KR101746047B1 - Lactobacillus fermentum strain SI-1309 isolated from pickled fish having toll-like receptor 2-mediated immune activity and antimicrobial activity against pathogen and use thereof - Google Patents

Abstract

The present invention relates to a Lactobacillus fermentum SI-1309 strain derived from salted and fermented fish having antimicrobial activity against pathogenic bacteria, and more particularly to a method for producing Lactobacillus sp. Lactobacillus fermentum SI-1309 isolates were identified and genetically identified. In addition, the expression of the tole-like receptor 2 was increased by the strain, and the immune activity was increased through the increase of the receptor. Thus, it was confirmed that the strain exhibited an antimicrobial activity inhibiting the growth of pathogenic bacteria. Therefore, it can be very usefully used for immuno-enhancing and antibacterial compositions using the present invention.

Description

Lactobacillus fermentum strain SI-1309 isolate having an antimicrobial activity against toll-like receptor 2 mediated immunological activity and pathogen and a use thereof Lactobacillus fermentum strain SI-1309 isolated from pickled fish having toll-like receptor 2-mediated immune activity and antimicrobial activity against pathogen and use thereof.

The present invention relates to a Lactobacillus fermentum strain SI-1309 derived from a fermented fish having antibacterial activity against a toole-like receptor 2 mediated immune activity and a pathogen, and more particularly to a Toll-like receptor 2 ) Lactobacillus fermentum strain SI-1309, which has antimicrobial activity against mediated immunological activity and pathogens, an antimicrobial and immunomodulating composition containing the strain or a culture thereof as an active ingredient, and a method for culturing the strain And a method for producing an antibacterial and immunostimulating composition.

Innate immunity is the host's most frontal defense against pathogens and is activated by factors such as toll-like receptors (TLRs) that recognize non-self substances. In the immune system, the Toll-like receptor recognizes the specific structure of microorganisms by acting as a receptor for a variety of endogenous molecules, that is, a pathogen-associated molecular pattern that is specifically present in microorganisms It transmits a signal that causes an immune response. In particular, various kinds of ligands such as lipopeptides and lipopolysaccharides (LPS) represented by molecular signals related to pathogenic factors can be recognized. In mammals, 13 kinds of similar species have been identified. In general, Toll-like receptor 2 (Toll-like receptor 2) forms a heterodimer with a tole-like receptor 1 or a toll-like receptor 6 to form a ligand-receptor complex and initiate an immune response. The tole-like receptor 1/2 recognizes a triacylated lipopeptide and the tole-like receptor 2/6 recognizes a diacylated lipopeptide. Thus, the toll-like receptor 2 may be a bacterial lipopeptide, a Gram positive bacterium, a Mycobacteria, a Peptidoglycan, Zymosan or Pam3Cys-Ser- (Lys) 4 ( In particular, when TLR2 is stimulated by a ligand such as a lipopeptide present on the cell surface of a lactic acid bacterium, a series of continuous signal transduction pathways activate the adapter protein (Pam3CSK4) NF-kB (NF-kB), which is the ultimate transcription factor through the Myeloid differentiation primary response gene 88, Tumor necrosis factor associated factor (TRAF) and IKK (Inhibitor of kB kinase) -kB) is activated, thereby producing an inflammatory cytokine, thereby increasing the immunological activity.

It is known that many kinds of microorganisms are inhabited in a person's intestines, and microorganisms existing in a human intestine are called intestinal flora. Intestinal flora of man night steroid (Bacteroides), Bifidobacterium (Bifidobacterium), Clostridium (Clostridium), Enterobacter (Enterobacter), Enterococcus (Enterococcus), E. coli (Escherichia), oil cake Te Leeum (Eubacterium), A microorganism belonging to the genus Fusobacterium , Klebsiella , Lactobacillus , Peptococcus, Peptostreptococcus , Proteus , and Ruminococcus , and about 500 It is made up of microorganisms overflowing. Among them, Bacteroides and Firmicutes are the largest numbers, and there are 10 times more intestinal microorganisms than the cells in the human body. In recent years, the intestinal flora has become a part of the gastrointestinal tract And is expressed as a superorganism.

