KR101708249B1 - OsNFY27 promoter specific for plant seed endosperm or aleurone layer and uses thereof - Google Patents

Abstract

The present invention relates to an Oryza sativa nuclear factor Y27 (OsNFY27) promoter specific to an endosperm or an aleurone layer of plant seeds, and a method for specifically expressing exotic genes in an endosperm or an aleurone layer of transformed plants. The exotic genes can be specifically expressed in an endosperm or an aleurone layer of plant seeds by using the OsNFY27 promoter. Accordingly, the OsNFY27 promoter can be used for analyzing objective gene functions in mature seeds, thereby being used for developing functional seeds therethrough.

Description

[0001] The present invention relates to an OsNFY27 promoter and to its use,

The present invention relates to a method for expressing an exogenous gene in an endosperm or a phyllosphere of a transgenic plant by using a plant seed ovum or a phylum-specific OsNFY27 (Oryza sativa Nuclear Factor Y27) promoter.

Breeding is the production of new varieties or improvement of existing varieties using the genetic properties of the organisms. New varieties must have at least some of their traits (properties) different from those of existing ones, and should have excellence, uniformity and permanence that are beneficial for agricultural production as crops or livestock. The breeding business uses various means to achieve its purpose based on scientific theory, which is called breeding technique.

There are various methods of breeding such as selection method, hybridization method, hybrid breeding method, hybrid breeding method, mutation method, and genetic engineering method. Recently, molecular breeding technique has attracted attention due to the development of molecular biology technology.

Molecular breeding is a technique that occurs as biology evolves, and is a technology that directly manipulates DNA, the genetic information of living things, to produce useful living things. Recombinant microorganisms that already produce human proteins are being breeded. By molecular breeding, we crossed the wall of the species that was the limit of conventional breeding, and it became possible to exchange genetic information between people who were not crossed and microorganisms. In order to carry out molecular breeding, a means for expressing a useful gene and a transformation technique for various animals and plants are required. In particular, there is a continuing need to develop various promoters and vectors for expressing a desired gene at a desired site.

Recently, as the genetic engineering technology has developed, many researches have been carried out to improve the characteristics of plants. In particular, there is much interest in techniques for obtaining a useful gene from a transgenic plant. A promoter involved in expression of the gene is required when the desired gene is expressed in a transgenic plant.

In general, a promoter is a kind of regulatory region having a function of regulating the expression of a nucleotide sequence, that is, a gene, which determines when and where a gene is to be expressed. Numerous types of promoters have been identified through endless research. Conventionally reported promoters can be classified according to their features and functions such as a promoter that induces expression at all times and a promoter that induces expression in time or position specific manner.

More specifically, the first is a strong promoter capable of maximizing the expression level. This was initially developed as a promoter that is used to maximize the expression level of the target gene, and is representative of the 35S RNA gene promoter (P35S) of flower cabbage mosaic virus and the actin gene promoter of rice. They are mainly used for the purpose of production of antibiotic resistance genes used as selection markers in the transformation of plants, genes for inhibiting insect pests of plants, or plants.

Second, promoters that limit the time of expression can be mentioned. This has been reported as a promoter that restricts the expression of a gene of interest only to a specific stage of the developmental stage of the plant. For example, promoters of genes involved in flowering can express genes only during the flowering season, and promoters of genes expressed by various biotic or abiotic stimuli can be included in the timing-regulated promoters.

Third, tissue-specific promoters that limit expressed tissue are examples. This is the promoters that are used to achieve the transfection purpose by limiting the expression of the desired gene only to specific tissues of the plant. A number of examples of promoters inducing such tissue-specific expression have been reported for each tissue of a plant according to various purposes to be used.

In particular, the promoters inducing tissue-specific expression among the promoters classified according to functions and characteristics are classified as follows according to the tissues expressed in the plant.

First, a systemic expression-inducible promoter can be mentioned. As a promoter that induces expression in plant whole body, a promoter of 35S RNA gene of cauliflower mosaic virus (CaMV), which is also a promoter used to maximize expression amount, is used as a representative promoter for a dicotyledonous plant. Promoters of rice actin and maize ubiquitin genes have been mainly used as the systemic expression inducing promoters for the monocotyledonous plants. Recently, promoters of rice cytochrome C gene (OsOc1) have been developed (Patent Document 1) . These genes are used for the purpose of inducing the expression of antibiotics, herbicide resistance genes and reporter genes used as selection markers in the transformation as in the case of the promoters maximizing the expression level. From the viewpoint of research, These are the promoters that are considered to be the priority when attempting to reveal.

