KR101705421B1 - Nucler Moelcules for detecting UV induced damage and Methods and Systems for evaluating UV induced damage and repairby using thereof - Google Patents

Abstract

The present invention provides a nucleic acid molecule for detecting ultraviolet ray damage, a recombinant vector, a transformant, and a method and apparatus for evaluating ultraviolet damage and restoration using the same, and a method and apparatus for searching ultraviolet ray damage control substances. More specifically, a nucleotide sequence encoding a polypeptide having hypoxanthine phosphoribosyl transferase activity as set forth in SEQ ID NO: 1, a nucleotide sequence encoding a polypeptide having a hypoxanthine phosphoribosyl transferase activity, a nucleotide sequence encoding a termination codon or a thymine dimer a nucleic acid molecule, a recombinant vector, a transformant, and an ultraviolet damage using the nucleic acid molecule, which are arranged in the sequence of a nucleotide sequence encoding a polypeptide having a luciferase activity described in SEQ ID NO: 2 and a thymine dimer And a restoration evaluation method and apparatus, and a method and apparatus for searching for ultraviolet ray damage control substances. Through the present invention, it is possible to overcome the disadvantages of existing substitution technologies and to maximize the advantages of the existing DNA damage control materials in terms of basic principles, technical completeness, sensitivity and efficiency, A method and apparatus for easily and accurately evaluating damage and repair and selecting ultraviolet damage control materials.

Description

TECHNICAL FIELD [0001] The present invention relates to nucleic acid molecules for detecting ultraviolet light damage, and to UV light damage and repair evaluation methods using the same. [0002]

The present invention relates to a nucleic acid molecule for detecting ultraviolet ray damage, a recombinant vector, a transformant, an ultraviolet ray damage and restoration evaluation method and apparatus using the same, and a method and apparatus for searching for ultraviolet ray damage control substances.

Skin is the largest organ in the body and forms the outermost part of the body. Thus, the skin is more exposed to external toxic substances, especially UV radiation, than other organs in the body. Human skin consists of the epidermis, dermis and hypodermis. The most dominant cells in the dermis are human dermal fibroblasts (HDFs) that contribute to skin hardness and elasticity. Persistent and long-term ultraviolet radiation causes major symptoms of skin aging such as upregulation of extracellular matrix metalloproteinases (MMPs), collagen degradation, and wrinkling (Non-Patent Documents 1 and 2). In addition, ultraviolet radiation causes damage to reactive oxygen species and chromosomes leading to cell senescence and suicide of human dermal fibroblasts (Non-Patent Document 3). Furthermore, exposure to ultraviolet radiation is an important inducer of skin diseases such as photodermatoses, actinic keratosis and skin cancer (Non-Patent Document 3). Ultraviolet-induced skin aging is not an inevitable natural consequence, but can be controlled by extracellular factors, i.e. aging, by avoiding ultraviolet radiation (Non-Patent Document 4).

Many studies have shown that application of a chemical sunscreen, commonly known as sunscreen with a suitable sun protection factor (SPF), may be beneficial for the treatment of DNA damage by ultraviolet light such as pyrimidine dimer formation in human skin (Non-Patent Documents 5 and 6). The effectiveness of these sunscreens has been challenged by new studies. In particular, sunscreen agents are useful for preventing chromosomal damage by ultraviolet rays only when used regularly (Non-Patent Documents 7 and 8). When the ultraviolet absorber was used irregularly, the level of ultraviolet-induced thymine dimer in human skin was statistically significantly increased even though it was only once before the ultraviolet radiation exposure (Non-Patent Document 8). Moreover, the number of daylight cell counts, degree of inflammation, intensity of lysozyme staining, and number of Langerhans cells were significantly different from those at regularly applied ultraviolet screening agents at irregular UV screening sites (see Non-Patent Literature 7). In addition, recent studies have shown that sunscreens with superior UVA blocking and UVB SPF 50 retarded the development of UVA melanoma skin cancer, but only partial protection, It has been found that ultraviolet light penetrates ultraviolet light blocking agents slightly, resulting in long-term chromosomal damage even when the sun protection factor is 50 or more (Non-Patent Document 9).

These results suggest that ultraviolet screening with sunscreen does not protect against ultraviolet radiation in human skin, because ultraviolet screening agents exert only a physical protective effect within the time of a given ultraviolet screening index, Blocking also means that there is no continuous UV protection effect. Therefore, identifying novel factors that exert biological UV protection effects in human cells is important for future research to prevent UV-induced skin aging.

1. U.S. Published Patent Application No. US20110020806A1 2. European patent application EP1262553A1

N. Philips, S. Auler, R. Hugo, and S. Gonzalez, Beneficial regulation of matrix metalloproteinases for skin health, Enzyme Res. 427285 (2011); DOI: 10.4061 / 2011/427285. O. Friedman, Changes associated with the aging face, Facial Plast. Surg. Clin. North. Am. 13 (2005) 371-380; DOI: 10.1016 / j.fsc.2005.04.004. B. Wang, Photoaging: a review of current concepts of pathogenesis, J. Cutan. Med. Surg. 15 Suppl 1 (2011) S374-377; DOI: 10.2310 / 7750.2011.00006. M.A. Farage, K.W. Miller, P. Elsner, and H.I. Maibach, Intrinsic and extrinsic factors in skin aging: a review, Int. J. Cosmet. Sci. 30 (2008) 87-95; DOI: 10.1111 / j.1468-2494.2007.00415.x. A. Fourtanier, D. Moyal, and S. Seite, Sunscreens containing the broad-spectrum UVA absorber, Mexoryl (R) SX, preventative cutaneous detrimental effects of UV exposure: a review of clinical study results, Photodermatol. Photoimmunol. Photomed. 24 (2008) 164-174; DOI: 10.1111 / j.1600-0781.2008.00365.x. S.E. Freeman, R.D. Ley, and K.D. Ley, Sunscreen protection against UV-induced pyrimidine dimers in DNA of human skin in situ, Photodermatol. 5 (1988) 243-247; DOI: 10.1046 / j.0022-202x.2001.01580.x. T.J. Phillips, J. Bhawan, M. Yaar, Y. Bello, D. Lopiccolo, and J.F. Nash, Effect of daily versus intermittent sunscreen application on solar simulated UV radiation-induced skin response in humans, J. Am. Acad. Dermatol. 43 (2000) 610-618; DOI: 10.1067 / mjd.2000.107244. M. Al Mahroos, M. Yaar, T.J. Phillips, J. Bhawan, and B.A. Gilchrest, Effect of sunscreen application on UV-induced thymine dimers, Arch. Dermatol. 138 (2002) 1480-1485; DOI: 10.1001 / archderm.138.11.1480. A. Viros, B. Sanchez-Laorden, M. Pedersen, S.J. Furney, J. Rae, K. Hogan, S. Ejima, M.R. Girotti, M. Cook, N. Dhomen, and R. Marais, Ultraviolet radiation accelerates BRAF-driven melanomagenesis by targeting TP53, Nature 511 (2014) 478-482; DOI: 10.1038 / nature13298. I.S. An, S. An, S.M. Kang, T.B. Choe, S.N. Lee, H.H. Jang, and S. Bae, Titrated extract of Centella asiatica provides a UVB protective effect by altering microRNA expression profiles in human dermal fibroblasts, Int. J. Mol. Med. 30 (2012) 1194-1202; DOI: 10.3892 / ijmm.2012.1117. I.S. An, S. An, S. Park, S.N. Lee, and S. Bae, Involvement of microRNAs in epigallocatechin gallate-mediated UVB protection in human dermal fibroblasts, Oncol. Rep. 29 (2013) 253-259; DOI: 10.3892 / or.2012.2083.