Lactobacillus is known to produce a variety of antimicrobial substances such as lactic acid, acetic acid, and other organic acids, and bacteriocin, which are known to be important biological preservatives for food and feed. In addition, it enhances the self-defense ability of plants by producing various physiologically active substances, antimicrobial substances and anticancer substances, and in the case of livestock, stabilizes intestinal microorganisms, increases feed efficiency, and increases disease resistance. In addition, lactic acid bacteria are of particular interest because they are generally accepted as safe and generally accepted as safe, since they are widely used in foods, both east and west. However, in order to properly use lactic acid bacteria industrially, it is generally necessary to clearly understand and evaluate the scientific aspects of what is the intended use and the characteristics suitable for the application, rather than judging by the list of positive effects. This is because only the uniformity of the product and the reproducibility of the effect can be guaranteed.

In recent years, interest in the health promotion effect of lactic acid bacteria has been increasing as research results have been published that show that intestinal flora is important for development and regulation of immune system development and activity. Although many kinds of lactic acid bacteria have been reported to have immune enhancement or inflammation inhibiting activity for several decades, recently, various lactic acid bacteria have been used to control intestinal immune regulation, congenital immune response, and acquired immune response by lactic acid bacteria, However, studies on the mechanism of immunological / molecular biology are underway.

Korean Patent Laid-Open Publication No. 2015-0056208 discloses a novel Lactobacillus perfumer SJ8256 strain and its use, and Korean Patent No. 1511976 discloses a novel lactobacillus fermentum HY7301 having immunity enhancing activity and A product containing it as an active ingredient '. However, the Lactobacillus fermentum SI-1309 strain having antibacterial activity against the toll-like receptor 2-mediated immunological activity and pathogens of the present invention and its use has not been mentioned.

SUMMARY OF THE INVENTION The present invention has been made in view of the above-mentioned needs, and it is an object of the present invention to provide a fermented food fermented from Lactobacillus fermentum SI-1309 isolates were identified and genetically identified. In addition, the expression of Toll-like receptor 2 (TLR 2) is increased by the above-mentioned strain, and the immune activity is increased through this, and the above-mentioned pathogen, Salmonella enterica enterica ), Staphylococcus ( Staphylococcus aureus) aureus , Staphylococcus epidermidis , Shigella flexneri , Shigella sonnei), Bacillus cereus (Bacillus cereus), Listeria mono cytokines to Ness (Listeria monocytogenes ) and Escherichia coli ( Escherichia coli ). The present invention has been completed based on this finding.

In order to accomplish the above object, the present invention provides a method for inhibiting Toll-like receptor 2 (TLR2) mediated immune activity and Lactobacillus fermentation fermentum ) strain SI-1309.

The present invention also provides an antimicrobial and immunostimulating feed additive, a pharmaceutical or health food composition comprising the strain or a culture thereof as an active ingredient.

The present invention also provides a method for producing an antibacterial and immunomodulating composition comprising the step of culturing the strain.

In the present invention, Lactobacillus fermentum strain SI-1309 was isolated from a fermented fermented fish meal and classified and genetically identified. In addition, the expression of Toll-like receptor 2 (TLR 2) is increased by the above-mentioned strain, and the immune activity is increased through this, and the above-mentioned pathogen, Salmonella enterica enterica ), Staphylococcus ( Staphylococcus aureus) aureus , Staphylococcus epidermidis , Shigella flexneri , Shigella sonnei), Bacillus cereus (Bacillus cereus), Listeria mono cytokines to Ness (Listeria monocytogenes ) and Escherichia coli ( Escherichia coli ). Therefore, the present invention can be very usefully used in immunoconjugate and antibacterial compositions.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 is a graph showing the activity of Lactobacillus < RTI ID = 0.0 > fermentum ) SI-1309 strain.
Figure 2 is a photograph of the Lactobacillus < RTI ID = 0.0 > fermentum The expression level of Toll-like receptor 2 (Toll-like receptor 2) was measured 3 hours and 24 hours after treatment with strain SI-1309. HSH-102 is Lactobacillus fermentum HSH-102, HSH-124 is Lactobacillus fermentum HSH-124, HSH133 is a Lactobacillus fermentum HSH133 and HSH135 represent the lactobacillus fermentum SI-1309 strain isolated in the present invention.