Second, seed-specific promoters can be mentioned. As a representative example, the rice glutelin promoter used for the development of golden rice as promoters of rice major storage protein gene is widely used to induce seed-specific expression of monocotyledonous plants. Promoters that are mainly used to induce seed-specific expression include soybean-derived lectin promoter, cabbage-derived napin promoter and γ-tocopherol methyl transferase (γ-TMT) in Arabidopsis seeds. There are carrot-derived DC-3 promoter and perilla derived oleosin promoter used in studies to promote vitamin E production by inducing gene expression.

Third, root-specific expression promoter has not yet been commercialized. However, root-specific expression of pyruvate peroxidase (prxEa) has been isolated and confirmed recently. In recent years, the expression of maz genes (ibMADS) It has been reported that the ADP-glucose pyrophosphatase (AGPase) gene is isolated and the corresponding promoter induces a specific expression in the root and induces root-specific transient expression in carrot and radish .

Fourthly, there are other tissue specific promoters such as leaves. The related promoters include ribosyl bisphosphate carboxylase / oxygenase small subunit (rbcS), which induces expression of strong genes only in photosynthetic tissues of leaves and the like. ) Promoter, tomato-derived fruit maturation-specific expression-inducing phytoene synthase (PDS) promoter, and pollen-specific plant-derived cabbage-derived oleosin promoter.

Such seed, root or leaf-specific expression promoters are expected to be used for the purpose of improving agricultural traits, accumulating useful proteins, and producing useful substances in major crops used for food, food, or food.

However, conventional promoters known to induce tissue-specific expression in the known promoters, particularly plants, have the advantage of being capable of expressing a target gene in a tissue-specific manner, but have a disadvantage in that the expression amount thereof is insignificant. Therefore, it is urgent to find useful new promoters capable of expressing a gene of interest in a plant in a tissue-specific and large-scale expression.

In recent years, promoters for expressing a target gene in specific tissues of plants have been developed. For example, there have been disclosed sporozoites or pollen-specific expression promoters derived from rice OsO5g0543000 gene (Patent Document 2).

Accordingly, the present inventors have conducted research to develop new promoters that can be used for the production of transgenic plants, and have completed the present invention by isolating promoters specifically expressed in the endosperm of the plant seeds or in the phylum.

Korean Patent Publication No. 0429335 Korean Registered Patent No. 1554209

It is an object of the present invention to provide an endosperm or an aleurone layer-specific OsNFY27 (Oryza sativa Nuclear Factor Y27) promoter of plant seeds.

Another object of the present invention is to provide a primer set for amplifying the OsNFY27 promoter.

It is still another object of the present invention to provide a recombinant vector comprising the OsNFY27 promoter.

It is another object of the present invention to provide a transgenic plant transformed with said recombinant vector.

It is another object of the present invention to provide a transformed seed obtained from the transgenic plant.

It is still another object of the present invention to provide a method for expressing a foreign gene specifically in the endosperm or horny layer of transgenic plants using the OsNFY27 promoter.

One embodiment of the present invention provides an endosperm or aleurone layer-specific OsNFY27 (Oryza sativa Nuclear Factor Y27) promoter of a plant seed comprising the nucleotide sequence of SEQ ID NO: 1.

The OsNFY27 (Oryza sativa Nuclear Factor Y27) gene may be an NF-YC family transcription factor.

The promoter may be one isolated from rice ( Oryza sativa L. ), specifically, one separated from Dongjin rice. In the example of the present invention, the nucleotide sequence of translation initiation of the OsNFY27 gene, in which the gene expression is increased about 5 times or more, is isolated between 3 to 6 days and 25 days after rice seeding.

The promoter may include various regulatory factors involved in seed germination, dormancy regulation, and seed-specific expression, and specifically includes motifs involved in seed germination and dormancy, motifs involved in seed-specific expression, sugar motifs, drought-responsive motifs, WRKY transcription factor binding sites, and the like, but are not limited thereto.

As used herein, the term "promoter " refers to the region of DNA upstream from the structural gene and refers to a DNA molecule to which an RNA polymerase binds to initiate transcription. A "plant promoter" is a promoter capable of initiating transcription in plant cells.

The nucleotide sequence of SEQ ID NO: 1 may be 1,799 bp in size. The nucleotide sequence of SEQ ID NO: 1 may have a 10 bp deletion and a 2 bp nucleotide sequence in comparison with the promoter sequence of 1,809 bp of the LOC_Os01g39850 gene extracted from Nipponbarre's genome database.

