KR101736326B1 - Bacillus subtilis SCHB1437 strain having auxin production activity, enzyme secretion activity and antifungal activity against plant pathogen and uses thereof - Google Patents

Abstract

The present invention relates to a strain of Bacillus subtilis SCHB1437, which produces auxin, has an extracellular enzyme-releasing activity, has an antifungal activity against a plant pathogenic bacterium, a strain of Bacillus subtilis SCHB1437 or a culture thereof And a method for treating a plant disease comprising treating the plant or soil with an effective amount of the Bacillus subtilis SCHB1437 strain or a culture thereof. Therefore, by using the present invention, it can be very useful for the development of microbial pesticides which are eco-friendly and can replace the use of chemical pesticides or chemical fertilizers.

Description

The present invention relates to a Bacillus subtilis SCHB1437 strain producing an auxin and having an extracellular enzyme-releasing ability, an antifungal activity against a plant pathogenic bacterium, and a use thereof, and a use thereof Bacillus subtilis SCHB1437 strain having auxin production activity, enzyme secretion activity and antifungal activity against plant pathogen uses thereof}

The present invention relates to a Bacillus subtilis SCHB1437 strain producing auxin, having an extracellular enzyme-releasing ability, an antifungal activity against a plant pathogenic bacterium, and a use thereof, and more particularly, to an auxin- Bacillus subtilis SCHB1437 strain having an ability to secrete foreign enzymes and having an antifungal activity against plant pathogenic microorganisms, a microorganism preparation for controlling plant diseases comprising the strain or a culture thereof as an active ingredient, To an effective amount of a plant or soil.

Modern agriculture is dependent on the use of organic synthetic pesticides to protect crops from disease. The agriculture made with these chemical agrochemicals is an important tool in the development of environmentally friendly, toxic and drug resistant pathogens, And the environment. Due to the concern about the side effects of these pesticides, recently, as the awareness of environment protection and the awareness of safe agricultural products have increased, there is a tendency to prefer environmentally friendly agricultural cultivation methods.

Globally, the market for bio-pesticides is expected to grow explosively in the early stages of the growth phase following the introduction phase, as the global interest in environmentally-friendly policies and safe agricultural products increases. World biopharmaceuticals accounted for about 2% of the pesticide market in 2001, but it is estimated that the market will reach about 15% of the global pesticide market by 2015 due to environment friendly agricultural policies centering on OECD countries. In the 21st century, OECD countries including Korea are actively promoting eco-friendly agricultural policies that reduce the use of chemical pesticides and chemical fertilizers due to environmental pollution and side effects such as pesticide residues. Therefore, in Korea, there is no concern about residual toxicity of agricultural products and there is an advantage of not disturbing agricultural ecosystem. Therefore, biological control method using microbial agent is increasingly interested in. Research on biopesticides in Korea began in 1987 with the development of biconia for the control of ginseng root rot disease starting in 1980. Since then, research institutes such as the Korea Research Institute of Chemical Technology, the Institute of Biotechnology, the National Institute of Agricultural Science and Technology, We are trying to develop new microbial pesticides that are safe for humans and the environment. However, in order to produce eco-friendly agricultural products, microorganism pesticides with excellent effect that can substitute for synthetic pesticides are required. Also, microorganisms having antagonistic ability selected under limited conditions of a laboratory can not settle and survive in actual packaging, The antagonistic bacterium is selected only in a large number of cases. In addition, domestic research institutes have been conducting researches on antagonistic microorganisms for the control of plant diseases by using bacteria and fungi as well as advanced countries. However, they are still carrying out basic researches, and in plant cultivation, The research is centered on universities, agricultural research institutes and government research institutes. However, it is not enough for domestic researchers and technology accumulation to be applied to domestic cultivation conditions and the use of agricultural pesticides And the practical use thereof is small.

Currently, researches using microorganisms as well as byproducts such as rice bran, food, and crab shells are actively conducted for the production of eco-friendly agriculture. Among them, farming methods using antagonistic microorganisms having excellent ability to control disease in crops, promotion of crop growth and soil improvement effect are widely spreading. Mainly used soil microorganisms are Bacillus sp., Pseudomonas sp., And Rhizobium sp..

