KR101742972B1 - A heat shock transcription factor gene, CaHsfB1 and transgenic plants using the same gene - Google Patents

Abstract

The present invention relates to a defense-related heat shock transcription factor gene CaHsfB1 of pepper plants and a transgenic plant using the same. Since the pepper heat shock transcription factor of the present invention acts as a positive regulator of the defense reaction in the virus-induced disease-resistance reaction according to the temperature change, the production effect of the transgenic plant using the pepper- It can contribute to the production of high-quality clean crops suitable for the times and the activation of various industries connected with them.

Description

[0001] The present invention relates to a plant-specific heat shock transcription factor gene, CaHsfB1, and a transgenic plant using the same, wherein the heat shock transcription factor gene, CaHsfB1 and transgenic plants using the same gene,

The present invention relates to a defense-related heat shock transcription factor gene CaHsfB1 And a transgenic plant using the same.

Differences in daytime and nighttime temperature in planted areas and changes in temperature due to seasonal changes are important environmental factors affecting plant growth and development (Long and Woodward, 1988). However, it is not known exactly how plants respond to changes in temperature during the day or seasonal changes in temperature (Penfield 2008). In addition, temperature changes are known to affect resistance responses to bacteria, fungi, viruses, insects, etc. (Garrett et al. 2006), especially high temperatures are known to inhibit plant immune responses (Dropkin 1969). Despite these changes in temperature affecting plant disease resistance and agricultural productivity, little is known about the molecular biology of plant immune responses to temperature changes. Heat shock transcription factor is a protein that is common to bacteria, fungi, and animals. It plays a role not only to recognize external temperature changes but also to protect cells from various stresses applied to organisms (Chen and Parker 2002). The basic structure and target DNA binding sites (eg, heat shock elements) that make up this transcription factor protein are common from bacteria, yeast to humans (Wu 1995). Yeast and humans have one and three heat shock transcription factors, respectively (Nakai 1999), while plants have a large number of transcription factors. It has been shown that 21 Arabidopsis thaliana and 23 rice heat shock transcription factors (Nover et al., 2001; von Koskull-Doring et al., 2007). Recent studies have shown that plant heat shock transcription factors respond to environmental factors in addition to temperature changes (Baniwal et al., 2004; Yokotani et al., 2008). Inhibition of HsfA1a expression in tomatoes is highly sensitive to high-temperature stress (Mishra et al., 2002) . If HsfA4d in rice is abnormal, it becomes highly sensitive to high temperature and causes necrotizing symptoms. It has been found that heat shock transcription factors participate not only in non-biotic environmental stress but also in biological stress. Arabidopsis HsfB1 and HsfB2b are known to be involved in the expression of PDF 1.2 and resistance to pathogens (Kumar et al. 2009). In addition, Arabidopsis HsfB1 has been shown to play a key role in regulating the balance between plant growth and disease-resistant responses (Pajerowska-Mukhtar et al., 2012).

On the other hand, red pepper and tobacco are one of the most cultivated crops in Korea. These peppers. Viruses, bacteria, fungi, etc. have been reported as pathogenic bacteria in tobacco plants. In Korea, the production rate decreases frequently due to various diseases after the rainy season. In addition, the increase in temperature due to global warming causes a double problem of increase of disease caused by existing pathogens and generation of new pathogens in the cultivation area of crops. However, until now, it is totally dependent on chemical control for crop protection. In particular, the genes related to hypersensitivity cell death and systemic resistance resistance in pepper plants have not yet been isolated, and molecular cloning of these genes has been carried out to identify the molecular expression regulation and function of these genes in the signal transduction pathway There is a need to do. Identification of the characteristics of heat shock transcription factors of pepper plants obtained through the isolation of effective defense-related genes using biotechnological techniques that can complement the disadvantages of the development of new resistant crops using traditional breeding and reduction of production costs by producing transgenic plants To increase the income of farm households and to produce high quality clean crops for the eco-friendly period and contribute to the activation of various industries connected with this. Therefore, there is an urgent need to study how to produce plants such as red pepper, tobacco, and Arabidopsis which have improved disease resistance by using biotechnological techniques.

The present inventors have completed the present invention by discovering the plant-specific thermal shock transcription factor gene CaHsfB1 for defense of pepper plants in the disease resistance reaction induced by TMV-P ₀ .

Accordingly, an object of the present invention is to provide a heat shock transcription factor gene CaHsfB1 consisting of the nucleotide sequence of SEQ ID NO: 1.

Another object of the present invention is to provide a protein consisting of the amino acid sequence of SEQ ID NO: 2.

Another object of the present invention is to provide a vector containing the gene, a plant transformed cell transformed with the vector.