There is a need for a method and an apparatus for easily and accurately evaluating ultraviolet ray damage and restoration on human cells and selecting ultraviolet ray damage control substances by supplementing and shortening the disadvantages of existing DNA damage control materials.

In order to accomplish the above object, the present invention provides a nucleic acid molecule capable of detecting DNA damage caused by ultraviolet rays.

In particular, the nucleic acid molecule according to the present invention comprises a nucleotide sequence encoding a polypeptide having hypoxanthine phosphoribosyl transferase activity as set forth in SEQ ID NO: 1, a stop codon or a stop codon according to a change of the cyanine on the sequence to a thymine A nucleotide sequence arranged in the sequence of a nucleotide sequence encoding a polypeptide having a luciferase activity as shown in SEQ ID NO: 2 and a sense sequence for generating a thymine dimer.

According to the present invention, the nucleotide sequence encoding the polypeptide having hypoxanthine phosphoribosyl transferase activity as set forth in SEQ ID NO: 1 is a sequence as set forth in SEQ ID NO: 3.

According to the present invention, the nucleotide sequence encoding the polypeptide having luciferase activity as set forth in SEQ ID NO: 2 is a sequence as set forth in SEQ ID NO: 4.

According to the present invention, the termination codon is any one selected from the group consisting of TAG, TAA, TGA, UAG, UAA and UGA.

According to the present invention, the detection sequence is SEQ ID NO: 5.

According to the present invention, there is provided a recombinant vector comprising the aforementioned nucleic acid molecule.

According to the present invention, the recombinant vector is lentivirus.

According to the present invention, there is provided a transformant which is introduced into a host cell so as to express the above-mentioned recombinant vector.

According to the present invention, the host cell is human dermal fibroblast.

According to the present invention, there is provided a transformant which is introduced into a host cell so that the lentiviral recombinant vector described above is expressed.

According to the present invention, the introduced host cell expressing the lentiviral vector is human dermal fibroblast.

According to the present invention, the above-mentioned transformant is used to perform any one or more of cytotoxicity analysis, DNA mutation analysis, cell cycle and cell death inhibition analysis, flow cytometry analysis and luciferase activity assay, And a method for evaluating recovery.

According to the present invention, the above-mentioned transformant is used to perform any one or more of cytotoxicity analysis, DNA mutation analysis, cell cycle and cell death inhibition analysis, flow cytometry analysis and luciferase activity assay, Thereby providing a method for searching for an adjustable substance.

According to the present invention, the above-mentioned transformant is used to perform any one or more of cytotoxicity analysis, DNA mutation analysis, cell cycle and cell death inhibition analysis, flow cytometry analysis and luciferase activity assay, And a device for evaluating recovery.

According to the present invention, the above-mentioned transformant is used to perform any one or more of cytotoxicity analysis, DNA mutation analysis, cell cycle and cell death inhibition analysis, flow cytometry analysis and luciferase activity assay, An apparatus for searching for an adjustable substance is provided.

The present invention overcomes the disadvantages of conventional DNA damage control materials in terms of basic principles, technical completeness, sensitivity, efficiency, etc., and overcomes the disadvantages of existing alternative technologies and maximizes advantages, A method and apparatus for easily and accurately assessing restoration and screening for ultraviolet light damage control materials.