Korean Patent No. 1454774 discloses 'a Bacillus strain having plant growth promotion or plant disease controlling activity and its use'. However, the Bacillus subtilis SCHB1437 strain, which produces auxin of the present invention and has an extracellular enzyme-releasing ability and has an antifungal activity against plant pathogenic bacteria, has not been disclosed.

Bacillus subtilis SCHB1437 strain of the present invention produces auxin and produces amylase and protease which are extracellular enzymes. And confirming that it exhibits antifungal activity against various plant pathogenic bacteria. Thus, the present invention has been completed.

In order to achieve the above object, the present invention provides Bacillus subtilis strain SCHB 1437, which produces auxin and has an extracellular enzyme-releasing ability and has an antifungal activity against plant pathogenic bacteria.

The present invention also provides a microorganism preparation for controlling plant diseases, comprising the Bacillus subtilis strain SCHB1437 or a culture thereof as an active ingredient.

The present invention also provides a method of controlling a plant disease comprising treating the plant or soil with an effective amount of the Bacillus subtilis strain SCHB1437 or a culture thereof.

In the present invention, Bacillus subtilis strain SCHB1437, which produces auxin and produces extracellular enzymes amylase and protease, and has antifungal activity against various plant pathogenic bacteria, was isolated. Therefore, by using the present invention, it can be very useful for the development of microbial pesticides which are eco-friendly and can replace the use of chemical pesticides or chemical fertilizers.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a graph showing changes in pH of Bacillus subtilis SCHB1437 according to the incubation time and temperature. FIG.
FIG. 2 shows cell growth of Bacillus subtilis SCHB1437 according to the incubation time and temperature of the present invention.

In order to accomplish the present invention, the present invention provides Bacillus subtilis SCHB1437 strain which produces auxin, has an extracellular enzyme-releasing ability, and has an antifungal activity against a plant pathogenic bacterium .

The Bacillus subtilis SCHB1437 strain was isolated from soil, producing auxin, secreting extracellular enzyme, and was selected as a strain having excellent antifungal activity against plant pathogenic bacteria. The strain Bacillus subtilis SCHB1437 was deposited at the Institute of Agricultural Biotechnology on Jul. 28, 2015 (Accession No .: KACC81010BP).

In the strain according to an embodiment of the present invention, the enzyme may be an amylase and a protease, and the plant disease causative microorganism may be selected from the group consisting of Cladosporium cucumerinum , Alternaria , a causative organism of spotted deciduous disease mali ), a sclerotinia causative organism, Sclerotinia trifolium), gray mold causative organism of boats Rio Tee California flops Kelly Ana (Botryotinia fuckeliana), a collation Saturday grape anthracnose pathogen tree Colchicum global Eos Forio Death (Colletotrichum gloeosporiodes ), pepper anthracycline colletotrichum cocodes ( Colletotrichum coccodes) or Colle Sat tree Qom to help Marty (Colletotrichum dematium) and the Fusarium solani root rot pathogens (Fusarium solani ) or Cylindrocarpon ( Cylindrocarpon destructans ), but the present invention is not limited thereto.

The present invention also provides a microorganism preparation for controlling plant diseases, comprising the Bacillus subtilis strain SCHB1437 or a culture thereof as an active ingredient. The microorganism preparation for controlling plant diseases may be used as a microbial pesticide.

The microbial agents for controlling plant diseases according to the present invention may be in the form of, for example, directly sprayable solutions, powders and suspensions or in the form of highly concentrated aqueous, oily or other suspensions, dispersions, emulsions, oily dispersions, pastes, dusts, But is not limited thereto.