Another object of the present invention is to provide a method for producing a viral disease resistant plant comprising the step of preparing a vector containing the gene and introducing the vector into the plant, and a method for increasing the viral disease resistance of the plant.

In order to achieve the above object, the present invention provides a heat shock transcription factor gene CaHsfB1 comprising the nucleotide sequence of SEQ ID NO: 1.

In addition, the present invention provides a protein consisting of the amino acid sequence of SEQ ID NO: 2.

The present invention also provides a vector comprising the gene.

The present invention also provides a plant transformed cell transformed with said vector.

The present invention also provides a method for producing a vector comprising the steps of: 1) preparing a vector comprising a gene consisting of the nucleotide sequence of SEQ ID NO: 1; 2) preparing a plant transformed cell transformed with the vector prepared in the step 1); And 3) preparing a plant with the plant transformed cell prepared in the step 2); And a method for producing a virus-resistant plant.

The present invention also provides a method for producing a vector comprising the steps of: 1) preparing a vector comprising a gene consisting of the nucleotide sequence of SEQ ID NO: 1; And 2) increasing the expression of CaHsfB1 by introducing the vector prepared in the step 1) into a plant; To increase the resistance of the plant to viral diseases.

Since the pepper heat shock transcription factor of the present invention acts as a positive regulator of the defense reaction in the virus-induced disease-resistance reaction according to the temperature change, the production effect of the transgenic plant using the pepper- It can contribute to the production of high-quality clean crops suitable for the times and the activation of various industries connected with them.

Figure 1 is a graph showing the effect of CaHsfB1 Fig. 3 shows the nucleotide sequence of the gene.
2 is a diagram showing the nucleotide sequence and amino acid sequence of NbHsfB1 of tobacco.
FIG. 3 is a diagram showing the results of comparing amino acid sequences of CaHsfB1 derived from pepper with AtHsfB1, AtHsfB2a, AtHsfB2b, AtHsfB3, AtHsfB4 and tobacco-derived amino acid sequences derived from Arabidopsis thaliana.
FIG. 4 is a diagram showing the amino acid sequences of CaHsfB1 derived from pepper and AtHsfB1, AtHsfB2a, AtHsfB2b, AtHsfB3 and AtHsfB4 derived from Arabidopsis thaliana and amino acid sequences of NbHsfB1 derived from tobacco.
FIG. 5 is a graph showing the effect of CaHsfB1 And the expression of the gene was confirmed by qRT-PCR.
FIG. 6 is a graph showing the relationship between TMV-P ₀ CaHsfB1 due to virus infection And the expression of the gene was confirmed by qRT-PCR.
Figure 7 CaHsfB1 - a diagram showing the result confirming the expression level of the gene in CaHsfB1 silence plant.
Figure 8 FIG. 5 shows the result of confirming hypersensitive cell death through DAB staining and trypan blue (TPB) staining in CaHsfB1 -silenced plants.
FIG. 9 shows the results of qRT-PCR for expression of the capsid- related genes ( CaPR1 , CaPR10 ) caused by TMV-P ₀ virus infection in CaHsfB1 -silent plants.
FIG. 10 is a graph showing the results of the hypersensitive cell death induced by the interaction of CaL ² and TMV-P ₀ CP in NbHsfB1 -silent plants. FIG.
11 is a graph The phenotype of the overexpressed gene was confirmed.
Figure 12 shows that CaHsfB1 The position of the CaHsfB1 protein in the overexpression of the gene was confirmed.

Hereinafter, the present invention will be described in detail.

The present invention provides a heat shock transcription factor gene CaHsfB1 comprising the nucleotide sequence of SEQ ID NO: 1.

The present CaHsfB1 The cDNA nucleotide sequence of the gene is 1881 bp, and expression is increased by infection with tobacco mosaic virus-P ₀ (TMV-P ₀ ).

The term "heat shock transcription factor" in the present invention is a transcriptional regulator that governs transcriptional promotion by thermal shock. In normal eukaryotic cells, heat shock transcription factors are present in the cell matrix in an inactive form, and when the cells are subjected to thermal shock, they are activated to move into the nucleus and function by promoting the transcription of the heat shock gene.

The present invention relates to a method for producing CaHsfB1 Genes, homologous homologs thereof, and variants thereof. The thermal shock transcription factor CaHsfB1 also comprises a protein consisting of the amino acid sequence of SEQ ID NO: 2 and a functional equivalent of said protein. Is at least 70%, preferably at least 80%, more preferably at least 90%, even more preferably at least 70%, more preferably at least 90%, more preferably at least 90% Refers to a protein having substantially the same physiological activity as a protein having an amino acid sequence represented by SEQ ID NO: 2, having a sequence homology of 95% or more. In addition, the heat shock transcription factor CaHsfB1 of the present invention includes not only the protein having the native amino acid sequence but also its variants, within the scope of the present invention. By such variant is meant a protein having a sequence that differs by the deletion, insertion, non-conservative or conservative substitution, or a combination thereof, of the amino acid sequence of the thermal shock transcription factor CaHsfB1 and one or more amino acid residues.