FIG. 1A is a schematic diagram of pLenti-HT-Luciferase, pCMV-VSV-G and pCMV-dR8.2 vectors used in the present invention. LTR, long terminal repeat sequence; RRE, rev response element; cPPT, central polypurine tract; P _CMV , cmv promoter; MCS, multiple cloning sites; IRES, internal ribosome entry site; Puro ^R , puromycin resistant gene; WPRE, woodchuck hepatitis virus post-transcriptional regulatory element; VSV-G, vesicular stomatitis virus GP; PolyA, poly-A sequence.
FIG. 1B is a schematic diagram of SS (SS, SS-R, SS-F) vectors for the detection sequences of pLenti-HT-Luciferase used in the present invention. LTR, long terminal repeat sequence; RRE, rev response element; cPPT, central polypurine tract; P _CMV , cmv promoter; MCS, multiple cloning sites; IRES, internal ribosome entry site; Puro ^R , puromycin resistant gene; WPRE, woodchuck hepatitis virus post-transcriptional regulatory element; VSV-G, vesicular stomatitis virus GP; PolyA, poly-A sequence.
FIG. 1C shows the results of evaluating the effect of the transformant according to the present invention on UV-induced damage by SS, SS-R, and SS-F, respectively. The mean ± standard deviation of the results of the third experiment. * P < 0.05, significant relative to control WS1 cells.
2A is a schematic diagram showing a process for producing a lentiviral-expressing lentiviral vector according to the present invention.
FIG. 2B is a schematic diagram showing a process for producing a luciferase-expressing transformant (WS-1 cell) according to the present invention. DREAM-F is a selection of transformants with excellent activity (see Fig. 2c for selection process).
FIG. 2C shows the results of measuring the luciferase activity of each of the transformants obtained according to FIG. 2B for each clone. Clone 6, which exhibits excellent activity, is selected as DREAM-F.
FIG. 3A is a schematic diagram of a method and apparatus for selecting ultraviolet radiation damage control materials (1) using the transformant (DREAM-F) according to the present invention. Cells were inoculated on a culture dish, treated with candidate substances before or after UV irradiation, and WST-1 assay and luciferase activity were measured.
FIG. 3B shows the results of evaluating cytotoxicity against TECA, EGCG, CA and QC using the sorting apparatus according to FIG. 3A. The mean ± standard deviation of the results of the third experiment.
FIG. 3C is a result of evaluating ultraviolet protection effect (cell viability, WST-1 analysis) on TECA, EGCG, CA and QC using the sorting apparatus according to FIG. The mean ± standard deviation of the results of the third experiment. * P < 0.05, significant compared to UV-irradiated DREAM-F cells.
FIG. 3D shows the results of evaluating ultraviolet protection effect (change in luciferase activity) against TECA, EGCG, CA and QC using the screening apparatus according to FIG. 3A. The mean ± standard deviation of the results of the third experiment. * P <0.05, significant relative to control WS1 cells and UV-irradiated DREAM-F cells.
FIG. 4 is a schematic diagram of a method and apparatus for selecting ultraviolet radiation damage control materials (2) using the transformant (DREAM-F) according to the present invention. Cells were inoculated on a culture dish, treated with candidate substances before or after irradiation with ultraviolet light, and subjected to fluorescent PI staining FACS analysis and mutation analysis (cDNA synthesis and DNA sequencing analysis).

Before describing the specific contents of the present invention, the meanings used in this specification will be described.

As used herein, the term &quot; polypeptide &quot; is interpreted to include an amino acid sequence that exhibits substantial identity to the amino acid sequence of interest. The above-mentioned substantial identity is determined by aligning the amino acid sequence of the present invention with any other sequence as much as possible, and analyzing the aligned sequence using the algorithm commonly used in the art, at least 60% Homology, more preferably at least 80% homology, most preferably at least 90% homology.

For example, the polypeptide may comprise at least about 60%, at least 80%, at least 90%, at least 95%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4% , 99.5% or more, or 99.9% or more identity with a beta-adipate pathway. In general, the higher the percent identity, the more preferable.

Also, the polypeptides having the above identity include polypeptides associated with the beta-adipate pathway, including amino acid sequences in which one or more amino acid residues are deleted, substituted, inserted, and / or added in the polypeptide of the specific amino acid sequence described do. In general, the smaller the number of elimination, substitution, insertion, and / or addition is, the more preferable.

As used herein, the term &quot; polynucleotide &quot; has a meaning inclusive of DNA (gDNA and cDNA) and RNA molecules, and the nucleotide, which is a basic constituent unit in the nucleic acid molecule, includes not only natural nucleotides, It also includes analogues.

The polynucleotide of the present invention is not limited to a nucleic acid molecule encoding the above-described specific amino acid sequence (polypeptide), and may be a polynucleotide having an amino acid sequence exhibiting substantial identity to a specific amino acid sequence as described above or a poly Is interpreted to include nucleic acid molecules encoding the peptides. The above substantial identity is determined by aligning the amino acid sequence of the present invention with any other sequence to the greatest correspondence and analyzing the aligned sequence using algorithms commonly used in the art to obtain a homology of at least 60% , More preferably at least 80% homology, and most preferably at least 90% homology.

The polypeptide having the corresponding function includes, for example, a polypeptide having an amino acid sequence in which one or more amino acids are deleted, substituted, inserted, and / or added. Such a polypeptide is preferably a polypeptide having an amino acid sequence in which one or more amino acid residues are deleted, substituted, inserted, and / or added as described above and which has an activity (hypoxanthine phospholiposyltransferase, luciferase) Peptide, and it is preferable that the number of disappearance, substitution, insertion, and / or addition of amino acid residues is small. The polypeptide also includes a polypeptide having an amino acid sequence having about 60% or more identity with the specific amino acid sequence described above and having an activity (hypoxanthine phospholiposyl transferase, luciferase) The higher the identity, the better.

The term " complementary "or" complementarity ", as used herein, refers to the ability of purine and pyrimidine nucleotides to bind through hydrogen bonding to form double stranded polynucleotides, including partially complementary. The following base pairs are associated with complementarity: guanine and cytosine; Adenine and thymine; And adenine and uracil. "Complementary" applies substantially to all base pairs in which the above-mentioned relationship includes two single-stranded polynucleotides across the molecule of the full length. "Partially complementary" means that a portion of one of the molecules remains as a single strand because the length of one of the two single-stranded polynucleotides is short.

"Outpatient" refers generally to polynucleotide sequences or polypeptides that are not naturally occurring in wild-type cells or organisms, but are typically introduced into cells by molecular biology techniques, i.e., engineering processes for producing recombinant microorganisms.

 A "recombinant" microorganism typically comprises one or more foreign nucleotide sequences, e.g., in a plasmid or vector.

 The term "vector" refers to any nucleic acid that is inserted into a host cell, recombined with the host cell genome, inserted into it, or contains a competent nucleotide sequence that replicates spontaneously as an episome. Such vectors include linear nucleic acids, plasmids, phagemids, cosmids, RNA vectors, and viral vectors.

 "Transfection or transfection" refers to the process by which extracellular DNA enters a host cell in the absence and presence of entities. "Transfected cell" refers to a cell in which extracellular DNA is introduced into a cell and contains extracellular DNA. DNA can be introduced into the cell and the nucleic acid can be inserted into the chromosome or replicated as an extrachromosomal material.

"Host cell" may be a receptor of any recombinant vector (s) or isolated polynucleotide of the present invention, or includes individual cells or cell cultures that are receptors. The host cell may be a progeny of a single host cell, and the progeny may not be completely identical to the original parent cell (either in form or in a total DNA image) due to natural, accidental or artificial mutations and / or alterations. Host cells include cells transfected, transformed, or infected with a recombinant vector or polynucleotide of the invention in vivo or in vitro. A host cell comprising the recombinant vector of the present invention is a recombinant host cell, a recombinant cell, or a recombinant microorganism.