The microbial agent for controlling plant diseases of the present invention can be formulated into various forms. The preparation can be prepared, for example, by adding a solvent and / or a carrier. Often, inert additives and surface-active materials, such as emulsifiers or dispersants, are mixed into the formulation. Suitable surface-active materials include, but are not limited to, aromatic sulfonic acids (e.g., lignosulfonic acid, phenol-sulfonic acid, naphthalene- and dibutylnaphthalenesulfonic acid), fatty acids, alkyl- and alkylarylsulfonates, alkyl lauryl ethers, A salt of a fatty alcohol glycol ether, a sulfonate naphthalene and derivatives thereof, a condensate of formaldehyde, a condensate of naphthalene or naphthalene sulfonic acid, a phenol and a formaldehyde Condensates, polyoxyethylene octylphenol ethers, ethoxylated isooctyl-, octyl- or nonylphenol, alkylphenyl or tributylphenyl polyglycol ethers, alkylaryl polyether alcohols, isotridecyl alcohol, fatty alcohol / ethylene oxide condensates , Ethoxylated castor oil, polyoxyethylene alkyl ether or polyoxypropylene, lauryl alcohol Polyglycol ether acetate, sorbitol esters, lignin-sulfite waste liquid, or may be a cellulose, are not limited.

Suitable solid carrier materials are in principle all porous and comprise an agriculturally acceptable carrier such as mineral earths such as silica, silica gel, silicate, talc, kaolin, limestone, limestone, chalk, Fertilizers such as ammonium sulfate, ammonium phosphate, ammonium nitrate, urea, vegetable products such as cereal flour, bark powder, wood meal, And nut shell powder), or cellulose powder. The solid carrier may be used alone or in combination of two or more.

The microbial agent for controlling plant diseases according to the present invention can be used as an active ingredient by mixing Bacillus subtilis SCHB1437 alone or in combination with two or more different antifungal, antibacterial or antiviral substances.

The microbial agent for controlling plant diseases according to the present invention can be mixed with a dispersing agent, a penetrating agent, or a surfactant in order to enhance plant absorption and effect.

The present invention also provides a method of controlling a plant disease comprising treating the plant or soil with an effective amount of the Bacillus subtilis strain SCHB1437 or a culture thereof.

As a method for controlling the plant disease, the microorganism preparation for controlling using an effective amount of the Bacillus subtilis SCHB1437 strain and a culture thereof may be sprayed or sprayed on a plant or soil, but the present invention is not limited thereto.

The " effective amount " of the present invention can be determined by uniformly diluting the control microbial formulation with water to control the plant disease, in an amount sufficient to produce beneficial or desired results, and then sprayed onto the plant and arable land using a suitable spraying device, can do. When the wettable powder or liquid wettable powder of the present invention is diluted in water, the concentration of the wettable powder or the liquid wettable powder may be adjusted to 10 ⁵ to 10 ¹⁰ cfu / ml so that the effective ingredient may be in a biologically effective range, but is not limited thereto.

The present invention also provides a method for promoting plant growth comprising treating the plant or soil with an effective amount of the Bacillus subtilis strain SCHB1437 or a culture thereof.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are merely illustrative of the present invention and that the scope of the present invention is not limited thereto.

Example  1. Collect soil samples

The soil used in this example was collected from 23 farms and farm households in Chungbuk, Sun-Gun, Bounheung-myeon area (35.4672 latitude, 126.9347 latitude) The soil samples were collected at a distance of 8 cm or more from different points of the soil. The samples were stored in a polyethylene vinyl bag at 4 ° C and used as samples in the following examples. Respectively.

Soil sample list number Collection area The name of a child In the case of serial damage One Daqwari Schisandra radish 2 Seomarie Kim Yong Deok Schisandra radish 3 Dongbang Lee Schisandra radish 4 Seojiri Room Schisandra radish 5 Dongbang Lee Schisandra U 6 Yong Deok Kim Schisandra U 7 Seojiri Room Schisandra U 8 The Schisandra radish 9 Top Gun Ginseng U 10 Dongsan Yoon Geum Sang Ginseng U 11 Top Gun Ginseng U 12 Dongsan Yoon Geum Sang Ginseng U 13 Dongsan Yoon Geum Sang Ginseng U 14 Top Gun Ginseng radish 15 Ji Seon Lee Ginseng radish 16 Nahmam The radish 17 The The U 18 bibliography The radish 19 Surgical room The U 20 Nahmam Bokbunja radish 21 Nahmam Bokbunja radish 22 Chilip Jeong Byeonggon cucumber radish 23 Chilip Bokbunja U

Example  2. Isolation of useful microorganisms

(Potato Dextrose Agar), CMA (Corn Meal Agar), MEA (Malt Extract Agar), NA (Nutrient Agar), LBA (Luria-Bertani Agar) and the like were used to separate useful microorganisms from the soil samples shown in Table 1 Five different media were used as culture media for indigenous useful microorganisms (Table 2). 10 g of soil samples were suspended in 90 ml of physiological saline solution (NaCl 0.85%), diluted to a concentration of 10 ^{-5 with a} decanter drainage system, and plated on PDA, CMA, MEA, NA and LBA culture medium. and cultured until colony formation. The colonies formed were classified according to shape and color and purified. Classified microorganisms were assigned strain numbers as desired.