The pepper heat shock transcription factor CaHsfB1 of the present invention acts as a regulator of the defense reaction according to the temperature change in the disease-resistant reaction induced by tobacco mosaic virus-P ₀ (TMV-P ₀ ), and particularly the expression level increases at high temperature. In one embodiment of the present invention, the high temperature of 45 ° C was applied to pepper to increase the expression level of the CaHsfB1 gene. In addition, CaHsfB1 of the present invention is an important factor controlling the apoptosis of plants by being involved in virus resistance.

The present invention also provides a vector comprising a heat shock transcription factor gene CaHsfB1 consisting of the nucleotide sequence of SEQ ID NO: 1.

The term "vector" in the present invention is used to refer to a DNA fragment (s), a nucleic acid molecule, which is transferred into a cell. The vector replicates the DNA and can be independently regenerated in the host cell. Vector refers to a recombinant DNA molecule comprising a desired coding sequence and a suitable nucleic acid sequence necessary for expressing a coding sequence operably linked in a particular host organism. The vector used for inserting the heat shock transcription factor gene CaHsfB1 consisting of the nucleotide sequence of SEQ ID NO: 1 may be a pCAMBIA2300 vector or a pGWB vector as long as it is a general plant transformation expression vector. In one embodiment of the present invention, CaHsfB1 The pGWB405 vector for plant transformation was used to insert the gene.

The present invention also provides a viral disease resistant plant transformed cell transformed with a vector containing the heat shock transcription factor gene CaHsfB1 to increase the expression of CaHsfB1. The plant cell into which the vector is introduced in the present invention is not particularly limited as long as the cell can be regenerated into a plant, but the plant cell is not limited to a specific form, but may be, for example, a cultured cell suspension, a protoplast, a leaf section and a callus . The vector containing the heat shock transcription factor gene CaHsfB1 may be prepared by a known method such as a polyethylene glycol method, an electroporation method, a Agrobacterium-mediated transfer and a particle bombardment method And can be introduced into plant cells by the method.

The plants used for the production of plant transformed cells in the present invention may be any plants regardless of dicotyledonous or monocotyledonous plants, but may be preferably pepper, Arabidopsis or cigarette.

In the present invention, the viruses may be selected from the group consisting of Cucumber mosaic virus (CMV), Pepper mottle virus (PepMoV), Pepper mild mottle virus (PMMoV) Tobacco mild green mosaic virus (TMGMV), Tomato spotted wilt virus (TSWV) and TMV-P ₀ (Tobacco mosaic virus-P ₀ ), and the virus belonging to the tobacco mosaic virus group can be included without limitation, but preferably TMV-P ₀ Virus.

The present invention also provides a method for producing a vector comprising the steps of: 1) preparing a vector comprising a gene consisting of the nucleotide sequence of SEQ ID NO: 1; 2) preparing a plant transformed cell transformed with the vector prepared in the step 1); And 3) preparing a plant with the plant transformed cell prepared in the step 2); And a method for producing a virus-resistant plant.

In the present invention, the vector used for inserting the heat shock transcription factor gene CaHsfB1 consisting of the nucleotide sequence of SEQ ID NO: 1 may be any expression vector for general plant transformation. In one embodiment of the present invention, the CaHsfB1 gene To insert the plant, a plant overexpressing CaHsfB1 was prepared using the pGWB405 vector for plant transformation.

The present invention provides a method for producing a virus-resistant plant by regenerating the plant transformed cells by a tissue culture method. Regeneration through the manipulation culture of the present invention is preferably carried out through a general transformation plant manufacturing process.

The present invention also provides a method for producing a vector comprising the steps of: 1) preparing a vector comprising a gene consisting of the nucleotide sequence of SEQ ID NO: 1; And 2) increasing the expression of CaHsfB1 by introducing the vector prepared in the step 1) into a plant; To increase the resistance of the plant to viral diseases.

According to the method of increasing the virus resistance of the plant of the present invention, it is possible to increase the resistance of the plant to viral diseases by controlling the hypersensitive cell death by the thermal shock caused by the high temperature treatment.