In order to accomplish the above object, the present invention provides a nucleic acid encoding a polypeptide having a hypoxanthine phosphoribosyl transferase activity as set forth in SEQ ID NO: 1, a nucleotide sequence encoding a polypeptide having a hypoxanthine phosphoribosyl transferase activity, A nucleic acid molecule, a recombination vector, a trait and a nucleotide sequence which are arranged in order of a nucleotide sequence encoding a polypeptide having luciferase activity as set forth in SEQ ID NO: 2 and a detection sequence for generating a stop codon or a thymine dimer And a method and an apparatus for searching ultraviolet damage and restoration using the same, and a method and an apparatus for searching ultraviolet ray damage control material. BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail with reference to the drawings.

The present invention relates to a nucleotide sequence encoding a polypeptide having hypoxanthine phosphoribosyl transferase activity as set forth in SEQ ID NO: 1, a nucleotide sequence encoding a termination codon or a thymine dimer dimer) and a nucleotide sequence encoding a polypeptide having luciferase activity as set forth in SEQ ID NO: 2.

That is, the present invention relates to a human housekeeping gene hypoxanthine phosphoribosyl - transferase ( HPRT -SS-Luciferase), which is cloned so that the HPRT and the sensor sequence (SS) are located upstream of the luciferase gene. The HPRT gene is a house keeping gene involved in the metabolicism of the DNA base. It is used to detect the degree of CT mutation caused by ultraviolet rays. The detection sequence is terminated by CT mutation (CAG → UAG) and thymine dimer formation Is a nucleotide sequence designed to inhibit the transcription of DNA into mRNA and affect the transcription level of the luciferase gene located behind the sense sequence. The gene group includes a case where the complementary genes of the respective genes are arranged in the reverse order so that the respective genes can be expressed in order, and the genes are expressed in the same order.

The nucleotide sequence encoding the polypeptide having hypoxanthine phosphoribosyl transferase activity described in SEQ ID NO: 1 may be the sequence described in SEQ ID NO: 3.

The detection sequence is a sequence capable of generating a stop codon or forming a thymine dimer when cyanine is changed to thymine in the sequence, and is, for example, a sequence comprising CCAG or TTTT. That is, the second C in CCAG changes to T, resulting in a TAG, which becomes a termination codon. The termination codon may be any one selected from the group consisting of TAG, TAA, TGA, UAG, UAA, and UGA. For example, the detection sequence may be any one or more selected from SEQ ID NOS: 5 to 7.

The nucleotide sequence encoding the polypeptide having the luciferase activity described in SEQ ID NO: 2 may be the sequence described in SEQ ID NO: 4.

The present invention provides a recombinant vector comprising the nucleic acid molecule described above. The recombinant vector may be lentivirus. The recombinant vector may include a constitutive or inducible promoter, a transcription enhancer, a transcription terminator and the like for regulating expression of the gene. When expressing a plurality of exogenous genes, several genes may be inserted into one recombinant vector or inserted into a separate recombinant vector. The recombinant vector can be introduced into a host cell in a known manner. Each of the polynucleotides may be operatively linked to the same or different promoters, respectively.

In addition, the present invention provides a transformant which is introduced into a host cell so as to express the above-mentioned recombinant vector. The transformant may be produced by a transformation method of introducing the transformant into an host cell using an expression cassette such as a recombinant vector. The introduction method may also be carried out by a known technique, for example, transformation with a calcium chloride method, heat shock method, Or introduced through transfection with recombinant phage virus or lentivirus. It will be apparent to those skilled in the art that various strains can be readily used depending on the vector, which varies depending on the purpose of expression, in addition to the above host cells.

The host cells usable for the production of the transformant of the present invention are not limited to bacteria, yeast, fungi, etc. In order to more closely match the application effects of the present invention with the actual effects in the human body, human skin cells, human dermal fibroblasts .

The present invention uses the transformant described above to perform one or more of cytotoxicity analysis, DNA mutation analysis, cell cycle and cell death inhibition analysis, flow cytometry analysis and luciferase activity assay, Quot; is &lt; / RTI &gt;

The present invention relates to a method for producing a cytotoxic agent capable of regulating cytotoxicity-regulating substances by ultraviolet rays by carrying out one or more of cytotoxicity analysis, DNA mutation analysis, cell cycle and cell death suppression analysis, flow cytometry analysis and luciferase activity assay using a transformant And provides a method for searching.

The present invention uses the transformant described above to perform one or more of cytotoxicity analysis, DNA mutation analysis, cell cycle and cell death inhibition analysis, flow cytometry analysis and luciferase activity assay, Is provided.

In the present invention, the above transformant can be used to perform cytotoxicity analysis, DNA mutation analysis, cell cycle and cell death inhibition analysis, flow cytometry analysis and luciferase activity assay, A device for searching for a substance is provided.

Hereinafter, the present invention will be described in more detail with reference to Examples. It should be understood, however, that these examples are for illustrative purposes only and are not to be construed as limiting the scope of the present invention.

[ Example ]

1. Cells and reagents

Normal human dermal fibroblasts (NHDFs) were purchased from Lonza (Basel, Switzerland) and human dermal fibroblast WS1 cells were purchased from CLS cell line service (Eppelheim, Germany). The cells were cultured in Dulbecco's modified Eagle's medium (DMEM, Gibco, Life Technologies, Grand Island, New York, USA) containing 10% fetal bovine serum (FBS, Sigma-Aldrich, St. Louis, Missouri, USA) And stored in a humidified chamber containing 37 ° C and 5% carbon dioxide. To analyze cytotoxicity and luciferase activity, 5 × 10 ³ cells were inoculated into 96-well culture dishes and cultured. Titrated extracts of Centella asiatica ( TECA) were purchased from Bayer HealthCare (Berlin, Germany), and were mixed with dimethylsulfoxide (DMSO), quercetin and caffeic acid caffeic acid) was purchased from Sigma-Aldrich.