In order to accomplish the above object, the present invention provides a method for inhibiting Toll-like receptor 2 (TLR2) mediated immune activity and Lactobacillus fermentation fermentum ) strain SI-1309 (KCTC 12843BP).

The Lactobacillus fermentum strain SI-1309 was isolated from salted fish and increased in expression of Toll-like receptor 2 (TLR 2), which is present in dendritic cells and induces immunological activity, Such as Salmonella enterica , Staphylococcus aureus , Staphylococcus epidermidis , Shigella flexneri , Shigella sonnei , Bacillus subtilis, Were selected as strains having excellent antimicrobial activity against Bacillus cereus , Listeria monocytogenes KCTC 3710 and Escherichia coli . The Lactobacillus fermentum strain SI-1309 was deposited on June 11, 2015 by the Korea Research Institute of Bioscience and Biotechnology (Accession No .: KCTC 12843BP).

In a method according to one embodiment of the invention, the pathogen is Salmonella enterica enterica ), Staphylococcus ( Staphylococcus aureus) aureus , Staphylococcus epidermidis , Shigella flexneri , Shigella sonnei), Bacillus cereus (Bacillus cereus), Listeria mono cytokines to Ness (Listeria monocytogenes KCTC 3710) or Escherichia coli (Escherichia coli ). < / RTI >

The present invention also relates to the aforementioned Lactobacillus fermentum fermentum SI-1309 strain or a culture thereof as an active ingredient.

The feed additive of the present invention is added to the base feed at a certain ratio. The basic diet may be composed of corn, soybean meal, whey, fish meal, molasses, salt, vitamin premix, and mineral premix. The vitamin premix can be composed of vitamin A, vitamin D, vitamin E, riboflavin and niacin, and the mineral premix can be composed of manganese, iron, zinc, calcium, copper, cobalt and selenium.

The content of the Lactobacillus perfumant SI-1309 strain or the culture thereof in the feed composition containing the antimicrobial and immunostimulating feed additive of the present invention can be appropriately selected according to species, age, body weight, May be 0.01 to 10% by weight based on the total weight of the feed.

The feed composition comprising the antimicrobial and immunostimulating feed additive of the present invention can be prepared according to a feed production method well known in the art. For example, various feed ingredients or compound feeds and the lactobacillus fermentum SI -1309 strain or a culture thereof, followed by further processing, for example, a step in the form of a pellet or a step in the form of a granule or the like.

It is apparent to those skilled in the art that the composition, composition, manufacturing method, feeding method and the like of the antimicrobial and immunostimulating feed composition of the present invention can be suitably selected from conventional techniques known in the art.

The present invention also relates to the aforementioned Lactobacillus fermentum fermentum SI-1309 strain or a culture thereof as an active ingredient.

The pharmaceutical composition for antibacterial and immunological enhancement of the present invention may be formulated into solid preparations such as powders, granules, tablets, capsules, and liquid preparations such as suspensions, emulsions and syrups, injections, , Suppositories, etc., and may be administered orally or parenterally.

The formulation method can be carried out according to a conventional method known in the art and can be suitably carried out using, for example, a filler, an extender, a binder, a wetting agent, a disintegrant, a surfactant, a lubricant, an excipient, .

The dosage of the Lactobacillus fermentum SI-1309 strain of the present invention or the culture thereof may be suitably selected according to the age, sex, weight, condition, disease severity, drug form, administration route and period of the subject to be administered.

It will be apparent to those skilled in the art that the method of formulation, dose, route of administration, components and the like of the pharmaceutical composition for antibacterial and immunological enhancement of the present invention can be suitably selected from conventional techniques known in the art.

The present invention also relates to the aforementioned Lactobacillus fermentum fermentum SI-1309 strain or a culture thereof as an active ingredient.

