 1000 Genome Project data, but does not include race-specific allele frequencies that represent race-specific differences. However, the data in the 1000 Genomes Browser are less informative about SNPs, but are more likely to be classified as 'allele frequency (AF)' (Asian allele frequency, AMR AF, AFR AF, And the European allele frequency (EAF), the SNPs of alleles of each gene were confirmed by checking the Genomes Browser and the variation viewer for each SNP allele reported to be present for selecting antimutagenic gene primers Respectively.

The primers of the present invention were designed to minimize the number of cases where PCR amplification did not occur due to SNPs that could be located at specific positions according to individuals.

The primers of the present invention are composed of primers (SEQ ID NOS: 1 to 36) for detecting TPMT, DYPD, F5 and KCNH2 genes containing respective SNPs as follows. PCR of the TPMT gene is 98, 169, 172, PCR of 125, 129, 107, 128, 116, 92bp, and F5 was 165bp, and the PCR of the KCNH2 gene was 143, 175, 112, 96, and 184bp long, respectively. Respectively. The nucleotide sequences of PCR primers for each gene are shown in Table 1 below.

In the table below, R represents A + G (Purines), Y represents C + T (Pyrimidine), and K represents G + T (Keto).

Primers for PCR
No.
Gene Name
Primer Name
Sequence (5 '-> 3')
Length
(bp)
Amplicon (bp)
RS number
One
TPMT-719A> G
1142345F
AGTTGGGGAATTGACTGTCTTT
22
98
RS1142345
2
1142345R
CCTCAAAAACATGTCAGTGTGAT
23
3
TPMT-460G> A
TPMT-460F
TGAAGTACCAGCATGCACCA
20
169
rs1800460
4
TPMT-460R
TTACCATTTGCGATCACCTG
20
5
TPMT-238G> C
TPMT-238F
GCTTTCCTGCATGTTCTTTGA
21
172
rs1142345
6
TPMT-238R
CTACACTGTGTCCCCGGTCT
20
7
TPMT-828-1G> A
1800584F
AAGTGTTGGGATTACAGGTGTGAG
24
148
RS1800584
8
1800584R
CCTTCTCAAGACAACGTATATTGC
24
9
TPMT-539A > T
TPMT-539F
GTAGCTATGCAGATACAATG
20
141
rs75543815
10
TPMT-539R
GGATGTTTAGTTGGATCATAA
21
11
TPMT-460A> T
TPMT-460-1 F
CATGGGAGTGGAGGTGTCTT
20
164
rs12201199
12
TPMT-460-1 R
AGCTGCCTCAGTTTCCCATA
20
13
DPYD-1601G> A
1801158F
ACAATATGGAGCTTCCGTTTCTGC
24
125
RS1801158
14
1801158R
CGCTAGCAAGACCAAAAGGATTTA
24
15
DPYD-1627A> G
1801159F
TTCTGCCAAGCCTGAACTACC
21
129
RS1801159
16
1801159R
ATGTGCTGGTGGCTGGAGTT
20
17
DPYD-2194G> A
1801160F
GAGCTGCATGAAAATGTTGATGT
23
107
RS1801160
18
1801160R
CAAGGTGTGCCATCAGATTTTAA
23
19
DPYD-85T> C
1801265F
ACAAATGCCAACATATTTCCATA
23
128
RS1801265
20
1801265R
CTTGTCTAATTTCTTGGCCGAAGT
24
21
DPYD-1905 + 1G > A
3918290F
AGTGAGAAAACGGCTGCATATT
22
116
RS3918290
22
3918290R
TCACCAACTTATGCCAATTCTCTT
24
23
DPYD-1898C> del
72549303F
GCTGCATATTGGTRTCAAAGTGT
23
92
RS72549303
24
72549303R
TGCCAATTCTCTTGTTTTAGATGT
24
25
F5-1601G> A
6025F
TCATGAGAGACATCGCCTCTG
21
165
RS6025
26
6025R
CCCATTATTTAGCCAGGAGACC
22
27
KCNH2-1330C> G / T
12720441F
CCTGGCCATGAAGTTCAAGAC
21
143
RS12720441
28
12720441R
ACCCAGGATGGCCACGAC
18
29
KCNH2-2690A> C
1805123F
CCCGGCAGTACGGAGTTAG
19
175
RS1805123
30
1805123R
GAGGCCTGGGTAAAGCAGAC
20
31
KCNH2-2120G > T
36210421F
CCCAGCCTCCTCAACATCC
19
112
RS36210421
32
36210421R
CACCTGCACTCCCTCACCT
19
33
KCNH2-307 + 4589G > A
3807375F
GTATTTCCCTGAAGCGTTCCTGA
23
96
RS3807375
34
3807375R
GGGCAATGAGAGAGAACGTGTT
22
35
KCNH2-2132 + 22G > A
3815459F
CCCAGCCTCCTCAACATCC
19
184
RS3815459
36
3815459R
ACAGGCCCTCTCCCTCTACCA
21