2. Preparation of recombinant transformants

The open reading frame (ORF) of the firefly luciferase gene (SEQ ID NO: 4) in the pGL3 luciferase receptor vector (Promage, Madison, Wis., USA) was PCR amplified using the following primers 1B).

Detection sequence classification direction The base sequence (5'-3 ') location order
number
SS forward CGGATCC AGCCAGAGCCAGTTTTTG ATGGAAGACGC BamHI and sense sequence
(sensor sequence) 6 backward GGAATTCCTTACACGGCGATC EcoRI 7 SS-F forward CGGATCC CCAG ATGGAAGACGC BamHI and sense sequence
(sensor sequence) 8 backward GGAATTCCTTACACGGCGATC EcoRI 9 SS-R
forward CGGATCC TTTTT ATGGAAGACGC BamHI and sense sequence
(sensor sequence) 10 backward GGAATTCCTTACACGGCGATC EcoRI 11

The PCR product was cloned by introducing into a Lenti-HT vector (obtained from Professor Lee Jae Ho of Kanto Univ., Korea).

hypoxanthine An open reading frame (ORF) of phosphoribosyl - transferase (HPRT) (SEQ ID NO: 3) was PCR amplified using the following primers.

direction The base sequence (5'-3 ') location SEQ ID NO: forward CGGATCCACCATGGCGACCCGCAG BamHI 12 backward CGGATCCGGCTTTGTATTTTGC 13

The HPRT PCR product was introduced into the Lenti-HT-luciferase vector and cloned.

The lenti-HT-luciferase / HPRT lentiviral transfer vector, pCMV-dR8.2 (Addgene, Cambridge, Massachusetts, USA) and the pCMV-HPRT lentiviral transfer vector described above were used to generate a recombinant lentivirus containing luciferase and HPRT -VSV-G plasmid (Addgene) was introduced into embryonic kidney 239T cells, and the introduced cells were cultured for 48 hours. (See Figs. 1A and 1B, see Fig. 2A)

After 48 hours of culture, the medium containing the recombinant lentiviral particles was collected and introduced into WS1 cells (incubation for 48 hours). The transgenic WS1 cells were selected by culturing in DMEM medium containing 1 / / ml of puromycin.

galactosidase (β-gal) was introduced by introducing pSMPUM-MNDnLacZ vector (Cell Biolabs, Inc., San Diego, Calif., USA), pCMV-dR8.2 and pCMV-VSV- After expressing the lentivirus, it was further introduced into the selected WS1 cells.

WS1 cells infected with lentivirus were inoculated into a 96-well culture dish containing furomycin to express the luciferase and beta-galactosidase, followed by culturing for one week to perform puromycin selection (primary selection).

The primary selected infected WS1 cells were separated into trypsin, single cells were inoculated into 96-well culture dishes, cultured for 2 weeks, and collected for each clone. Each collected monoclonal cell was inoculated into a 12-well culture dish and cultured for 24 hours, followed by lysophosphatase activity assay. As a result, the cells with the most excellent effects were selected and designated as DREAM-F.

3. Experimental Method

(1) Luciferase assay

Cells were inoculated into 96-well culture dishes, treated with reagents and UVB radiation, and the cell culture medium was removed. 50 μl of Passive Lysis Buffer (Promega) was added to each well and incubated for 5 minutes. Half of the cell hydrolyzate obtained in each well was transferred to a white opaque luminometer microtiter plate and mixed with 80 Luc of Luciferase Assay Reagent (Promega). The luciferase activity in each well was measured using a Veritas Luminometer (Turner Designs, Sunnyvale, Calif., USA). The remaining half of the cell hydrolysates obtained in each well were used for the measurement of beta -galactosidase activity using Luminescent beta-galactosidase Detection Kit II (Clontech Laboratories, Inc., Mountain View, Calif., USA). The relative activity of luciferase was standardized for beta-galactosidase activity. The results were averaged over three experiments.

(2) Ultraviolet radiation

Prior to exposure to UVB radiation, cells were inoculated into 96-well and 60-mm culture dishes and cultured overnight in growth media. When the cells became over 70% confluent, cells were resuspended in DMSO, TECA and Epigallocatechin gallate (EGCG) for Centella asiatica ). After the pretreatment, the plate was washed twice with phosphate buffered saline (PBS), and the lid of the cell culture dish was removed to expose it to UVB of 100 mJ / cm ² in a state where the UVB was not removed. The transfected cells were cultured in growth medium for 24 hours. In the posttreatment experiment, UVB radiation was first treated and then treated with reagent for 24 hours.

(3) Cytotoxicity test

Cytotoxicity and UVB protection effects on individual reagents were evaluated by water-soluble tetrazolium salt (WST-1) analysis (EZ-Cytox cell viability assay kit, Itsbio, Seoul, Korea). After the above-described treatment protocol, the cells were inoculated in a 96-well culture dish and cultured at 37 ° C for 30 minutes, followed by the addition of 10 μl of the WST-1 kit solution.

Cell viability was assessed by measuring the absorbance at 450 nm using an iMark microplate reader (Bio-Rad, Hercules, Calif., USA). Three experiments were performed and the results were expressed as mean ± standard deviation (SD).

(4) Flow cytometric analysis

After the reagent and UVB radiation treatment, the cells were harvested, washed twice with cold phosphate buffered saline, and suspended in 1 ml of cold 70% ethanol. Thereafter, the cells were incubated at -20 DEG C for 2 hours and fixed. Then, the cells were washed with cold phosphate buffered saline and stained with propidium iodide (PI) staining solution (50 μg / ml PI [Sigma-Aldrich], 0.5% Triton X-100 [Sigma -Aldrich] and 100 [mu] g / ml RNase) and incubated at 37 [deg.] C for 1 hour.

Cells in different cell cycles were measured by evaluating the intensity of fluorescent PI staining for 10,000 cells using a FL2-H channel of a FACS Calibur flow cytometer (BD Biosciences, San Jose, Calif., USA).