The food may be selected from the group consisting of dairy products (milk, soy milk, processed milk), fermented milk (liquid yogurt, yoghurt), drinks, meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, , An alcoholic beverage, and a vitamin complex, but the present invention is not limited thereto.

The food of the present invention may contain a functional food. In the functional food of the present invention, in addition to the above-mentioned active ingredients, various auxiliary ingredients may be added as necessary. In the case of the functional food of the present invention, vitamins such as vitamin A, vitamin B1, vitamin B2, vitamin B3, vitamin B6, vitamin B12, folic acid, vitamin C, vitamin D3 and vitamin E, Iron, magnesium, potassium, zinc, etc., or lactic acid bacteria.

In addition, among the functional foods of the present invention, the health drink may contain various flavors or natural carbohydrates as an additional ingredient such as ordinary beverages. Examples of the flavoring agent include natural sweetening agents such as tau martin and stevia extract, and synthetic sweetening agents such as saccharine and aspartame. Examples of natural carbohydrates include monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol and erythritol.

When the strain obtained in the step of culturing the strain of the present invention or a culture solution thereof is used as a food additive, the strain or the culture thereof may be directly added, used in combination with other food or food ingredients, . The amount of the active ingredient to be mixed can be suitably determined according to the purpose of use thereof.

The present invention also relates to the aforementioned Lactobacillus fermentum fermentum ) strain SI-1309 by culturing the strain of the present invention.

Any method known in the art can be used for culturing the strain, and the method is not particularly limited.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are merely illustrative of the present invention and that the scope of the present invention is not limited thereto.

Example  1. Isolation and preservation of lactic acid bacteria from fermented fish paste

To separate the lactic acid bacteria from the fermented fishes, various salted and fermented fish were minced aseptically. One gram of the fermented salted fish was suspended in 9 ml of sterilized physiological saline (0.85% NaCl), diluted stepwise and plated on MRS solid medium. After culturing at 30 ° C for 48 hours, strains of different colony forms were selected and purified. Then, the lactic acid bacteria purified from the fermented fish meal were plated on a MRS solid medium and cultured at 30 ° C. The colonies formed were suspended in a 20% glycerol solution and stored in a freezer at -80 ° C. to obtain a toll-like receptor 2 (Toll-like receptor 2).

Example  2. In mouse tissue Intermediate lobe  Stem Cells( Mesenchymal stem cell Separation and culture

Adipose tissue was collected from the femur of C57BL / 6 mice at 7 to 10 weeks of age, washed with PBS buffer, and cut. The sliced tissue was suspended in MEM (Minimun essential medium) cell culture medium containing 0.075% collagenase type I and mixed several times with a 10 ml pipette, followed by centrifugation at 1200 × g for 10 minutes to obtain supernatant And discarded cells. After being suspended in a 100-μm nylon mesh to remove the suspension, the suspension was suspended in Mesalut's Basal medium supplemented with 20% mesenchymal supplement (Stem Cell Technologies) and cultured in a 60 mm culture dish . Half of the cultures were replaced every 3 days. When the cell density reached about 95%, the cells were suspended using trypsin (0.05% EDTA, 0.25% trypsin) and subcultured.

Example  3. Toll-like receptor 2 by lactic acid bacteria Toll - like receptor  2) expression

Toll-like receptor 2 (TLR2) mRNA expressed in mesenchymal stem cells was confirmed by RT-PCR. Total RNAs were isolated from the cultured cells using a triazole reagent (Invitrogen). 1 g of total RNA was prepared by using ImProm-Reverse Transcription System (Promega) and amplified by PCR using a primer specific for TLR 2 shown in Table 1 below.