Example 4: Design of a probe of a kit

SNP data from the variation viewer (data in dbSNP) and the 1000 Genomes Browser (data from the 1000 Genome Project) for each SNP allele of the anti-malignant tumor-associated gene were confirmed (http://www.sequenceontology.org). dbSNP includes all of the HapMap and 1000 Genome Project data, but does not include race-specific allele frequencies that represent race-specific differences. However, the data in the 1000 Genomes Browser are less informative about SNPs, but are more likely to be classified as 'allele frequency (AF)' (Asian allele frequency, AMR AF, AFR AF, African allele frequency, and European allele frequency). Therefore, SNPs of each gene allele were compared and analyzed by checking the Genomes Browser and the variation viewer for each SNP allele of the gene.

In order to devise an oligonucleotide probe, a vast basal base (SNPs3D) for the nucleotide sequence of an anti-malignant tumor-associated gene was analyzed, and the presence of SNP genotype in each gene The intra-cariant base sequence was also analyzed. Therefore, the SNP type of the anti-malignant tumor-associated gene was selected and the oligo probe was designed to search for its genotype (Table 2).

The oligonucleotide probe design of the present invention was designed as a genotype specific probe capable of specifically binding to various SNPs of 19 genes according to the purpose of the present invention, Genotype-specific probes were designed using the computer program PyroMark Assay Design or Primer3.

At this time, 19 kinds of type-specific probes were first designed by setting the oligonucleotide probes to 20 ± 2 and 18 ± 2 bp oligonucleotides, and the anti-malignant tumor- A total of 19 TPMT, DPYD, F5, and KCNH2 genes from six TPMT genes, six DPYD genes, one F5 gene, and six KCNH2 genes are targeted.

The names, sequence numbers and types of the oligonucleotide probes are summarized in Table 2 below.

In the table below, R is A + G (Purines), Y is C + T (Pyrimidine), K is G + T (Keto), V is A + C + C (Amino).