In the present invention, "hypersensitive cell death" is local cell death, which is one of the defense mechanisms of plants. Plants develop various resistance mechanisms to defend themselves against attack by pathogens, which can induce hypersensitive cell death at the pathogen-infected sites and thus protect against pathogens. According to the method of the present invention, the CaHsfB1 thermal shock transcription factor has an effect of increasing the temperature-dependent disease resistance in the virus-induced defense reaction of the virus.

Terms not otherwise defined herein have meanings as commonly used in the art to which the present invention belongs.

Hereinafter, the present invention will be described in detail with reference to examples. However, the following examples are illustrative of the present invention, and the content of the present invention is not limited by the following.

Experimental Example  1 - DNA Isolation and Sequencing

Tobacco mosaic virus -P ₀ (TMV-P ₀₎ of the microarray results of the peppers were infected, some factors that were specifically expressed by the increase in resistance during the reaction, a significant increase in expression in response to TMV-P ₀ of which CaHsfB1 Genes were selected.

PCR was used to detect CaHsfB1 The cDNA fragment of the gene was obtained and the base sequence was determined. As a result of sequencing, this nucleotide sequence was confirmed to be the same as the sequence information of the pepper genome performed in the pepper genome laboratory (Prof. As shown in Fig. 1, CaHsfB1 The cDNA nucleic acid sequence is 1881 bp.

In addition, CaHsfB1 The gene encodes a single protein with a molecular weight of 33.7 kDa and has HSF DNA binding domain, one nuclear localization signal domain and a repressor domain. The nucleotide sequence and amino acid sequence of tobacco NbHsfB1, which is homologous to CaHsfB1 in pepper, is shown in Figure 2 in the Sol genomic network (http://solgenomics.net/). The amino acid sequences of the two genes were compared with those of 88.2 % Homology.

The results of comparing the amino acid sequences of CaHsfB1 derived from pepper with AtHsfB1, AtHsfB2a, AtHsfB2b, AtHsfB3, AtHsfB4 and tobacco-derived amino acid sequences derived from Arabidopsis thaliana are shown in FIG. The similarity between the genes is shown in Fig. 4 as a phylogenetic tree in which the length of the horizon represents the dissimilarity between the associated sequences, and the number below the line represents the relative distance from the adjacent node. As shown in FIG. 4, it was confirmed that AtHsfB1 among the genes derived from Arabidopsis is most similar to CaHsfB1 of the present invention. The similarity of two base sequences and amino acid sequences derived from different plants means that the structures of the proteins are similar. Since the structure of the protein is a key factor in determining its function, the base sequence and amino acid sequence of AtHsfB1 derived from Arabidopsis and the tobacco-derived NbHsfB1 are similar to the base sequence and amino acid sequence of CaHsfB1 derived from red pepper, Has a gene with a similar function. This indicates the importance of this gene in plants, suggesting that the CaHsfB1 gene plays an important role in pepper.

Experimental Example  2 - By high temperature treatment CaHsfB1 Identification of gene expression

CaHsfB1 The leaves were collected at 0, 1, 2, 6, 12, 24, 48 and 72 hours after exposing the 2-month-old red pepper to the environment at 45 ° C in the chamber, Frozen in liquid nitrogen and stored at -80 ° C. As a control group, pepper leaves exposed to 26 ° C environment were used. The qRT-PCR was performed in the pepper leaf samples as in Experimental Example 2.2, and the relative expression level obtained by qRT-PCR was normalized to the expression of the CaActin gene. The results are shown in FIG.

As shown in Fig. 5, when treated at a high temperature of 45 DEG C compared to 26 DEG C, CaHsfB1 Gene overexpression. Therefore, CaHsfB1 Gene was confirmed to be a thermal shock factor induced by high temperature.

Experimental Example  3 - Depending on temperature due to viral infection CaHsfB1  Identification of gene expression

3.1 TMV - P ₀  Inoculation of virus

Virus-sensitive wild cigarette ( Nicotiana benthamiana ) was used as a plant material for securing TMV-P ₀ virus. Tobacco plants were grown in a growth chamber at 26 ° C, 31 ° C, and 34 ° C in a light period of 16h light / 8h dark. Healthy, well-picked leaves collected from 4-week-old tobacco plants were harvested from TMV-P ₀ Viruses and used for nucleic acid extraction. Three-week-old wild tobacco ( Nicotiana benthamiana ) leaves infected with TMV-P ₀ with 10 mM Potassium Phosphate buffer were prepared and leaf sap containing TMV-P ₀ was prepared.

To inoculate pepper plants, TMV-P ₀ 10 ml of the virus-containing fluid and 0.5 g of carborundum (Hayashi Chemical, Japan) were mixed and rubbed on the surface of the 4th or 5th fully developed leaves of the pepper plants to thereby obtain a red pepper plant infected with TMV-P ₀ virus . As a control, mock - inoculated plants (Mock) were used with potassium phosphate buffer and pepper plants rubbed with carborundum alone.