The nucleotide sequence of SEQ ID NO: 1 can be modified to some extent by various recent research techniques, for example, directed evolution or site-directed mutagenesis. That is, the OsNFY27 promoter nucleic acid molecule of the present invention includes a functional equivalent thereof that performs a functionally equivalent function. The functional equivalent is an artificial mutation in which a part of the base sequence of the nucleotide is deleted, substituted, , Variants modified by insertion, or a combination thereof, or functional fragments of the polynucleotide that perform the same function.

It will be apparent to those skilled in the art that as long as a base sequence retaining 70% or more homology by such an artificial modification retains the promoter activity for the gene expression desired in the present invention, It is easily understood that the present invention belongs to the scope of the present invention.

Accordingly, the promoter has a homology of 70% or more with the nucleotide sequence of SEQ ID NO: 1 and includes a nucleotide sequence having promoter activity.

As used herein, the term "homology" is intended to indicate the similarity between nucleic acid sequences and is preferably 70% or more, more preferably 80% or more, still more preferably 90% or more, , And most preferably at least 95%.

The promoter includes a nucleotide sequence complementary to a nucleotide sequence which exhibits 70% or more homology with the nucleotide sequence of SEQ ID NO: 1 and has promoter activity. Preferably, the promoter has promoter activity equivalent to that of the nucleotide .

As used herein, the term "complementary" means hybridization or base pairing between two strands of a nucleotide or nucleic acid, e. G., A double stranded DNA molecule.

As used herein, the term "endosperm", also referred to as endosperm, is a nutritional tissue formed within the backpack of a seed plant, which is contained in the cotyledons or in the surrounding tissue of the embryo. There are two types of tissues that supply the nutrients needed for germination and growth of the seeds.

As used herein, the term "aleurone layer " refers to a cell layer containing a large amount of crest, crest, and callus visible from the inside of bamboo and seed coat. It is differentiated from cells in the endosperm periphery, 2 to 3 cell layers.

As used herein, the term "specific" means that the expression activity of a promoter is higher in a particular tissue than in at least one other tissue in the same plant. The level of expression activity of a promoter can be assessed by comparing the level of expression of the promoter in tissues previously measured using methods known in the art to those in other tissues. Generally, the level of expression of a promoter is measured by the amount of gene product expressed under the control of the promoter, for example, protein and RNA.

Thus, the term "plant endosperm or aleurone layer specific" means that the expression activity of the promoter is higher in the endosperm or hornbreak tissue of the plant seed than other tissues in the same plant.

Another embodiment of the present invention provides a primer set represented by SEQ ID NO: 2 and SEQ ID NO: 3 for amplifying the OsNFY27 promoter.

As used herein, the term "primer " refers to a single-stranded oligonucleotide sequence complementary to a nucleic acid strand to be copied, and may serve as a starting point for the synthesis of a primer extension product. The length and sequence of the primer should allow the synthesis of the extension product to begin. The specific length and sequence of the primer will depend on the primer usage conditions such as temperature and ionic strength, as well as the complexity of the desired DNA or RNA target. Oligonucleotides used as primers can also include nucleotide analogs such as phosphorothioates, alkylphosphorothioates or peptide nucleic acids or they can contain an intercalating agent ). Preferably, the primer is a deoxyribonucleotide and is a single strand. The primers used in the present invention may include naturally occurring dNMPs (i.e., dAMP, dGMP, dCMP and dTMP), modified nucleotides or non-natural nucleotides. In addition, the primers may also include ribonucleotides.

When PCR amplification reaction is performed using rice as a sample using the primer set, the OsNFY27 promoter of the present invention can be isolated. Specifically, when the primer set is used to perform PCR amplification using the genomic DNA of Dong Jin-jin as a sample, the OsNFY27 promoter of the present invention can be isolated.

The term "amplification reaction" as used herein refers to a reaction to amplify a nucleic acid molecule. A variety of amplification reactions have been reported in the art, including polymerase chain reaction (PCR) (US Pat. Nos. 4,683,195, 4,683,202 and 4,800,159), reverse-transcription polymerase chain reaction (RT-PCR) (Sambrook et al., Molecular Cloning. (LCR) (see, for example, A Laboratory Manual, 3rd Ed. Cold Spring Harbor Press (2001)), Miller, HI (WO 89/06700) and Davey, C. et al (EP 329,822) 17,18), Gap-LCR (WO 90/01069), repair chain reaction (EP 439,182), transcription-mediated amplification (TMA) 19 (WO 88/10315) (US Ser. No. 6,410, 276), self-sustained sequence replication (20) (WO 90/06995), selective amplification of target polynucleotide sequences (U.S. Patent No. 6,410,276), consensus sequence priming polymerase chain The consensus sequence primed polymerase chain reaction (CPPCR) (U.S. Patent No. 4,437,975), random (US Pat. Nos. 5,413,909 and 5,861, 245), nucleic acid sequence based amplification (NASBA) (U.S. Patent No. 5,130,238, 5,409,818, 5,554,517 and 6,063,603), strand displacement amplification (21,22) and loopmediated isothermal amplification (21,22). (LAMP) 23, but is not limited thereto. Other amplification methods that may be used are described in U.S. Patent Nos. 5,242,794, 5,494,810, 4,988,617 and U.S. Patent No. 09 / 854,317.