The oligonucleotide probe No. Gene Name Probe Name Sequence (5 '-> 3') rs number 37 TPMT-719G rs1142345gP FAM-CATTTACTTTTCTGTAAGTAGACATAACT-MGB rs1142345 38 TPMT-460A rs1800460aP FAM-TGGGATAGAGGAACATTAGT-MGB rs1800460 39 TPMT-238C rs1800462cP FAM-CCGGTCTGGAAACCT-MGB rs1142345 40 TPMT-828-1A rs1800584aP FAM-GTTACTCTTTCTTGTTTCAAGTA-MGB rs1800584 41 TPMT-539A rs75543815aP FAM-AGAAGTTTCAKTTTCTCCTGTG-MGB rs75543815 42 TPMT-460C (T) rs12201199tP FAM-TGTGGATGTTACACAGGTG-MGB rs12201199 43 DPYD-1601A rs1801158aP FAM-GAYCTGGTGGACATTAATGT-MGB rs1801158 44 DPYD-1627G rs1801159gP FAM-CAAGACCAAAAGGATTTACAAAC-MGB rs1801159 45 DPYD-2194A rs1801160aP FAM-GGCTGTAATRCCATTGG-MGB rs1801160 46 DPYD-85T rs1801265tP FAM-AACTCATGCAACTCTGTG-MGB rs1801265 47 DPYD-1905 + 1A rs3918290aP FAM-GATGTTAAATCACACTTATVTTG-MGB rs3918290 48 DPYD-1898del rs72549303dcP FAM-GCTGACTTYCAGACAACG-MGB rs72549303 49 F5-1601A rs6025aP FAM-TGGACAGGCAAGGAATAC-MGB rs6025 50 KCNH2-1330T rs12720441tP FAM-CCTGTACTTCATCTCCTG-MGB rs12720441 51 KCNH2-1330G rs12720441gP FAM-CTGTACTTCATCTCCGG-MGB rs12720441 52 KCNH2-2690C rs1805123cP FAM-AGGYDCAYKGACAC-MGB rs1805123 53 KCNH2-2120T rs36210421tP FAM-YYTCCAGYTCCAGCT-MGB rs36210421 54 KCNH2-307 + 4589A (G) rs3807375gP FAM-GAGAACTTCTGCRTTTAGAGTG-MGB rs3807375 55 KCNH2-2132 + 22A rs3815459aP FAM-GAGTGMAGGTGGGGTAG-MGB rs3815459

The NCI oligonucleotide length was set to 19 ± 7 bp oligonucleotides and 18 types of NCI were first designed. The anti-malignant tumor-associated genotype diagnostic reagents and kits showed that the DNA SNPs contained 6 TPMT genes, 6 DPYD gene, 1 F5 gene, and 5 KCNH2 genes in total 18 species of TPMT, DPYD, F5, and KCNH2 genes. The names, sequence numbers and types of NCI (non-competitive inhibitor) are summarized in Table 3 below. NCI is an oligonucleotide modified to prevent PCR amplification by making it impossible to synthesize by Taq Polymerase by removing -OH group at the 3 'end, unlike ordinary oligo. It is mainly composed of 3'-phosphate group, thiol group or amine group and the like to remove 3'-OH. The prepared NCI binds only to the ancestral SNP region without binding to the variant SNP to be detected, so that the PCR amplicon is amplified by the primer. Therefore, the target probe of the present invention reacts only with the variant SNP portion of each gene to display a signal.

NCI sequence information No. Gene Name NCI Name Sequence (5 '-> 3') mer RS number 56 TPMT-719A 2-1B CATTTACTTTTCTGTAAGTAGATATAACT 29 rs1142345 57 TPMT-460G 2-2B GGGATAGAGGAGCATTAG 18 rs1800460 58 TPMT-238G 2-3B CGGTCTGCAAACCT 14 rs1142345 59 TPMT-828-1G 2-4B TCTTGTTTCAGGTAAAATAT 20 rs1800584 60 TPMT-539T 2-5B AGAAGTTTCAGTATCTCCTGT 21 rs75543815 61 TPMT-460T (A) 2-6B TGTTACACAGGAGGAAGAG 19 rs12201199 62 DPYD-1601G 2-7B GGACATTAGTGTAGAAATGG 20 rs1801158 63 DPYD-1627A 2-8B CCAAAAGGATTTATAAACTTCA 22 rs1801159 64 DPYD-2194G 2-9B GCTGTAACGCCATTG 53 rs1801160 65 DPYD-85C 2-10B CAACTCTGCGTTCCAC 16 rs1801265 66 DPYD-1905 + 1G 2-11B AATCACACTTACGTTGTCT 19 rs3918290 67 DPYD-1898C 2-12B TGACTTTCCAGACAACG 17 rs72549303 68 F5-1601G 2-13B GGACAGGCGAGGAATA 16 rs6025 69 KCNH2-1330C 2-14B TTCATCTCCCGGG 13 rs12720441 70 KCNH2-2690A 2-15B ACGGACAAGGGTGAG 15 rs1805123 71 KCNH2-2120G 2-16B CCAGCGCCAGCT 12 rs36210421 72 KCNH2-307 + 4589G (A) 2-17B GTTTAGAATGCTCCTTTTTC 20 rs3807375 73 KCNH2-2132 + 22G 2-18B CCCCCCACCCC 11 rs3815459