4. Experimental results

(1) Preparation of Recombinant Transformants Luciferase  Activity evaluation and DREAM -F selection

The recombinant transformants were irradiated with ultraviolet rays and the change of luciferase activity was measured in each of the above-prepared sense sequences (SS, SS-F and SS-R). After culturing for 24 hours, the cells were irradiated with 100 J / cm ² ultraviolet light (UVB) and further cultured for 24 hours. After culturing, cells were collected and lysed to perform luciferase and beta-galactosidase assays. As a result, the activity of luciferase after ultraviolet irradiation was statistically significantly decreased (P < 0.05, see Fig. 1C). Among these, the decrease in the activity of luciferase was the largest in the group using the detection sequence SS.

The WS1 cells infected to express the above-mentioned luciferase and beta-galactosidase (sense sequence SS) were inoculated into 96-well culture dishes and then subjected to puromycin selection (primary selection). Since the genome of the luciferase fused lentivirus used in the present invention is randomly inserted into the cell DNA, the luciferase activity of each cell differs. Therefore, in order to construct an effective screening method and apparatus, it is necessary to select the above-mentioned fusion gene inserted at the same position of the cell. Single clone screening was performed for this purpose (see the experimental method above). Luciferase expression in each individual clone was measured using a luminometer, and expression levels were analyzed by comparing the expression levels of β-gal.

FIG. 2C shows the results of performing clonal selection on the recombinant transformants using the detection sequence SS with the greatest decrease in luciferase activity and performing luciferase activity for each clone. Among these, clone 6 cells showing the highest expression of luciferase were selected and designated as DREAM-F cells and used in the subsequent system construction.

(2) Ultraviolet ray damaging effect and restoration evaluation and method of selecting ultraviolet ray damage control material and system configuration (1)

The DREAM-F cells obtained above were used to construct a system and method for screening ultraviolet light damage control substances.

The first step determines the appropriate experimental concentration in terms of cytotoxicity for the candidate substance. The DREAM-F cells are inoculated into 96-well culture dishes, and various candidate substances are treated at a concentration of 4 to 5 times the concentration determined above. After 24 hours incubation, WET-1 assay is performed to assess cytotoxicity. WST has the advantage that it does not need any additional process because it changes into water-soluble formazan.

After evaluating the cytotoxicity of each candidate substance, the ultraviolet damage repair effect can be evaluated. To evaluate the ultraviolet protection effect, DREAM-F cells were treated with a candidate for a low cytotoxic concentration for 6 hours and irradiated with ultraviolet rays of 100 J / cm ² . After culturing for 24 hours, WST-1 analysis is performed to analyze cytotoxicity and luciferase activity. For the ultraviolet damage repair effect, the cells are first irradiated with ultraviolet rays, and the respective candidate substances are treated and analyzed. A schematic diagram of the system is shown in FIG.

In order to verify the system of the present invention, the titrated extract of Centella (Centella asiatica) asiatica, TECA), experiments were performed with respect to the rates going to go epi catechins (epigallocatechin gallate, EGCG), quercetin (quercetin, QC) and cafe acid (caffeic acid, CA) (Non-Patent Document 10 to 13).

The experimental results are shown in FIG. 3B. (TECA) and epigallocatechin gallate (EGCG) were cytotoxic to DREAM-F cells at relatively high concentrations, whereas quercetin (QC) and caffeic acid (CA) Did not show cytotoxicity. On the other hand, only the Quantitative Extract (TECA) and Epigallocatechin gallate (EGCG) of Centella asiatica (Centella asiatica) showed UV protection effect and ultraviolet ray damage recovery effect on DRAM-F cells (FIG. According to further experimental results, the Quantitative Extract (TECA) and Epigallocatechin gallate (EGCG) of Centella asiatica (Centella asiatica) inhibited the decrease of UV-induced luciferase activity (FIG. 3D). This means that Quantitative Extract (TECA) and Epigallocatechin gallate (EGCG) of Centella asiatica (Centella asiatica) have ultraviolet protection and damage restoration effect in human dermal fibroblast.

In other words, it has been reported that quercetin (QC) and caffeic acid (CA) are antioxidant in hairless mouse and lymphocyte according to the existing studies, but this effect is caused by cell specificity or deterioration of cell viability by ultraviolet Can be inferred as not directly related.

In conclusion, the results of the above studies show that the ultraviolet ray damage and restoration evaluation method and apparatus using DREAM-F cells according to the present invention are useful for screening and screening substances that regulate UV damage in human skin cells.

(3) Ultraviolet ray damaging effect and restoration evaluation and method for selecting ultraviolet ray damage control material and system configuration (2)

 A system for quantitatively evaluating the degree of DNA damage caused by ultraviolet rays was constructed using DREAM-F cells according to the present invention (see FIG. 4). That is, it is possible to evaluate changes in cell cycle and DNA mutation by ultraviolet light.

The DREAM-F cells are inoculated into a 60 cm or 6-well culture dish and treated with candidate substances before or after UV irradiation. After 24 hours of culture, cells are collected and fluorescent PI staining is performed. The stained cells are analyzed for cell cycle using a flow cytometer. To measure the number of mutations, the candidate material and ultraviolet-treated cells are cultured for 96 hours and then subjected to total RNA purification and cDNA synthesis. Analyze HPRT-SS-Luciferase fusion gene using cDNA sequencing.

(TECA) and epigallocatechin gallate (EGCG) reduced the accumulation of sub-G1 phase cells in ultraviolet irradiated cells, which ultimately led to the ultraviolet irradiation of human dermal fibroblasts (Non-patent documents 10 and 11).