Microbial separation medium and culture conditions Separation medium Nutrient agar, Luria-Bertani agar,
Potato Dextrose Agar, Corn Meal Agar,
Malt Extract Agar Culture conditions 37 ^o C, 1 day culture Storage medium Nutrient agar

Example  3. Isolation of microorganisms Extracellular Enzyme secretory ability  analysis

Each separated microorganism was inoculated into LB liquid medium and incubated at 37 DEG C and 200 rpm for 24 hours. The supernatant was taken by centrifuging the culture (12,000 rpm, 4 ° C and 30 minutes) and measuring the extracellular enzyme secretion ability.

First, a plate medium supplemented with 1.0% skim milk was used in a basal medium containing NB (Nutrient broth), GSS and PDB (potato dextrose broth) to isolate microorganisms producing protease . The prepared bacterial supernatant was inoculated in the selective medium and cultured at 37 占 폚 for 3 days. Bacteria forming a clear zone were selected. Next, in order to isolate amylase-producing microorganisms, a starch medium supplemented with 0.5% soluble starch was used in a basal medium containing NB (Nutrient broth), GSS and PDB (potato dextrose broth) Respectively. The above-mentioned bacterial supernatant was inoculated on the above-mentioned plate medium and incubated at 37 ° C for 3 days, followed by staining with a Lugols iodine solution for 20 minutes to confirm the presence of a clear zone. Finally, to isolate cellulase-producing microorganisms, a basal medium containing NB (Nutrient broth), GSS and PDB (potato dextrose broth) was used with a plate medium supplemented with 0.5% CMC (carboxy methyl cellulose) Respectively. The cellulase production ability was evaluated by inoculating the above-mentioned plate medium with the bacterial supernatant, culturing at 37 ° C for 3 days, staining with 0.1% congo red solution, decolorizing with 1M NaCl, and confirming the formation of yellow circles around the cells . As a result, 25 strains having an extracellular enzyme-releasing ability were selected as shown in Table 3.

The result of measuring the extracellular enzyme secretion ability of isolated microorganism Strain number Protease Amylase Cellulase SCBH1071 2.6 - 1.5 SCBH1090 2.6 - 1.6 SCBH1095 2.5 1.4 1.2 SCBH1118 2.1 2 - SCBH1120 2 1.2 - SCBH1241 2 1.2 1.2 SCBH1245 2.5 1.1 1.2 SCBH1250 2 - 1.2 SCBH1251 2 - 1.3 SCBH1290 2.5 1.1 - SCBH1332 2.5 1.5 - SCBH1382 3 1.5 1.5 SCBH1386 2.8 - 1.5 SCBH1388 3 1.2 1.6 SCBH1400 - 1.8 1.3 SCBH1409 3.1 1.8 - SCBH1416 2.7 - 1.6 SCBH1432 2.8 1.5 - SCBH1433 3 1.2 - SCBH1434 3.2 1.2 - SCBH1435 3.3 1.3 - SCBH1436 3.3 1.6 - SCHB1437 3.6 2 - SCBH1438 3.5 1.5 - SCBH1439 3.6 1.6 -

Unit: cm

Example  4. Plant pathogenic causative organisms of selected strains on  Antifungal activity analysis