Example 5: Fabrication of 96 well plate grid

A grid (Grid) was devised according to the probe designed in Example 4. The process of making the 96 well plate grid is as follows.

For the analysis of SNP genotypes of anti-malignant tumor-associated genes, TPMT-719A> G; A1, C1, E1 and G1 wells were used for the probe grid of each well. A2, C2, E2 and G2 wells are TPMT-460G> A; A3, C3, E3 and G3 wells are TPMT-238G> C; A4, C4, E4 and G4 wells are TPMT-828-1G> A; A5, C5, E5 and G5 wells are TPMT-539A> T; A6, C6, E6 and G6 wells are TPMT-460A> T; A7, C7, E7 and G7 wells are DPYD-1601G> A; A8, C8, E8 and G8 wells are DPYD-1627A> G; A9, C9, E9 and G9 wells are DPYD-2194G> A; A10, C10, E10 and G10 wells are DPYD-85T> C; A11, C11, E11 and G11 wells are DPYD-1905 + 1G> A; A12, C12, E12 and G12 wells are DPYD-1898C> del; B1, D1, F1 and H1 wells are F5-1601G> A; B2, D2, F2 and H2 well were KCNH2-1330C> T; B3, D3, F3 and H3 wells are KCNH2-1330C> G; B4, D4, F4 and H4 wells were KCNH2-2690A> C; B5, D5, F5 and H5 wells were KCNH2-2120G> T; B6, D6, F6 and H6 wells were KCNH2-307 + 4589G> A; B7, D7, F7, and H7 wells were used to locate the oligo probe of the KCNH2-2131 + 22G> A gene.

In the present invention, a grid was created by grouping the detected genotypes according to genotype of anti-malignant tumor in one 96-well plate so as to easily recognize whether the genotypes were high risk type, low risk type or low risk type. The order is the same as in Fig.

Example 6 Establishment of qPCR Reaction and Analysis Conditions in 96-well Plate

Using the clones of each type of anti-malignant tumor-associated gene established in Example 3 as a template, the anti-malignant tumor related gene was amplified by qPCR, and then the sequence of the 96 well plate prepared in Example 5 And appropriate conditions were established.

The composition and conditions of qPCR for confirming the genotype of anti-malignant tumorigenic gene were performed as shown in Table 4 below.

However, when the 5 'end of the oligonucleotide in the probe combination was a variant allele, FAM fluorescence was used as a labeling means and MGB or BHQ1 was used as a labeling means at the 3' end of the oligonucleotide.

The labeling substance of the labeling means is selected from the group consisting of CY3, CY5, CY5.5, Bodipy, Alexa 488, Alexa 532, Alexa 546, Alexa 568, Alexa 594, Alexa 660, Rhodamine, TAMRA, FAM, FITC, Fluor X, HEX, VIC, OXYGEN 556, Oyster 556, Oyster 645, Bodipy 630/650, Bodipy 650/665, Calfluor Orange 546, Calfluor red 610, Quasar 670, HEX, TET, JOE, ROX, Texas Red, Orange green 488X, BHQ, MGB, ZEN, and biotin.

Example 7: Analysis in Clinical Specimens Using SNP Genotyping Kit

The DNA of the clinical specimen in which the SNP type was confirmed by the sequencing reaction after the PCR in Example 3 was analyzed by performing the qPCR again according to the method described in Example 3 above. Thus, the sensitivity, specificity and reproducibility of the present SNP Genotyping kit were analyzed, and the optimum conditions of the SNP Genotyping kit of the present invention for the diagnosis of the SNP genotype were checked again. The results are shown in FIG. 2 to FIG.