While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereby. something to do. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

<110> Industry Academic Cooperation Foundation of Konkuk University <120> Nucler Moelcules for detecting UV induced damage and Methods and          Systems for evaluating UV induced damage and repairby using          the <130> pn1411-343 <160> 13 <170> Kopatentin 2.0 <210> 1 <211> 218 <212> PRT <213> Hypoxanthine phosphoribosyl transferase polypeptide sequence <400> 1 Met Ala Thr Arg Ser Pro Gly Val Val Ile Ser Asp Asp Glu Pro Gly   1 5 10 15 Tyr Asp Leu Asp Leu Phe Cys Ile Pro Asn His Tyr Ala Glu Asp Leu              20 25 30 Glu Arg Val Phe Ile Pro His Gly Leu Ile Met Asp Arg Thr Glu Arg          35 40 45 Leu Ala Arg Asp Val Met Lys Glu Met Gly Gly His His Ile Val Ala      50 55 60 Leu Cys Val Leu Lys Gly Gly Tyr Lys Phe Phe Ala Asp Leu Leu Asp  65 70 75 80 Tyr Ile Lys Ala Leu Asn Arg Asn Ser Asp Arg Ser Ile Pro Met Thr                  85 90 95 Val Asp Phe Ile Arg Leu Lys Ser Tyr Cys Asn Asp Gln Ser Thr Gly             100 105 110 Asp Ile Lys Val Ile Gly Gly Asp Asp Leu Ser Thr Leu Thr Gly Lys         115 120 125 Asn Val Leu Ile Val Glu Asp Ile Ile Asp Thr Gly Lys Thr Met Gln     130 135 140 Thr Leu Leu Ser Leu Val Arg Gln Tyr Asn Pro Lys Met Val Lys Val 145 150 155 160 Ala Ser Leu Leu Val Lys Arg Thr Pro Arg Ser Val Gly Tyr Lys Pro                 165 170 175 Asp Phe Val Gly Phe Glu Ile Pro Asp Lys Phe Val Val Gly Tyr Ala             180 185 190 Leu Asp Tyr Asn Glu Tyr Phe Arg Asp Leu Asn His Val Cys Val Ile         195 200 205 Ser Glu Thr Gly Lys Ala Lys Tyr Lys Ala     210 215 <210> 2 <211> 550 <212> PRT <213> Luciferase polypeptide sequence <400> 2 Met Glu Asp Ala Lys Asn Ile Lys Lys Gly Pro Ala Pro Phe Tyr Pro   1 5 10 15 Leu Glu Asp Gly Thr Ala Gly Glu Gln Leu His Lys Ala Met Lys Arg              20 25 30 Tyr Ala Leu Val Pro Gly Thr Ile Ala Phe Thr Asp Ala His Ile Glu          35 40 45 Val Asp Ile Thr Tyr Ala Glu Tyr Phe Glu Met Ser Val Arg Leu Ala      50 55 60 Glu Ala Met Lys Arg Tyr Gly Leu Asn Thr Asn His Arg Ile Val Val  65 70 75 80 Cys Ser Glu Asn Ser Leu Gln Phe Phe Met Pro Val Leu Gly Ala Leu                  85 90 95 Phe Ile Gly Val Ala Val Ala Pro Ala Asn Asp Ile Tyr Asn Glu Arg             100 105 110 Glu Leu Leu Asn Ser Met Gly Ile Ser Gln Pro Thr Val Val Phe Val         115 120 125 Ser Lys Lys Gly Leu Gln Lys Ile Leu Asn Val Gln Lys Lys Leu Pro     130 135 140 Ile Ile Gln Lys Ile Ile Met Asp Ser Lys Thr Asp Tyr Gln Gly 145 150 155 160 Phe Gln Ser Met Tyr Thr Phe Val Thr Ser His Leu Pro Pro Gly Phe                 165 170 175 Asn Glu Tyr Asp Phe Val Pro Glu Ser Phe Asp Arg Asp Lys Thr Ile             180 185 190 Ala Leu Ile Met Asn Ser Ser Gly Ser Thr Gly Leu Pro Lys Gly Val         195 200 205 Ala Leu Pro His Arg Thr Ala Cys Val Arg Phe Ser His Ala Arg Asp     210 215 220 Pro Ile Phe Gly Asn Gln Ile Pro Asp Thr Ala Ile Leu Ser Val 225 230 235 240 Val Pro Phe His His Gly Phe Gly Met Phe Thr Thr Leu Gly Tyr Leu                 245 250 255 Ile Cys Gly Phe Arg Val Val Leu Met Tyr Arg Phe Glu Glu Glu Leu             260 265 270 Phe Leu Arg Ser Leu Gln Asp Tyr Lys Ile Gln Ser Ala Leu Leu Val         275 280 285 Pro Thr Leu Phe Ser Phe Phe Ala Lys Ser Thr Leu Ile Asp Lys Tyr     290 295 300 Asp Leu Ser Asn Leu His Glu Ile Ala Ser Gly Gly Ala Pro Leu Ser 305 310 315 320 Lys Glu Val Gly Glu Ala Val Ala Lys Arg Phe His Leu Pro Gly Ile                 325 330 335 Arg Gln Gly Tyr Gly Leu Thr Glu Thr Thr Ser Ala Ile Leu Ile Thr             340 345 350 Pro Glu Gly Asp Asp Lys Pro Gly Ala Val Gly Lys Val Val Pro Phe         355 360 365 Phe Glu Ala Lys Val Val Asp Leu Asp Thr Gly Lys Thr Leu Gly Val     370 375 380 Asn Gln Arg Gly Glu Leu Cys Val Arg Gly Pro Met Ile Met Ser Gly 385 390 395 400 Tyr Val Asn Asn Pro Glu Ala Thr Asn Ala Leu Ile Asp Lys Asp Gly                 405 410 415 Trp Leu His Ser Gly Asp Ile Ala Tyr Trp Asp Glu Asp Glu His Phe             420 425 430 Phe Ile Val Asp Arg Leu Lys Ser Leu Ile Lys Tyr Lys Gly Tyr Gln         435 440 445 Val Ala Pro Ala Glu Leu Glu Ser Ile Leu Leu Gln His Pro Asn Ile     450 455 460 Phe Asp Ala Gly Val Ala Gly Leu Pro Asp Asp Ala Gly Glu Leu 465 470 475 480 Pro Ala Ala Val Val Leu Glu His Gly Lys Thr Met Thr Glu Lys                 485 490 495 Glu Ile Val Asp Tyr Val Ala Ser Gln Val Thr Thr Ala Lys Lys Leu             500 505 510 Arg Gly Gly Val Val Phe Val Asp Glu Val Pro Lys Gly Leu Thr Gly         515 520 525 Lys Leu Asp Ala Arg Lys