25 kinds of strains with excellent enzyme production ability were selected by the measurement of the extracellular enzyme secretion ability of the microorganisms isolated from the soil in Example 3, and 15 kinds of plant disease causative bacteria distributed from the Rural Development Administration's Agricultural Gene Information Center were selected, Cladosporium cucumerinum KCCM11419, Alternaria mali KCCM11382, a causative organism of apple leaf spotted decidua, Alternaria mali KCCM11382, a causative organism of sheath blight, Pellicularia sasaki , Scotland Klee Loti Catania Tripoli Stadium (Sclerotinia trifolium KCCM60135), rice tall bottles causative of jibe Relais Fu Siegfried Roy (Gibberella fujikuroi KCCM12329), gray mold causative organism of boats Rio tee California flops Kelly Ana (Botryotinia fuckeliana KCCM32314), wilt pathogen in Fusa Solarium Room oxy Spokane (Fusariium oxysporum KCCM12326), grape anthracnose pathogen in Colle Saturday Rikum global Eos Forio Death (Colletotrichum gloeosporiodes KCCM43520), red pepper anthracnose pathogen in Colle Sat tree Colchicum Coco Death (Colletotrichum coccodes KACC40009 or KACC40010) or Colle Sat tree Qom to Marty Help (Colletotrichum dematium KACC40013), tomato late blight pathogen of pie Saratov Sora The present invention relates to a method for screening for a disease caused by a disease such as Phytophthora capsici KACC40177, Sclerotinia sclerotiorum KACC41065, a causative organism of red pepper scleroderma, and Fusarium solani KACC 40384 or Cylindrocarpon destructans The antifungal activities of 25 strains were investigated. A PDA (Potato Dextrose agar) medium was used as a culture medium for plant pathogenic bacteria, and the cells of the plant pathogenic bacteria cultivated in the medium were inoculated with a disc at the center of the PDA medium and incubated in an incubator at 25 ° C for 3 days Lt; / RTI > The disc diffusion method and the paper disc method were used for the measurement, and it was confirmed that the selected strains formed an inhibition zone. As a result, as shown in Table 4, nine kinds of isolated microorganisms showing excellent antifungal activity against plant pathogenic bacteria were selected. Among them, SCBH1433, SCBH1435, SCHB1437 and SCBH1439 showed excellent antifungal activity against various plant pathogenic bacteria Respectively .

Results of antifungal activity against selected plant pathogenic microorganisms Plant disease (causative bacteria) Isolate strain number 1290 1382 1432 1433 1434 1435 1437 1438 1439 Black colored bottle
(Cladosporium cucumerinum KCCM 11419) + - - + - + + - + Sheepskin bottle
(Felicolaria Sasaki) - - - + - + - - - Apple dotted leaves
(Altanariamali KCCM11382) + - - + + + + + + Blast
(Sclerotinia Tripoliorum KCCM60135) - - - + - - + - + Rice cramp
(Gibelare fujicloi KCCM12329) - - - - - - - - + Gray Mold
(Boat Rio Tinia Ferrari KCCM32314) - - + + - + + + + Wilt
(Fusarium oxysporum KCCM12326) - - - + - - - - + Grape anthrax
(Colletotriquus gloria sporeosus KCCM43520) + + - - - + + + + Pepper anthracite
(Colletotrichum cocodes) < RTI ID = 0.0 > KACC40009) - + - + - + + - - Pepper anthracite
(Colletotricum cocodes KACC40010) - + + + - - + - + Tomato plague
(Phytophthora capsidii KACC40177) - - - - - - - - - Pepper scleroderma
(Sclerotinia schlulotiocyte KACC 41065) - - - - - - - - + Pepper anthracite
(Choletotrichum de martium KACC40013) - - - - - - + - + Root rot disease
(Fusarium Solani KACC40384) - - - + - + + - + Root rot disease
(Cylindrical car phone desert trucks KACC41077) - - - + + - + + +

+: Positive reaction

-: negative reaction

Example  5. Selection of selected strains Auxin ( auxin ) Production capacity  analysis

The auxin production ability of 25 isolated microorganisms selected in Example 3 was confirmed. First, 25 isolates were inoculated into the medium supplemented with LB agar and 0.1% L-tryptophan, and cultured at 30 ° C for 2 days. Then, Salchow's reagent (2.0 ml of 2.0% HClO ₄ and 2 ml of 0.05 M FeCl ₃ ) Red color colonies were selected after incubation for 30 minutes under dark conditions. As a result, it was confirmed that the three isolated microorganisms produce oxine as shown in Table 5 below.