<110> KOREA (National Institute of Food and Drug Safety Evaluation) <120> Reagent for SNP-genotyping of a gene related with anticancer          drug-metabolizing enzyme & signal transduction pathway, the kit          comprising the same, and the method for the SNP genotyping <130> 15-FP-015 <160> 73 <170> Kopatentin 2.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 1142345F <400> 1 agttggggaa ttgactgtct tt 22 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 1142345R <400> 2 cctcaaaaac atgtcagtgt gat 23 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TPMT-460F <400> 3 tgaagtacca gcatgcacca 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TPMT-460R <400> 4 ttaccatttg cgatcacctg 20 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> TPMT-238F <400> 5 gctttcctgc atgttctttg a 21 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TPMT-238R <400> 6 ctacactgtg tccccggtct 20 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 1800584F <400> 7 aagtgttggg attacaggtg tgag 24 <210> 8 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 1800584R <400> 8 ccttctcaag acaacgtata ttgc 24 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TPMT-539F <400> 9 gtagctatgc agatacaatg 20 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> TPMT-539R <400> 10 ggatgtttag ttggatcata a 21 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TPMT-460-1 F <400> 11 catgggagtg gaggtgtctt 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TPMT-460-1 R <400> 12 agctgcctca gtttcccata 20 <210> 13 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 1801158F <400> 13 acaatatgga gcttccgttt ctgc 24 <210> 14 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 1801158R <400> 14 cgctagcaag accaaaagga ttta 24 <210> 15 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 1801159F <400> 15 ttctgccaag cctgaactac c 21 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 1801159R <400> 16 atgtgctggt ggctggagtt 20 <210> 17 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 1801160F <400> 17 gagctgcatg aaaatgttga tgt 23 <210> 18 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 1801265F <400> 18 caaggtgtgc catcagattt taa 23 <210> 19 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 1801265F <400> 19 acaaatgcca acatatttcc ata 23 <210> 20 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 1801265R <400> 20 cttgtctaat ttcttggccg aagt 24 <210> 21 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 3918290F <400> 21 agtgagaaaa cggctgcata tt 22 <210> 22 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 3918290R <400> 22 tcaccaactt atgccaattc tctt 24 <210> 23 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 72549303F <400> 23 gctgcatatt ggtrtcaaag tgt 23 <210> 24 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 72549303R <400> 24 tgccaattct cttgttttag atgt 24 <210> 25 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 6025F <400> 25 tcatgagaga catcgcctct g 21 <210> 26 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 6025R <400> 26 cccattattt agccaggaga cc 22 <210> 27 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 12720441F <400> 27 cctggccatg aagttcaaga c 21 <210> 28 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> 12720441R <400> 28 acccaggatg gccacgac 18 <210> 29 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> 1805123F <400> 29 cccggcagta cggagttag 19 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 1805123R <400> 30 gaggcctggg taaagcagac 20 <210> 31 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> 36210421F <400> 31 cccagcctcc tcaacatcc 19 <210> 32 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> 36210421R <400> 32 cacctgcact ccctcacct 19 <210> 33 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 3807375F <400> 33 gtatttccct gaagcgttcc tga 23 <210> 34 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 3807375R <400> 34 gggcaatgag agagaacgtg tt 22 <210> 35 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> 3815459F <400> 35 cccagcctcc tcaacatcc 19 <210> 36 