The lactic acid bacteria isolated from the fermented fish meal were inoculated into 10 ml of MRS medium (Difco), cultured at 30 ° C for 24 hours, and centrifuged to remove the supernatant. 10 ml of sterilized water was added to each cultured lactic acid bacteria, and the lactic acid bacteria were washed twice. The thus-prepared lactic acid bacteria were sterilized at 121 ° C for 15 minutes, and all the lactic acid bacteria were killed to prevent the contamination in the subsequent experiments. Cells expressing tol-like receptor 2 were inoculated with 100 μl of each lactic acid bacterium, and the expression of tol-like receptor 2 was confirmed after 3 hours and 24 hours. As a result, as shown in FIG. 2, it was confirmed that the Lactobacillus fermentum SI-1309 strain of the present invention showed an increase in the expression of tole-like receptor 2 as compared with the negative control and other lactic acid bacteria.

The primers used in the present invention primer
name
Sequence information (5'-3 ') Forward (SEQ ID NO) Reverse (SEQ ID NO) TLR 2 ATGCAAAGTGCCATGTTCCTGG (SEQ ID NO: 1) TCATGTAGCATGGGGCTCCG (SEQ ID NO: 2)

Example  4: Separated from the seabass Lactobacillus  Perumtum ( Lactobacillus  fermentum ) SI Taxonomic Characteristics and Genetic Identification of the -1309 Strains

The identification of the selected Lactobacillus fermentum SI-1309 strains was carried out by the method of Brucey's Manual of Determinative Bacteriology, and morphological and biochemical characteristics were determined. The optimum growth temperature, Gram stain, Sequences of 16S rRNA were analyzed for motility, catalase test, presence of CO ₂ production and genetic identification. As a result, as shown in the following Table 2, the Lactobacillus fermentum SI-1309 strain isolated according to the present invention contained the standard strain Lactobacillus < RTI ID = 0.0 > fermentum ) IFO 3956 strain. Finally, homology to the 16S rRNA sequence of the Lactobacillus perfumant SI-1309 strain was analyzed using the BLAST program of NCBI, and it was identified as Lactobacillus fermentum with 99% confidence. In addition, the strain was treated with Lactobacillus < RTI ID = 0.0 > fermentum ) was named SI-1309 strain.

The identification result of the Lactobacillus fermentum SI-1309 strain of the present invention characteristic Lactobacillus fermentum
SI-1309 Lactobacillus fermentum
IFO 3956 Gram / form + / R + / R Spore - - motility - - Aerobic growth + + Anaerobic proliferation + + Catalase - - Oxydase - - Glucose (acid) + + Oxidation / Fermentation Test F F Gas production from glucose - - Growth at 15 ℃ + + Proliferation at 45 ° C - - Foges-Proscar Test - - Nitrate reduction - - Gelatin hydrolysis - - Esculin hydrolysis + + Arginine hydrolysis - - From Amigallin Carbohydrates, acids + + L-arabinose + + Cellobiose + + Esculin + + Fructose + + Galactose + + Gluconate + + Lactose + + maltose + + Mannitol + + Mannoose + + Meletitose + + Melly bios + + Rafinose + + Rhamnoose - - Ribose + + Salincin + + Sorbitol + + Sucrose + + Trehalose + + Xylose - D

+: Positive reaction

-: negative reaction

R: Round

F: Fermentation

Biochemical properties of the lactobacillus fermentum SI-1309 strain of the present invention carbohydrate Lactobacillus fermentum
SI-1309 carbohydrate Lactobacillus fermentum
SI-1309 Control - Esculin - Glycerol - Salincin - Erythritol - D-cellobiose - D-arabinose - D-maltose + L-arabinose - D-lactose + Ribose + D-melibiose + D-gyros - D-saccharose + L-gyros - D-trehalose - Adonitol - Inulin - Methyl-B-D-xylopyranoside - D-Melitose - D-galactose + D-raffinose + D-glucose + Amicon - D-fructose + Glycogen - D-mannose + Jalalitol - L-sorbose - Gentiobios - L-rhamnose - D-Turanos - Dissytol - D-Rick Source - Inositol - D-Tagatose - D-mannitol - D-fucose - D-sorbitol - L-fucose - Methyl-a, D-mannopyranoside - D-arabitol - Methyl-a, D-glucopyranoside - L-arabitol - N-ethyl-glucosamine - Gluconate - Amigalline - 2-keto-gluconate - Arbutin - 5-keto-gluconate -