Another embodiment of the present invention provides a recombinant vector comprising the OsNFY27 promoter.

The recombinant vector may additionally include, but is not limited to, a foreign gene operably linked to the OsNFY27 promoter.

The recombinant vector may be for expressing the foreign gene specifically in the endosperm or horny layer of a plant seed, but is not limited thereto.

As used herein, the term "recombinant" refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a protein encoded by a peptide, heterologous peptide or heterologous nucleic acid. The recombinant cell can express a gene or a gene fragment that is not found in the natural form of the cell in one of the sense or antisense form. In addition, the recombinant cell can express a gene found in a cell in its natural state, but the gene has been modified and reintroduced intracellularly by an artificial means.

As used herein, the term "vector" is used to refer to a DNA fragment (s), nucleic acid molecule, which is delivered into a cell. The vector replicates the DNA and can be independently regenerated in the host cell. The term "expression vector" is often used interchangeably with a "recombinant vector ". The term "recombinant vector" means a recombinant DNA molecule comprising a desired coding sequence and a suitable nucleic acid sequence necessary for expressing a coding sequence operably linked in a particular host organism. Promoters, enhancers, termination signals and polyadenylation signals available in eukaryotic cells are known.

The expression vector will preferably comprise one or more selectable markers. The marker is typically a nucleic acid sequence having a property that can be selected by a chemical method, and includes all genes capable of distinguishing a transformed cell from a non-transformed cell. Examples include herbicide resistance genes such as glyphosate, glufosinate ammonium or phosphinothricin, kanamycin, G418, Bleomycin, hygromycin, ), Chloramphenicol (chloramphenicol), but are not limited thereto.

As used herein, the term "operably linked" means that the promoter sequence is operably linked to the coding sequence to initiate and mediate the transcription of the coding sequence.

In one embodiment of the invention, the construction of the vector used a Gateway vector system. Specifically, both sequences of the gene sequence to be expressed are amplified using a PCR (Polymerase chain reaction) as a primer sequence. To insert into the pENTR / Directional TOPO vector (Invitrogen) with att L1 and att L2 sites, insert CACC in front of the forward primer in the bi-directional primer so that the amplified gene can be directed into pENTR ™ Directional TOPO vector (PENTR TM Directional TOPO Cloning Kits, Invitrogen). Then, the target gene was inserted into the target vector using the LR Clonase II Enzyme Mix in the destination gateway vector system having att R1 and att R2. In this manner, a vector overexpressing the gene of interest was prepared. site-specific recombination (SSR) through a unique sequence called att .

The recombinant vector can be used to measure the activity of a promoter by connecting a reporter gene downstream of the promoter. For example, GUS may be used as a reporter gene.

In one embodiment of the present invention, a recombinant vector OsNFY27 promoter-GUS expression vector prepared by inserting an OsNFY27 promoter into a pBGWFS7 vector containing a GUS reporter gene is exemplified, but the present invention is not limited to this specific vector. The GUS reporter gene is used for measuring the activity of a promoter. It is possible to introduce a desired foreign gene to induce specific expression in the endosperm or hornbreak of a plant seed instead of the GUS reporter gene in the recombinant vector of the present invention. It is.

Another embodiment of the present invention provides a transgenic plant transformed with said recombinant vector.

The introduction of the recombinant vector into a plant can be carried out by a method known in the art. For example, but not limited to, Agrobacterium sp. -Mediated methods, particle gun bombardment, silicon carbide whiskers, sonication, heat shock A heat shock, an electroporation method and a precipitation method using PEG (Polyethylenglycol) can be used. In one embodiment of the present invention, a plant cell is transformed into a recombinant vector of the present invention by a method of Agrobacterium-mediated method, that is, a method of transforming plant cells using Agrobacterium to which an expression vector according to the present invention is introduced, But the present invention is not limited thereto.

The plant cell into which the recombinant vector is introduced is not particularly limited to a specific form as long as the cell can be regenerated as a plant. These cells include, for example, cultured cell suspension, protoplasts, leaf sections and callus.