3.2 Due to virus infection CaHsfB1 Identification of gene expression

Pepper plants infected with the virus produced in 3.1 by the inoculation of TMV-P ₀ CaHsfB1 RT-PCR and qRT-PCR were used to analyze expression levels.

Specifically, 50 mg of red pepper leaves were ground in a mortar and pestle to make a light green powder in liquid nitrogen. Total RNA (total RNA) was extracted at 0 and 72 hours after inoculation using the QIAGEN RNeasy Mini Kit (Cat. No. 74106). 5 μg of the extracted total RNA was treated with M-MLV reverse transcriptase (Promega, USA) and subjected to RT-PCR to obtain cDNA. RT-Each first-strand cDNA product was amplified by PCR. The amplified cDNA was subjected to qRT-PCR using the KAPA SYBR FAST qPCR Kit (KAPA BIOSYSTEM) and the LightCycler 480 (Roche, Germany) as a gene-specific primer shown in Table 1 below.

gene order CaHsfB1 Forward CGTCAGCTTAACACCTATGG Reverse ACCTATCTCATCCCCAGAAT CaActin Forward GTGCTGAGAGATTCCGTTGC Reverse ATGGTTGAGCCACCACTGAG

The qRT-PCR result of CaHsfB1 The relative expression levels of the genes were analyzed by CaActin , a house keeping gene present in pepper And normalized by expression of the gene, as shown in Fig. As shown in FIG. 6, when TMV-P ₀ was inoculated into pepper, the expression of CaHsfB1 was increased at 26 ° C, 31 ° C and 34 ° C as compared with the control. On the other hand, it was confirmed that the increase was decreased at 34 ℃. Therefore, CaHsfB1 Gene was induced by TMV-P ₀ virus infection and the expression level was specifically changed according to temperature. In particular, CaHsfB1 related virus resistance at a temperature (34 < 0 > C) at which the resistance of the red pepper to the virus decreases Gene Expression also decreases proportionally at 34 ° C, indicating that pepper is virus resistant. CaHsfB1 And the amount of gene expression plays an important role.

Example  One - CaHsfB1 Confirmation of hypersensitive cell death by silencing of

1.1 Virus-induced gene silencing, VIGS ) CaHsfB1 - Manufacture of silent plants

A fragment containing the 324-bp ORF and 3 'UTR of CaHsfB1 amplified by PCR was amplified by PCR using the primer set forth in Table 2 below at the Bam H1 site of the TRV2 vector (Liu et al., 2002; Chung et al., 2004) . The pTRV2 and pTRV2- CaHsfB1 Agrobacterium Tome Pacifico Enschede (Agrobacterium tumefaciens strain GV3101) and the transformed Agrobacterium was selected on YEP medium containing 50 mg kanamycin and 100 mg rifampicin. The transformant was grown at 28 ° C for two days. After centrifugation, Agrobacterium was diluted in a buffer containing 10 mM MES-KOH (pH 5.7), 10 mM MgSO ₄ and 200 μM acetosyringone to obtain A ₆₀₀ 0.15 was re-suspended until, transformant culture comprises a pTRV2 and pTRV2- CaHsfB1 is Agrobacterium tumefaciens (A. tumifaciens) and one containing the vector TRV1: mixed in ratio 1. The mixture cultured at room temperature for 2 to 4 hours was inoculated with pTRV2 (control) and pTRV2- CaHsfB1 vector by agroinfiltration to 2-week-old pepper plants.

order Forward 5'-GGATCCTAGAAGAACAAGGTAGTTACAATGA-3 ' Reverse 5'-GGATCCGAAATCCAAATGAAATTACTAAATC-3 '

1.2 CaHsfB1 - Identification of hypersensitive cell death in silent plants

In order to confirm the function of the CaHsfB1 gene, DAH (3,3'-Diaminobenzidine) staining and trypan blue staining were performed on the CaHsfB1 -silent plants prepared in Example 1.1 above. Specifically, TMV-P ₀ was inoculated on the upper leaf one month after the Agroin filtration in Example 1.1, and after 3 days from inoculation, the control plant (TRV2) and the CaHsfB1- silent plant (TRV2- CaHsfB1 ) The cut leaves were transferred to a 50 ml tube containing a tree plate blue (TPB) solution (10 g phenol, 10 ml glycerol, 10 ml lactic acid, 10 ml water and 0.02 g Trypan blue). The following triflate blue solution was boiled for 5 minutes and then exposed to a vacuum for 5 minutes. After overnight storage in the dark, it was transferred to 2.5 g / ml of a chloral hydrate solution and decolorized for one week. The results are shown in FIGS. 7 and 8. Plants were cultured at 26 ° C.