+: Positive reaction

-: negative reaction

Example  5: Lactobacillus Fermantum ( Lactobacillus fermentum ) SI Antibacterial activity against the pathogen of -1309 strain

In the same manner as in Example 1, Lactobacillus fermentum SI-1309 The culture supernatant was added to Staphylococcus ( Staphylococcus aureus) aureus, Korea Research Institute of Bioscience and Biotechnology Biological Resource Center, KCTC 1928), Bacillus cereus (Bacillus cereus , KCTC 3624, Korea Research Institute of Bioscience and Biotechnology), and cultured for 24 hours or more at the optimal growth temperature of each indicator strain to determine the inhibition zone It was confirmed whether or not it was generated. Bacteriocin activity unit (AU / ml) was determined by multiplying the bacteriocin concentration by the reciprocal of the maximum dilution factor to dilute the culture supernatant twice, Respectively. As a result, as shown in Table 4, Salmonella enterica enterica ), Staphylococcus ( Staphylococcus aureus) aureus , Staphylococcus epidermidis , Shigella flexneri , Shigella sonnei), Bacillus cereus (Bacillus cereus), Listeria mono cytokines to Ness (Listeria monocytogenes KCTC 3710) and Escherichia coli (Escherichia coli ) was found to have a growth inhibitory effect.

The Lactobacillus fermentum SI-1309 Antimicrobial activity of strain Indication strain Antimicrobial activity
Bacteriocin active unit
(AU / ml) Shortened inhibition ring
(mm) Escherichia coli CFT073 ATCC 700928 33 24 Erwinia Laponti City KCTC 2567 - - Bacillus cereus KCTC 3624 132 51 Listeria monocytogenes KCTC 3710 33 24 Staphylococcus aureus KCTC 1928 66 28 Staphylococcus epidemidis KCTC 3958 66 29 Salmonella enterica KCTC 1925 132 42 Salmonella entericica KCTC 1926 66 29 Shigella flexneri KCTC 2517 66 32 Shigella Sonnay KCTC 2518 33 18

Korea Biotechnology Research Institute KCTC12843BP 20150611

<110> SUNILBIO Co., Ltd. <120> Lactobacillus fermentum strain SI-1309 isolated from pickled fish          having toll-like receptor 2-mediated immune activity and          antimicrobial activity against pathogen and use thereof <130> PN15164 <160> 2 <170> Kopatentin 2.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 atgcaaagtg ccatgttcct gg 22 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 tcatgtagca tggggctccg 20

Claims (7)

The expression of Toll-like receptor 2 is increased, and the expression of Salmonella enterica , Staphylococcus aureus , Staphylococcus epidermidis , A lactose-derived lactose having antibacterial activity against Shigella flexneri , Shigella sonnei , Bacillus cereus , Listeria monocytogenes or Escherichia coli Lactobacillus fermentum strain SI-1309 (KCTC 12843BP). delete delete A method for producing the Lactobacillus fermentum strain SI-1309 of claim 1 or a culture thereof containing Salmonella enterica , Staphylococcus aureus , Staphylococcus epidemidis For example, Staphylococcus epidermidis , Shigella flexneri , Shigella sonnei , Bacillus cereus , Listeria monocytogenes or Escherichia coli . An antimicrobial feed additive composition. delete A method for producing the Lactobacillus fermentum strain SI-1309 of claim 1 or a culture thereof containing Salmonella enterica , Staphylococcus aureus , Staphylococcus epidemidis For example, Staphylococcus epidermidis , Shigella flexneri , Shigella sonnei , Bacillus cereus , Listeria monocytogenes or Escherichia coli . Antibacterial health food composition. The method of claim 1, further comprising the step of culturing a strain of Lactobacillus fermentum SI-1309, wherein said strain is selected from the group consisting of Salmonella enterica , Staphylococcus aureus , Staphylococcus epidermidis ), Shigella flexneri , Shigella sonnei , Bacillus cereus , Listeria monocytogenes or Escherichia coli for antimicrobial use &Lt; / RTI &gt;

Images