The transgenic plant may be any one selected from the group consisting of rice, barley, wheat, sorghum and corn, and may be rice, and may be, for example, Dongjin rice.

Another embodiment of the present invention provides a transformed seed obtained from said transgenic plant.

In one embodiment of the present invention, seeds of transgenic rice plants having OsNFY27 promoter inserted therein were harvested at the developmental stage and analyzed by GUS staining. As a result, GUS expression was induced in the rumen layer about 25 days after the outbreak, After 25 days, it was confirmed that GUS expression was induced in the endosperm. However, GUS expression was hardly induced in the embryo of the seeds, and thus it was confirmed that the expression was specifically expressed in the endosperm or hornblende.

Another embodiment of the present invention provides a method for specifically expressing a foreign gene using the OsNFY27 promoter in an endosperm or hornbreak of a transgenic plant, more specifically,

1) preparing a recombinant vector comprising an OsNFY27 (Oryza sativa Nuclear Factor Y27) promoter consisting of the nucleotide sequence of SEQ ID NO: 1 and a foreign gene operably linked thereto;

2) transforming the recombinant vector prepared in the step 1) into a plant using Agrobacterium to express the foreign gene specifically in the endosperm of the transgenic plant or in the phylum.

The plant of step 2) may be any one selected from the group consisting of rice, barley, wheat, sorghum and corn, and may be rice, and may be, for example, Dongjin rice.

In one embodiment of the present invention, seeds of transgenic rice plants having the OsNFY27 promoter insertion were harvested at the developmental stage and analyzed by GUS staining. As a result, the seeds were hardly stained in the embryos after the seeding of the seeds, , And it was confirmed that the OsNFY27 promoter can specifically express the target gene in the endosperm of the plant or in the horny layer because the stain and leaves of the seedlings were hardly stained.

By using the OsNFY27 promoter according to the embodiment of the present invention, the foreign gene can be expressed specifically in the endosperm of the plant or in the horny layer. Therefore, it can be usefully used for analyzing the function of the target gene in mature seeds, and thus can be used to develop functional seeds.

FIG. 1 is a diagram showing the screening of seed expression transcription factors through analysis of transcripts according to seed development stage after seeding in rice;
(A) A graph showing the expression levels according to days after rice seeding (0, 3, 6, 25, and 40 days) of a gene group in which expression was increased during seed development as a result of microarray analysis of RNA.
(B) Seed development stage after rice emergence;
(C) A functional grouping graph for 134 transcription factors with a 5-fold increase in gene expression between 3 and 6 days and 25 days after rice emergence; And
(D) a graph comparing the expression levels of the selected transcription factors.
FIG. 2 shows the results of RT-PCR for the expression of the OsNFY27 gene according to the seed development stage after rice seeding.
3 is a diagram showing the nucleotide sequence of the OsNFY27 promoter.
FIG. 4 is a schematic diagram of an OsNFY27 promoter-GUS expression vector according to an embodiment of the present invention.
FIG. 5 shows the results of PCR analysis of whether or not the vector was introduced into rice plants transformed with the OsNFY27 promoter-GUS expression vector according to an embodiment of the present invention.
DJ: Dongjin, a control group; And
224, 225, 226: Rice transformed with the OsNFY27 promoter-GUS expression vector.
FIG. 6 is a graph showing the results of GUS staining (An, B, C, and D) of transgenic seeds transfected with OsNFY27 promoter-GUS expression vector according to one embodiment of the present invention, An, OV, OVT, Ovular vascular tract, AL, Aleurone layer, Em, Embryo, En, Endosperm).
FIG. 7 is a graph showing the results of GUS staining (Em, Embryo, En, Endosperm, AL, Aleurone) of the transgenic rice seedlings transfected with the OsNFY27 promoter-GUS expression vector according to an embodiment of the present invention layer).
8 is a graph showing the results of GUS staining (LB, Leaf blade, LS, Leaf Sheath, R, roots) in transgenic rice plants transfected with the OsNFY27 promoter-GUS expression vector according to an embodiment of the present invention Root).

Hereinafter, the present invention will be described in more detail in the following Examples. It should be noted, however, that the following examples are illustrative only and do not limit or limit the scope of the present invention. It will be understood by those of ordinary skill in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims.

< Example  1> Rice Seed Development Transcript  Analysis and transcription factors OsNFY27  Gene selection

RNA was isolated and analyzed by microarray according to the stage of seed development in high-quality rice, and 134 transcription factors with gene expression more than 5-fold increased between 3-6 days and 25 days after heading (Figures 1A and 1B). Functional grouping of the selected transcription factors was performed (Fig. 1C), and OsNFY27 (Oryza sativa Nuclear Factor Y27) gene (LOC_Os01g39850) was selected among the NF-YC transcription factors whose gene expression was greatly increased during seed development 1D).