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 3815459R <400> 36 acaggccctc tccctctacc a 21 <210> 37 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> rs1142345gP <400> 37 catttacttt tctgtaagta gacataact 29 <210> 38 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs1800460aP <400> 38 tgggatagag gaacattagt 20 <210> 39 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> rs1800462cP <400> 39 ccggtctgga aacct 15 <210> 40 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> rs1800584aP <400> 40 gttactcttt cttgtttcaa gta 23 <210> 41 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> rs75543815aP <400> 41 agaagtttca ktttctcctg tg 22 <210> 42 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> rs12201199tP <400> 42 tgtggatgtt acacaggtg 19 <210> 43 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs1801158aP <400> 43 gayctggtgg acattaatgt 20 <210> 44 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> rs1801159gP <400> 44 caagaccaaa aggatttaca aac 23 <210> 45 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> rs1801160aP <400> 45 ggctgtaatr ccattgg 17 <210> 46 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> rs1801265tP <400> 46 aactcatgca actctgtg 18 <210> 47 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> rs3918290aP <400> 47 gatgttaaat cacacttatv ttg 23 <210> 48 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> rs72549303dcP <400> 48 gctgacttyc agacaacg 18 <210> 49 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> rs6025aP <400> 49 tggacaggca aggaatac 18 <210> 50 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> rs12720441tP <400> 50 cctgtacttc atctcctg 18 <210> 51 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> rs12720441gP <400> 51 ctgtacttca tctccgg 17 <210> 52 <211> 14 <212> DNA <213> Artificial Sequence <220> <223> rs1805123cP <400> 52 aggydcaykg acac 14 <210> 53 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> rs36210421tP <400> 53 yytccagytc cagct 15 <210> 54 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> rs3807375gP <400> 54 gagaacttct gcrtttagag tg 22 <210> 55 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> rs3815459aP <400> 55 gagtgmaggt ggggtag 17 <210> 56 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> 2-1B <400> 56 catttacttt tctgtaagta gatataact 29 <210> 57 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> 2-2B <400> 57 gggatagagg agcattag 18 <210> 58 <211> 14 <212> DNA <213> Artificial Sequence <220> <223> 2-3B <400> 58 cggtctgcaa acct 14 <210> 59 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2-4B <400> 59 tcttgtttca ggtaaaatat 20 <210> 60 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 2-5B <400> 60 agaagtttca gtatctcctg t 21 <210> 61 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> 2-6B <400> 61 tgttacacag gaggaagag 19 <210> 62 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2-7B <400> 62 ggacattagt gtagaaatgg 20 <210> 63 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 2-8B <400> 63 ccaaaaggat ttataaactt ca 22 <210> 64 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> 2-9B <400> 64 gctgtaacgc cattg 15 <210> 65 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> 2-10B <400> 65 caactctgcg ttccac 16 <210> 66 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> 2-11B <400> 66 aatcacactt acgttgtct 19 <210> 67 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> 2-12B <400> 67 tgactttcca gacaacg 17 <210> 68 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> 2-13B <400> 68 ggacaggcga ggaata 16 <210> 69 <211> 13 <212> DNA <213> Artificial Sequence <220> <223> 2-14B <400> 69 ttcatctccc ggg 13 <210> 70 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> 2-15B <400> 70 acggacaagg gtgag 15 <210> 71 <211> 12 <212> DNA <213> Artificial Sequence <220> <223> 2-16B <400> 71 ccagcgccag ct 12 <210> 72 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2-17B <400> 72 gtttagaatg ctcctttttc 20 <210> 73 <211> 11 <212> DNA <213> Artificial Sequence <220> <223> 2-18B <400> 73 ccccccaccc c 11