Results of measurement of auxin production ability of 25 isolated microorganisms Strain number Auxin production ability SCBH1071 - SCBH1090 - SCBH1095 - SCBH1118 - SCBH1120 - SCBH1241 - SCBH1245 - SCBH1250 - SCBH1251 - SCBH1290 - SCBH1332 - SCBH1382 - SCBH1386 - SCBH1388 - SCBH1400 - SCBH1409 + SCBH1416 - SCBH1432 - SCBH1433 - SCBH1434 + SCBH1435 - SCBH1436 - SCHB1437 + SCBH1438 - SCBH1439 -

+: Positive reaction

-: negative reaction

Example 6. Identification of Bacillus subtilis SCHB1437 strain

(1) 16S rDNA  Sequencing

Based on the results of Examples 1 to 5, in order to identify an SCHB1437 strain producing auxin and secreting extracellular enzymes amylase and protease and having excellent antifungal activity against plant pathogenic bacteria, DNA of the SCHB1437 strain was isolated using a DNA purification kit (Promega, Madison, Wl) and PCR amplified using the universal primers shown in Table 6 below. The amplified PCR products were purified using Wizard SV Gel and clean-up system (Promega, Madison, WI). Sequence analysis of the purified PCR products was commissioned by Solgent and Cosmojintek. As a result, the 16s rDNA sequence of the SCHB1437 strain was identified as Bacillus subtilis through the ribosomal DNA sequence Date base of GenBank, and the strain was named as Bacillus subtilis SCHB1437 strain.

The primers used in the present invention Name of the primer Base sequence Forward (SEQ ID NO) Reverse (SEQ ID NO) 27F AGAGTTTGATCATGGCTCAG (SEQ ID NO: 1) - 1492R - GGATACCTTGTTACGACTT (SEQ ID NO: 2)

(2) Identification of biochemical properties

In order to confirm the biochemical characteristics of the finally selected Bacillus subtilis SCHB1437 strain, the presence or absence of spores was firstly observed, and the growth of the strain was observed. The Schaeffer and Fulton's method After spore staining using an optical microscope, endospore was stained green by malachite green inside the cells. Catalase test showed that bubbling was observed due to the addition of hydrogen peroxide (H ₂ O ₂ ) to the smoothed cells, and the result of oxidase activity was 1% tetramethyl-p-phenylenediamine The addition of 2 to 3 drops of tetramethyl-p-phenylenediamine dihydrochloride resulted in 80% color change within 10 seconds and 20% color change after 10 seconds. Therefore, it was judged positive.

In the VP (Voges-Proskauer) test, 5% α-naphtol and KOH reagent were oxidized in the atmosphere and observed. As a result, it was confirmed that the compound was negative because no red compound was observed. The pH of each culture broth was lowered to 8.0, and it was confirmed that the acid was generated from the carbon source used after culturing the strain in a liquid medium of Ricosy I (pH 9.0) for 24 hours at 40 ° C with shaking. In addition, to determine whether or not a gas was produced from glucose, a culture tube was inverted and cultured in a culture medium of a test tube. As a result, the bubbles collected inside the culture tube were visually confirmed. Since the color of the post-culture medium was not changed, it was confirmed that it was negative.

Finally, the ability to reduce nitrate to nitrite was confirmed. As a result, it was confirmed visually that bubbles were trapped in the Horikoshi I medium supplemented with nitrite. After addition of the diagnostic reagent No color change was observed, and zinc powder was added to detect the nitrite present in the medium. However, no change in color was observed after addition of zinc powder. Therefore, it was judged that nitrite was reduced in the culture medium, and thus it was judged that nitrite reduction ability was positive. Therefore, it was confirmed that the biochemical characteristics of the strain Bacillus subtilis SCHB1437 were the same as that of the 16s rRNA sequence.

Example 7. Identification of optimal growth conditions of Bacillus subtilis SCHB1437 strain

(1) Optimum growth temperature

Bacillus subtilis SCHB1437 strain, which was finally selected on the basis of Examples 1 to 6, was subcultured in 1% (v / v) medium supplemented with 2% molasses at 25, 30 and 37 ° C After 6 hours, 12 hours, 18 hours, 24 hours, 30 hours, 36 hours, 42 hours, and 48 hours of incubation, the optimum growth temperature was determined by measuring the absorbance at 600 nm. As a result, it was confirmed that the best growth was observed at 30 캜 and pH 7.0 as shown in Figs. 1 and 2.