Expression of OsNFY27 gene was analyzed by RT-PCR (Reverse Transcription PCR). Specifically, RNA was isolated from the seeds and mature seeds at 0, 25, and 40 days after heading, respectively. A single cDNA chain was synthesized using total RNA as template (dT ₁₈ ), primer and reverse transcriptase (Superscript II reverse transcriptase, Invitrogen). Using the synthesized cDNA as a template, the nucleotide sequence-specific primer set of OsNFY27 (OsNFY27F: 5'-CTAGTGATGTTGCTGCTATA-3 '(SEQ ID NO: 4); OsNFY27R: 5'- CATCACGTCACCAAGGAATG-3' (SEQ ID NO: PCR was carried out under the conditions of 5 캜 for 5 minutes, 94 캜 for 30 seconds, -58 캜 for 20 seconds, 72 캜 for 30 seconds, 25 cycles and 72 캜 for 5 minutes.

As a result, it was confirmed that the expression of OsNFY27 gene was maximized in seeds 25 days after emergence (Fig. 2).

< Example  2> OsNFY27  Promoter Isolation and Recombinant Vector Production

<2-1> OsNFY27  Isolation of promoter

In order to isolate the promoter region of the OsNFY27 gene selected in Example 1, nucleotide sequence information of 1,809 bp at the start of translation was extracted from a genome database of rice (Nipponbarre). Then, a pair of specific primers (OsNFY27P-F1 / R) was specifically prepared to specifically amplify the nucleotide sequence (Table 1). PCR was performed using the genomic DNA of Dongjin cotton as a template using the primer set. PCR was carried out under the conditions of 94 ° C for 5 minutes, 94 ° C for 30 seconds, -58 ° C for 40 seconds, -72 ° C for 2 minutes and 35 cycles, and 72 ° C for 5 minutes. The amplified PCR product was cloned into pENTR / D-TOPO (Invitrogen) and the entire nucleotide sequence was determined. As a result, when compared with the promoter sequence of the LOC_Os01g39850 gene extracted from the genome database of Nipponbarre, 10 bp was deleted and a 1,799 bp promoter having a different 2 bp sequence was detected (FIG. 3). The 1,799 bp sequence was designated as SEQ ID NO: 1.

SEQ ID NO: primer  designation primer  direction The base sequence (5 '- &gt; 3') 2 OsNFY27P-F1 Forward gccgcccccttcacc TACTACTTTTCTATACTTTGGCAATC 3 OsNFY27P-R Reverse gt;

&Lt; 2-2 > Production of Recombinant Expression Vector Containing OsNFY27 Promoter

An expression vector containing the OsNFY27 promoter was prepared using a gateway system.

Specifically, the isolated promoter was cloned into a pBGWFS7 vector (PSB company, Plans System Biology) containing a GUS reporter gene to prepare an OsNFY27 promoter-GUS expression vector as shown in FIG. That is, the OsNFY27 promoter cloned into the pENTR / D-TOPO vector as an entry clone was cloned into pBGWFS7 containing a GUS reporter gene as a target vector through a substitution method using LR clonase (Invitrogen).

<2-3> OsNFY27  Present in the promoter Regulatory factor  Confirm

To identify the regulatory elements present in the OsNFY27 promoter, a public database PLACE (plant cis-acting element database: http://www.dna.affrc.go.jp/PLACE/) was used.

As a result, the OsNFY27 promoter contains three kinds of Amy boxes (Amy1, Amy2, and Amy3) associated with seed germination, and the motifs (Pyrimidine box, RY / G box, E box, CANBNNAPA or DPBFCOREDCDC3). In addition, there are two types of hormones (ABA, GA) that regulate seed germination and dormancy: GA-responsive element and ABRE-responsive element; sugar-responsive motif (SURE) (RD22) and a WRKY transcription factor binding site (W box). Other OsNFY27 promoters were found to have motifs related to root and pollen expression (Table 2).