As shown in Figure 7 CaHsfB1 - results of the qRT-PCR using specific primers, CaHsfB1 - - gene shown in Table 1 in a sample obtained from the silence plant and control because the CaHsfB1 gene expression level in the silence plant is lower than in the control group The plants used for the experiment were CaHsfB1 Silence-plant.

Trifan blue staining can be used to visualize hypersensitive cell death induced by TMV-P ₀ infection. As shown in Fig. 8, at the normal temperature of 26 캜, it was confirmed that hypersensitive cell death, which appeared as a dotted pattern in the CaHsfB1 - silent plant, was reduced compared with the control group. The reduction of hypersensitive cell death, which is a typical virus resistance response of pepper, in CaHsfB1 - silenced plants implies that CaHsfB1 contributes to resistance to TMV-P ₀ through controlled apoptosis.

1.3 CaHsfB1 - Identification of the expression level of genes related to red pepper disease in silent plants

CaHsfB1 CaHsfB1 to check the function of the gene-process the TMV-P ₀ to silence plant and related pepper bottle in the manner described in Experimental Example 3 after three days CaPR ( Capsicum annuum pathogenesis-related ) gene, and the gene-specific primers shown in Table 3 below were used. As a control, a mock-inoculated plant (Mock) inoculated with potassium phosphate buffer solution and carborundum alone was used, and the expression level of the pepper disease-related gene was measured by CaActin The results are shown in Fig.

gene order CaPR1 Forward ATCCAGCAGTACTATGCTAT Reverse AACAGTAACGTACTCCACAG CaPR10 Forward CTGTCTATGTTTAAGCCAATGACC Reverse port AAAGTTCTTTCCATGACAACCAAT

As shown in Fig. 9, when the TMV-P ₀ was inoculated in the CaHsfB1 - silent plant compared with the control group, CaPR1 And CaPR10 All of the mRNA expression levels of the genes were decreased. Therefore, when the target gene of CaHsfB1 is CaPR1 And CaPR10 .

Example  2 - In cigarettes NbHsfB1 Identification of gene function

As shown in Experimental Example 1, CaHsfB1 NbHsfB1 of genes and tobacco Since the gene is highly homologous, NbHsfB1 The gene is also CaHsfB1 NbHsfB1 -silent plants were prepared using VIGS as described in Example 1.1 above to confirm that they had similar functions to genes. To induce hypersensitive apoptosis, which is a virus-resistant response to TMV-P ₀ in red pepper, in wild tobacco, 3-week-old wild cigarettes ( Nicotiana After three weeks of agroinfiltration into benthamiana leaves, Agrobacterium capable of expressing CaL ² and TMV-P ₀ CP proteins was infiltrated into the expanded leaves.

After infiltration , hypersensitive apoptosis induced by the interaction of CaL ² and TMV-P ₀ CP on NbHsfB1 -silent plants was observed, and the results are shown in FIG. As a result, we observed a phenotype in which hypersensitive cell death was reduced in wild tobacco NbHsfB1 - silent plants as in pepper CaHsfB1 - silent plants. Therefore NbHsfB1 - silenced plants also can be seen to contribute to the response to viral resistance has a similar function as the CaHsfB1- silenced plants.

Example  3 - CaHsfB1  Identification of hypersensitive cell death by gene overexpression

3.1 CaHsfB1 Over-expression of genes

CaHsfB1 To confirm the function of the gene, CaHsfBl :: GFP fusion protein was used to express CaHsfB1 Overexpression of the gene was prepared and its phenotype was observed.

Specifically, as the template, CaHsfB1 cDNA was used and primers as shown in Table 4 below were used to amplify CaHsfB1 An open reading frame (ORF) was prepared. And inserted into the pDONR201 vector (Invitrogen, USA) through a reaction using Gateway BP clonase. Inserted pDONR201- CaHsfB1 and destination vector pGWB405 and Gateway LR clonase were used to exchange the inserted gene. Finally, pGWB405- CaHsfB1 was obtained. Using the vector obtained pGWB405- CaHsfB1 Agrobacterium Tome Pacific Enschede (Agrobacterium tumefaciens strain GV3101). Transgenic Agrobacterium wild tobacco (Nicotiana the (Agrobacterium) benthamiana ) were inoculated with the agroinfiltration method. Tobacco was cultured at 26 ℃ and 31 ℃, respectively.

order Forward GGGGACAAGTTTGTACAAAAAAAGCAGGCTTCATGTCGCAAAGGACAGCGCC Reverse GGGGACCACTTTGTACAAGAAAGCTGGGTCTCCGTTACAAACCTTGCTGC

The phenotype of CaHsfBl :: GFP overexpressed 2 days after inoculation of Agrobacterium is shown in Fig.