(2) Optimum antifungal activity temperature

Bacillus subtilis SCHB1437 strain selected last on the basis of Examples 1 to 6 was cultured in molasses and sampled by 1 ml of Bacillus subtilis SCHB1437 culture medium at each time point and centrifuged at 12,000 rpm And 10 minutes), the optimum antifungal activity temperature was confirmed for Cylindrocarpon destructans KACC41077, a causative organism of root rot, using the supernatant. As a result, as shown in the following Table 7, the temperature exhibited a similar pattern, and the antifungal activity was highest when cultured at 25 ° C for 36 hours. The antifungal activity was observed at 30 ° C from 36 hours, . At 37 ℃, antifungal activity was observed from 24 hours, but the highest antifungal activity was observed at 48 hours

The antifungal activities against root rot caused by temperature of Bacillus subtilis SCHB1437 strain Temperature
(° C) Time (h) 6 12 18 24 30 36 42 48 54 60 25 - - - - - 1.4cm + + 1.2cm 1.1cm 30 - - - - - + - + + + 37 - - - + + + + 1.1cm + +

+: Positive reaction

-: negative reaction

Agricultural Biotechnology Research Institute KACC81010BP 20150728

<110> Microbial Institute for Fermentation Industry <120> Bacillus subtilis SCHB1437 strain having auxin production          activity, enzyme secretion activity and antifungal activity          against plant pathogens and uses thereof <130> PN15219 <160> 2 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 agagtttgat catggctcag 20 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 ggataccttg ttacgactt 19

Claims (4)

It is known that Clostosporium cucumerinum, which is a cause of black stellate disease, Clostosporium cucumerinum, which produces auxin and has amylase and protease releasing ability , Alternaria mali), rice blast pathogen in Scotland Klee Loti Catania Tripoli Stadium (Sclerotinia trifolium), gray mold causative organism of boats Rio tee California flops Kelly Ana (Botryotinia fuckeliana), a collation Saturday grape anthracnose pathogen tree Colchicum global Eos Forio death (Colletotrichum gloeosporiodes ), Colletotrichum coccodes or Colletotrichum dematium , an anthrax ancestor of pepper , and Fusarium solani or Cylindrocarpon, a causative agent of root rot disease, Bacillus subtilis SCHB1437 strain having an antifungal activity against destructans (KACC81 010BP). delete Claim in Bacillus standing subtilis (Bacillus subtilis) Cloud FIG sports Solarium Cuckoo Mary num black byeolmunui disease, Alterna Ria Mali (Alternaria mali) by (Cladosporium cucumerinum) containing SCHB1437 strain or culture thereof as an active ingredient according to one of the preceding claims , Sclerotinia trifolium blight, Gray mold disease by Botryotinia fuckeliana , Colletotrichum gloeosporiodes by Botryotinia &lt; RTI ID = 0.0 &gt; grape anthracnose by, Collet sat tree Colchicum Coco death (Colletotrichum coccodes) or Colle sat tree Qom to Marty help (Colletotrichum dematium) pepper anthracnose, or Fusarium solani (Fusarium solani) or a syringe draw Carphone death trucks Tansu (Cylindrocarpon destructans by ) Microorganism preparation for controlling root rot disease. A method for the treatment of black spotted disease caused by Cladosporium cucumerinum , which comprises the step of treating an effective amount of the strain of Bacillus subtilis SCHB1437 according to claim 1 or a culture thereof to a plant or soil, Apple blight foliage caused by Alternaria mali , blast caused by Sclerotinia trifolium , gray mold caused by Botryotinia fuckeliana , choletotrichum glow eos , Forio death (Colletotrichum gloeosporiodes) grape anthracnose caused by, Collet sat tree Colchicum Coco death (Colletotrichum coccodes) or Colle sat tree Qom to pepper anthracnose or Fusa by Marty Stadium (Colletotrichum dematium) Solarium solani (Fusarium solani) or a syringe draw A method for controlling root rot caused by Cylindrocarpon destructans .

Images