Element name Motif sequence Numbers Positions PYRIMIDINEBOXOSRAMY1A  CCTTTT One  1376 (+) RYREPEATGMGY2  CATGCAT 5  677 (-), 686 (-), 739 (+), 934 (+), 1132 RYREPEATBNNAPA  CATGCA 6  678 (-), 687 (-), 689 (+), 739 (+), 934 (+), 1133 (-) EBOXBNNAPA (MYCCONSENSUSAT)  CANNTG 3  667 (+), 790 (+), 1129 (+) DPBFCOREDCDC3  ACACNNG 2  666 (+), 1492 (-) AMYBOX1  TAACARA 3  352 (-), 1700 (-), 1765 (+) AMYBOX2  TATCCAT One  27 (-) CGACGOSAMY3  CGACG One  436 (-) GAREAT  TAACAAR 5  352 (-), 576 (-), 1172 (+), 1700 (-), 1765 (+) ABRELATERD1  ACGTG One  958 (-) ROOTMOTIFTAPOX1  ATATT 10  92 (-), 108 (-), 127 (+), 409 (+), 539 (+), 829 (+), 1158 (-), 1202 (-), OSE1ROOTNODULE  AAAGAT 5  306 (-), 493 (+), 1322 (+), 1341 (+), 1444 (-) OSE2ROOTNODULE  CTCTT 4  101 (+), 349 (+), 1395 (+), 1695 (+) WRKY71OS  TGAC 10  162 (-), 240 (+), 504 (-), 924 (-), 1182 (-), 1192 (+), 1197 (+), 1497 LTRE1HVBLT49  CCGAAA One  870 (+) SURE1STPAT21  AATAGAAAA One  181 (-) SURECOREATSULTR11  GAGAC 2  142 (-), 1404 (-) MYCATRD22  CACATG One  667 (+) POLLEN1LELAT52  AGAAA 12  (-), 51 (-), 66 (-), 182 (-), 818 (+), 1363 (+), 1382 (-), 1386 (-), 1434 (+ 1744 (+), 1754 (+)

< Example  3> OsNFY27  Production of transgenic rice plants into which a promoter-GUS expression vector was introduced

In order to study the function of the OsNFY27 promoter, transgenic rice was prepared using the OsNFY27 promoter-GUS expression vector prepared in Example 2-2 above.

Specifically, the OsNFY27 promoter-GUS expression vector was introduced into Agrobacterium LBA4404 and then infected with Dong-Jinpyeong callus. Then, transformants were selected under 6 ug / l phosphinothricin (PPT) conditions and grown in the greenhouse. Genomic DNA was isolated from the leaves of the transgenic rice plants, and PCR was carried out using a primer present in a part (GUSA-anti) and a promoter part (OsNFY27P-F2) present in the introduced vector. (Table 3 and Fig. 5).

SEQ ID NO: primer  designation primer  direction The base sequence (5 '- &gt; 3') 6 GUSA-Anti Reverse CGCGATCCAGACTGAATGCCC 7 OsNFY27P-F2 Forward GTGTGTGCTTGCTATGTAGGTC

< Example  4> OsNFY27  Analysis of GUS Staining of Transgenic Rice for Tissue Expression of Promoter

Transgenic rice seeds with OsNFY27 promoter insertion confirmed according to Example 3 were harvested at the developmental stage and analyzed by GUS staining. GUS staining was carried out in a GUS staining solution (X-gluc 20mM, NaH2PO4H2O 100mM, NaEDTA 10mM, 0.1% Triton-X / pH7.5) at 37 ° C for 18-24 hours and 90% ethanol To remove the staining liquid.

As a result, it was confirmed that the seeds were strongly stained in the endosperm of the mature seeds. GUS expression was evident in endosperm from approximately 25 days (25 DAH) after heading when seedling maturation started. Prior to 25 DAH, specific GUS staining was observed in the aleurone layer, but was hardly stained in the embryo (FIGS. 6 and 7).

On the other hand, GUS staining of the transgenic rice seedlings after 14 days of germination showed that the stem was partially stained in root tissues and leaf tips, but not in most stems and leaves (FIG. 8).

Therefore, it has been proved that the OsNFY27 promoter can specifically express the gene of interest in the endosperm of rice seeds or in the hornbone layer.