Claims (18)

An oligonucleotide probe set consisting of oligonucleotides respectively represented by the nucleotide sequences of SEQ ID Nos. 37 to 55, an oligonucleotide primer set consisting of the oligonucleotides respectively represented by the nucleotide sequences of SEQ ID Nos. 1 to 36, And a set of NCI (non-competitive inhibitor) oligonucleotides consisting of oligonucleotides respectively represented by the nucleotide sequences of SEQ ID NOS: 56 to 73, respectively, and comprises at least one selected from the group consisting of Capecitabine, A composition for SNP genotyping of genes TPMT, DYPD, F5, and KCNH2 associated with the action of Azathioprine, Mercaptopurine, Thioguanine, Tamoxifen and fluoxetine
delete delete The SNP genotyping composition according to claim 1, wherein the concentration of each oligonucleotide probe constituting the oligonucleotide probe set is 1 pmol or more
2. The oligonucleotide primer set according to claim 1, wherein the oligonucleotide primer set represented by each of the nucleotide sequences of SEQ ID NOS: 1 to 36 comprises a TPMT gene amplification primer represented by the nucleotide sequence of SEQ ID NOS: 1 to 12, A primer for amplifying the DYPD gene represented by the nucleotide sequence of SEQ ID NO: 13 to 24, a primer for amplifying the F5 gene represented by the nucleotide sequence of SEQ ID NO: 25 to 26, respectively, and a nucleotide sequence of SEQ ID NO: And a primer for amplifying KCNH2 gene each represented by SEQ ID NO:
The method of claim 1, wherein the labeling means is selected from the group consisting of CY3, CY5, CY5.5, Bodipy, Alexa 488, Alexa 532, Alexa 546, Alexa 568, Alexa 594, Alexa 660, Rhodamine, TAMRA, FAM, FITC, Fluor X, ROX, Texas Red, Orange green 488X, Orange green 514X, HEX, TET, JOE, Oyster 556, Oyster 645, Bodipy 630/650, Bodipy 650/665, Calfluor Orange 546, Calfluor red 610, Quasar 670, HEX , VIC, BHQ, BHQ1, MGB, ZEN and biotin. The composition for SNP genotyping
delete The method according to claim 1, wherein the 3 'end of the NCI oligonucleotide represented by each of the nucleotide sequences of SEQ ID NOS: 56 to 73 is any one selected from the group consisting of a phospate group, a thiol group and an amine group A functional group of SNP genotyping
An assay kit for SNP diagnosis comprising the composition according to claim 8
Amplifying a target gene of a sample by a single qPCR method using an oligonucleotide primer set consisting of oligonucleotides respectively represented by the nucleotide sequences of SEQ ID NOS: 1 to 36; Hydrolyzing a set of TaqMan oligonucleotide probes consisting of oligonucleotides respectively represented by the nucleotide sequences of SEQ ID NOS: 37 to 55; Comprising the steps of: mixing a set of NIC (non-competitive inhibitor) oligonucleotides consisting of oligonucleotides, each represented by the nucleotide sequence of SEQ ID NOS: 56 to 73, and detecting the labeling substance bound to the probe SNP genotyping analysis of the genes TPMT, DYPD, F5 and KCNH2 associated with the action of capecitabine, azathioprine, mercaptopurine, thioguanine, tamoxifen and fluoxetine Way
delete delete 11. The method of claim 10, wherein the labeling substance is selected from the group consisting of CY3, CY5, CY5.5, Bodipy, Alexa 488, Alexa 532, Alexa 546, Alexa 568, Alexa 594, Alexa 660, Rhodamine, TAMRA, FAM, FITC, Fluor X, ROX, Texas Red, Orange green 488X, Orange green 514X, HEX, TET, JOE, Oyster 556, Oyster 645, Bodipy 630/650, Bodipy 650/665, Calfluor Orange 546, Calfluor red 610, Quasar 670, HEX , VIC, BHQ, BHQ1, MGB, ZEN and biotin.
delete 14. The method according to claim 10 or 13, wherein the 3 ' end of the NCI oligonucleotide, each represented by the nucleotide sequence of SEQ ID NOS: 56 to 73, is selected from the group consisting of a phospate group, a thiol group or an amine group SNP genotyping assay method according to any one of &lt; RTI ID = 0.0 &gt;
11. The SNP genotyping assay according to claim 10, wherein TaqMan oligonucleotide probes represented by the nucleotide sequences of SEQ ID NOS: 37 to 55, respectively, have a labeling substance selected from MGB and BHQ1 bound to the 3 '
delete delete

Images