As shown in FIG. 11, at 26 ° C, unlike the region overexpressed with GFP, apoptosis was observed at the site of CaHsfBl :: GFP overexpression, and cell death was observed at the region overexpressing CaHsfBl :: GFP at 31 ° C. CaHsfB1 overexpression is similar to that caused by hypersensitive cell death, and CaHsfB1 contributes to viral disease resistance because hypersensitive cell death is derived only by overexpression of CaHsfB1.

3.2 CaHsfB1  Protein Intracellular  Location verification

The CaHsfB1 obtained in Example 3.1 The intracellular location of the CaHsfB1 protein was confirmed using GFP of the overexpressed gene.

In order to observe the intracellular location on the 2nd day after induction of overexpression by the agroinfiltration method, a fluorescence image was observed with a UV light incident fluorescence microscope equipped with fluorescence isothiocyanate filters (excitation filter 520 nm emission filter 488, Zeiss, Axioskop, Germany). The results are shown in FIG. As shown in Fig. 12, it was confirmed that the CaHsfB1 protein is located in the nucleus of the cell, and it can be seen that CaHsfB1 functions as a transcriptional regulator.

Therefore, CaHsfB1 acts as a transcriptional regulator in the nucleus at temperatures below 30 ℃ to increase the virus resistance of plants, and at temperatures above 31 ℃, CaHsfB1 And it was confirmed that the function was decreased through reduction of gene expression amount.