<110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> OsNFY27 promoter specific for plant seed endosperm or aleurone          layer and uses thereof <130> P16R12D0640 <160> 7 <170> KoPatentin 3.0 <210> 1 <211> 1799 <212> DNA <213> Oryza sativa <400> 1 tactactttt ctatactttg gcaatcatgg atagatagct ttatgtaaat tttctgtttt 60 ctgttttctc cctctctccc ttcctttgta aatatctctc tcttataata tatatatata 120 tatatatatt gcagtaggag tctctcctgc tattttcatg tcaaaaaaaa aatactactt 180 ttctattagt gaggggcact ttttgttttt atccttaact actaaaatac ttgggatgac 240 taggaatcaa gttttttggg gaataaaggg agtgctatat atgccttgaa ctatttcgtt 300 tatcttttat tgtgtttcac tatttatttg tatgtggtat ggtactcttt gttaagctag 360 caagttccat gagtttattt atcaatgtac aatttggagt ggtatatttg attagcccgt 420 tttccttagg cgtcgcttgt agctaactgc taacatacaa aagtaattaa gtatgtataa 480 aattgaaaag atggcgagtc atgagagaga gcaatgtggc aaacaaactc tatattagca 540 ttcaaaagta aagtactaac atacaaagct tgttagctag tggttgctga ataacataca 600 aaagtaataa agtattaagt acatggagta taagttatgt agctaggacc acaaacaaca 660 catgatctat gcatggtatg catgcaaacc atgcacttac tgcaagcaag taggccagcc 720 aaagtccatc atgcatatat gtatggacat catggtttat tattaaatag gtcattagac 780 aattgcttgc gttacacaat gtacaaaaga aatgtaggat attaagctaa aatacaaaat 840 tctccagcag gaaaggcgcc gaaagtacac ttagtttgct agcaatggat cgagtactta 900 tctactgatc tagtcatcaa tccatgcatc catccatcat taaaccacgt agcatgtatt 960 ggctggaatc aagctatcac atatatgcgt gaatctaaag caaaacaaac tcctcgatat 1020 atcttgcaca catctagagc taaccgtccg ttgatcagct agctaactta gagatagatt 1080 agcatgtatg acacatcaat ttgaaatcat gatgcatatg catggtatag gagaggacaa 1140 acaaatatat gttcaattaa caagcaagtc aattcgtgac atgactaata tgttacgcaa 1200 ataaactgca ctactttatc ttggttgtct ttagcataag aagtgtggaa tgcatggttt 1260 agccttgtga gccccacata tattaaagct agctgtttca ctggaaaaga tacacgcaag 1320 gctaaaagat ttcaccaaac ccacaagaaa ctaataaacc tttttttctt tcttcaactc 1380 tttttcgtct cccttctcaa caatacagat atcatagaaa ccagaatctt ttaggcctat 1440 ataaaccacc ccaccttgca tactatgttc atcctcgtgt catattgtgt tcatcttcat 1500 actaccaacc aattagtgct aataggtagc attttctgta gttgcagctc aagtaaggta 1560 atgcacctac tagcttatta ttcttgtgcc tagtattaat tagtttttgt actggtactt 1620 gtgaaaattt gtgatttgag caatgctatt tgatttgtaa ttaagctagc tatctctttt 1680 tgttagactg caatgtaaca tcgttttgct aatttttgaa ctagaaaagt aagaaaaaga 1740 agtaacaaaa gtgtgtgctt gctatgtagg tctattattc agagcaacga agggaagga 1799 <210> 2 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> OsNFY27P-F1 primer <400> 2 gccgccccct tcacctacta cttttctata ctttggcaat c 41 <210> 3 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> OsNFY27P-R primer <400> 3 tcggcgcgcc caccctttcc ttcccttcgt tgctctg 37 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OsNFY27F primer <400> 4 ctagtgatgt tgctgctata 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OsNFY27R primer <400> 5 catcacgtca ccaaggaatg 20 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GUSA-Anti primer <400> 6 cgcgatccag actgaatgcc c 21 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> OsNFY27P-F2 primer <400> 7 gtgtgtgctt gctatgtagg tc 22

Claims (9)

An endosperm or aleurone layer-specific OsNFY27 (Oryza sativa Nuclear Factor Y27) promoter of a plant seed, which comprises the nucleotide sequence of SEQ ID NO: 1. The promoter according to claim 1, wherein the promoter is isolated from rice ( Oryza sativa L. ). A primer set as set forth in SEQ ID NO: 2 and SEQ ID NO: 3 for amplifying the OsNFY27 promoter of claim 1. A recombinant vector comprising the OsNFY27 promoter of claim 1. A transgenic plant transformed with the recombinant vector of claim 4. 6. The transgenic plant according to claim 5, wherein the transgenic plant is any one selected from the group consisting of rice, barley, wheat, sorghum and corn. A transformed seed obtained from a transgenic plant according to claim 5. 1) preparing a recombinant vector comprising an OsNFY27 (Oryza sativa Nuclear Factor Y27) promoter consisting of the nucleotide sequence of SEQ ID NO: 1 and a foreign gene operably linked thereto;
2) transforming the recombinant vector produced in step 1) into a plant using Agrobacterium to express the foreign gene specifically in the endosperm of the transformed plant or in the phylum. 9. The method according to claim 8, wherein the plant of step 2) is any one selected from the group consisting of rice, barley, wheat, sorghum and corn. Way.

Images