<110> Korea University Research and Business Foundation <120> A heat shock transcription factor gene, CaHsfB1 and transgenic          plants using the same gene <130> 1_53P <160> 2 <170> Kopatentin 2.0 <210> 1 <211> 1881 <212> DNA <213> Capsicum annuum <400> 1 agtatagagt accttttttt agttcctctt cgaaaagtct tctaaatatt tctagaacct 60 cttagtactt gtattaaatt atctattccc attcgttttt ctcttccatt acctactact 120 atttctttct atccatcaat ttttatactc aaatcttcaa gaagagagag agagagagag 180 agaaaaggca gaaatttctg agctttttat tagagaacat atagatagtt atggtcgtgt 240 tgttcctggt gaagtttggc aaagttgtag ccaatggaag attctaagat catcatcagt 300 cgtcacaaaa acaatctcgt tcattctatt gtctttcttt tcggttttta ttgttgggat 360 tgggaattcc tcactgctct tttgcttttc agttactgct ccttctaatt taatttcctc 420 cttaggatct tgtcaattaa aattacagct aactcgtaat aagcccaaaa atctccaaag 480 gggatttttt tttttccaaa atttccacaa gttcgataga tttagtatag caagggatgt 540 cgcaaaggac agcgccggcg ccttttctgt tgaagacgta tcagttggtg gatgatgtgt 600 ccactgacga tgtaatatct tggaatgaaa atggcacaac gtttgtggtt tggaaaactg 660 ctgaatttgc aaaggatttg ctgccaaagt acttcaagca caataatttc tccagctttg 720 ttcgtcagct taacacctat ggatttcgca agattgtgcc tgacaagtgg gaattcgcca 780 acgagaactt caaaagagga cagaaggagc tcctcacagc aatacgccgt cggaagaccg 840 tgacatcagc cccagccatt ggaaagtctg tggcagctgg gacttcagca tctccggaca 900 attctgggga tgagataggt tcaagttcaa cctcgtcccc tgactccaag aaccctgggt 960 ccgttgaaac ccctggaaag ttgtcggcac aattcacaga cttgtcggac gagaacgaga 1020 agctaaagaa agacaaccag atgctgagct cagagctgat gcaggcgaag aaacaatgtg 1080 atgagttggt tgctttcttg agccagtacg tgaaggttgc acccgatatg atcaatcgaa 1140 tcatgagcca aggaacccca tcggggacaa gccttgaaga gttggtcaag gaggttggtg 1200 gtgttaaaga cttagaagaa caaggtagtt acaatgacga tgatgatgaa gaagctgatg 1260 atgatgacga aaagggtgat actctgaaac tatttggcgt gttattgaaa gaaaagaaga 1320 agaaaagggg tctggatgac aataatgatt tttgcggggt acgtgggaaa atgatgaaaa 1380 ctgtggacta taatgctcct tggatgaaaa tgtcatcggc agctggagag agcagcaagg 1440 tttgtaactg aggtgaactt gatgtgttaa ggtggagcag tgcagagcag agtatttagc 1500 ttctcccttt tgatttagta atttcatttg gatttcaaaa gtttgttatt atgaataaat 1560 agagaatctc attagtacga gtagcattgg ggtaagatta ctgctaagag tagtaatctc 1620 aacccccaag tagaactata tacatatcaa ttatcaggac agatgctgca gcccgaaagt 1680 ttggtttgca tcgtcgaaac tcataatgat aataataatg gtttctgatt tacgacttcg 1740 tgttcgtgtt gataatggat ctgtaattaa aggccctgca tgacttttta aatcttattc 1800 agtgggaagc acttcatttt agccgagttt cttttcggga accaaccaat cgacctttta 1860 cacaagggaa ggacagggtt t 1881 <210> 2 <211> 304 <212> PRT <213> Capsicum annuum <400> 2 Met Ser Gln Arg Thr Ala Pro Ala Pro Phe Leu Leu Lys Thr Tyr Gln   1 5 10 15 Leu Val Asp Val Ser Thr Asp Asp Val Ile Ser Trp Asn Glu Asn              20 25 30 Gly Thr Thr Phe Val Val Trp Lys Thr Ala Glu Phe Ala Lys Asp Leu          35 40 45 Leu Pro Lys Tyr Phe Lys His Asn Asn Phe Ser Ser Phe Val Arg Gln      50 55 60 Leu Asn Thr Tyr Gly Phe Arg Lys Ile Val Pro Asp Lys Trp Glu Phe  65 70 75 80 Ala Asn Glu Asn Phe Lys Arg Gly Gln Lys Glu Leu Leu Thr Ala Ile                  85 90 95 Arg Arg Arg Lys Thr Val Thr Ser Ala Pro Ala Ile Gly Lys Ser Val             100 105 110 Ala Ala Gly Thr Ser Ala Ser Pro Asp Asn Ser Gly Asp Glu Ile Gly         115 120 125 Ser Ser Thr Ser Ser Pro Asp Ser Lys Asn Pro Gly Ser Val Glu     130 135 140 Thr Pro Gly Lys Leu Ser Ala Gln Phe Thr Asp Leu Ser Asp Glu Asn 145 150 155 160 Glu Lys Leu Lys Lys Asp Asn Gln Met Leu Ser Ser Glu Leu Met Gln                 165 170 175 Ala Lys Lys Gln Cys Asp Glu Leu Val Ala Phe Leu Ser Gln Tyr Val             180 185 190 Lys Val Ala Pro Asp Met Ile Asn Arg Ile Met Ser Gln Gly Thr Pro         195 200 205 Ser Gly Thr Ser Leu Glu Glu Leu Val Lys Glu Val Gly Gly Val Lys     210 215 220 Asp Leu Glu Glu Gln Gly Ser Tyr Asn Asp Asp Asp Asp Glu Glu Ala 225 230 235 240 Asp Asp Asp Asp Glu Lys Gly Asp Thr Leu Lys Leu Phe Gly Val Leu                 245 250 255 Leu Lys Glu Lys Lys Lys Lys Arg Gly Leu Asp Asp Asn Asn Asp Phe             260 265 270 Cys Gly Val Arg Gly Lys Met Met Lys Thr Val Asp Tyr Asn Ala Pro         275 280 285 Trp Met Lys Met Ser Ser Ala Ala Gly Glu Ser Ser Lys Val Cys Asn     290 295 300

Claims (8)

A thermal shock transcription factor gene CaHsfB1 consisting of the nucleotide sequence of SEQ ID NO: 1.
A protein consisting of the amino acid sequence of SEQ ID NO: 2.
A vector comprising the gene of claim 1.
A tobacco mosaic virus-P ₀ -resistant plant transgenic cell transformed with the vector of claim 3 and having increased expression of CaHsfBl.
The transformed plant cell of tobacco mosaic virus-P ₀ disease according to claim 4, wherein the plant is at least one selected from the group consisting of red pepper, Arabidopsis and tobacco.
delete 1) preparing a vector comprising a gene consisting of the nucleotide sequence of SEQ ID NO: 1;
2) preparing a plant transformed cell transformed with the vector prepared in the step 1); And
3) preparing a plant with the plant transformed cell prepared in the step 2); Wherein the tobacco mosaic virus-P &lt; RTI ID = _0.0 &gt; _0- resistant &lt; / RTI &gt;
1) preparing a vector comprising a gene consisting of the nucleotide sequence of SEQ ID NO: 1; And
2) increasing the expression of CaHsfB1 by introducing the vector prepared in the above step 1 into a plant, thereby increasing resistance to tobacco mosaic virus-P ₀ disease in the plant.

Images