Ile Arg Glu Ile Leu Ile Lys Ala Lys Lys     530 535 540 Gly Gly Lys Ile Ala Val 545 550 <210> 3 <211> 657 <212> DNA <213> Hypoxanthine phosphoribosyl transferase cDNA sequence <400> 3 atggcgaccc gcagccctgg cgtcgtgatt agtgatgatg aaccaggtta tgaccttgat 60 ttattttgca tacctaatca ttatgctgag gatttggaaa gggtgtttat tcctcatgga 120 ctaattatgg acaggactga acgtcttgct cgagatgtga tgaaggagat gggaggccat 180 cacattgtag ccctctgtgt gctcaagggg ggctataaat tctttgctga cctgctggat 240 tacatcaaag cactgaatag aaatagtgat agatccattc ctatgactgt agattttatc 300 agactgaaga gctattgtaa tgaccagtca acaggggaca taaaagtaat tggtggagat 360 gatctctcaa ctttaactgg aaagaatgtc ttgattgtgg aagatataat tgacactggc 420 aaaacaatgc agactttgct ttccttggtc aggcagtata atccaaagat ggtcaaggtc 480 gcaagcttgc tggtgaaaag gaccccacga agtgttggat ataagccaga ctttgttgga 540 tttgaaattc cagacaagtt tgttgtagga tatgcccttg actataatga atacttcagg 600 gatttgaatc atgtttgtgt cattagtgaa actggaaaag caaaatacaa agcctaa 657 <210> 4 <211> 1653 <212> DNA <213> Luciferase cDNA sequence <400> 4 atggaagacg ccaaaaacat aaagaaaggc ccggcgccat tctatccgct ggaagatgga 60 accgctggag agcaactgca taaggctatg aagagatacg ccctggttcc tggaacaatt 120 gcttttacag atgcacatat cgaggtggac atcacttacg ctgagtactt cgaaatgtcc 180 gttcggttgg cagaagctat gaaacgatat gggctgaata caaatcacag aatcgtcgta 240 tgcagtgaaa actctcttca attctttatg ccggtgttgg gcgcgttatt tatcggagtt 300 gcagttgcgc ccgcgaacga catttataat gaacgtgaat tgctcaacag tatgggcatt 360 tcgcagccta ccgtggtgtt cgtttccaaa aaggggttgc aaaaaatttt gaacgtgcaa 420 aaaaagctcc caatcatcca aaaaattatt atcatggatt ctaaaacgga ttaccaggga 480 tttcagtcga tgtacacgtt cgtcacatct catctacctc ccggttttaa tgaatacgat 540 tttgtgccag agtccttcga tagggacaag acaattgcac tgatcatgaa ctcctctgga 600 tctactggtc tgcctaaagg tgtcgctctg cctcatagaa ctgcctgcgt gagattctcg 660 catgccagag atcctatttt tggcaatcaa atcattccgg atactgcgat tttaagtgtt 720 gttccattcc atcacggttt tggaatgttt actacactcg gatatttgat atgtggattt 780 cgagtcgtct taatgtatag atttgaagaa gagctgtttc tgaggagcct tcaggattac 840 aagattcaaa gtgcgctgct ggtgccaacc ctattctcct tcttcgccaa aagcactctg 900 attgacaaat acgatttatc taatttacac gaaattgctt ctggtggcgc tcccctctct 960 aaggaagtcg gggaagcggt tgccaagagg ttccatctgc caggtatcag gcaaggatat 1020 gggctcactg agactacatc agctattctg attacacccg agggggatga taaaccgggc 1080 gcggtcggta aagttgttcc attttttgaa gcgaaggttg tggatctgga taccgggaaa 1140 acgctgggcg ttaatcaaag aggcgaactg tgtgtgagag gtcctatgat tatgtccggt 1200 tatgtaaaca atccggaagc gaccaacgcc ttgattgaca aggatggatg gctacattct 1260 ggagacatag cttactggga cgaagacgaa cacttcttca tcgttgaccg cctgaagtct 1320 ctgattaagt acaaaggcta tcaggtggct cccgctgaat tggaatccat cttgctccaa 1380 caccccaaca tcttcgacgc aggtgtcgca ggtcttcccg acgatgacgc cggtgaactt 1440 cccgccgccg ttgttgtttt ggagcacgga aagacgatga cggaaaaaga gatcgtggat 1500 tacgtcgcca gtcaagtaac aaccgcgaaa aagttgcgcg gaggagttgt gtttgtggac 1560 gaagtaccga aaggtcttac cggaaaactc gacgcaagaa aaatcagaga gatcctcata 1620 aaggccaaga agggcggaaa gatcgccgtg taa 1653 <210> 5 <211> 18 <212> DNA <213> sensor sequence <400> 5 agccagagcc agtttttg 18 <210> 6 <211> 36 <212> DNA <213> ss forward primer <400> 6 cggatccagc cagagccagt ttttgatgga agacgc 36 <210> 7 <211> 21 <212> DNA <213> ss backward primer <400> 7 ggaattcctt acacggcgat c 21 <210> 8 <211> 22 <212> DNA <213> ss F forward primer <400> 8 cggatcccca gatggaagac gc 22 <210> 9 <211> 21 <212> DNA <213> ss F backward primer <400> 9 ggaattcctt acacggcgat c 21 <210> 10 <211> 23 <212> DNA <213> ss R forward primer <400> 10 cggatccttt ttatggaaga cgc 23 <210> 11 <211> 21 <212> DNA <213> ss R backward primer <400> 11 ggaattcctt acacggcgat c 21 <210> 12 <211> 24 <212> DNA <213> HPRT forward primer <400> 12 cggatccacc atggcgaccc gcag 24 <210> 13 <211> 22 <212> DNA <213> HPRT backward primer <400> 13 cggatccggc tttgtatttt gc 22

Claims (12)

Nucleic acid molecules capable of detecting DNA damage caused by ultraviolet light, such as a CCAG or TTTT base sequence;
A nucleotide sequence encoding a polypeptide having hypoxanthine phosphoribosyl transferase activity as set forth in SEQ ID NO: 1;
A sense sequence consisting of the nucleotide sequence of SEQ ID NO: 5; And
Wherein the nucleotide sequence encoding the polypeptide having luciferase activity as set forth in SEQ ID NO: 2 is arranged in order.
delete The method according to claim 1,
Wherein the nucleotide sequence coding for the polypeptide having hypoxanthine phosphoribosyl transferase activity as set forth in SEQ ID NO: 1 is the sequence as set forth in SEQ ID NO: 3. 2. The nucleic acid molecule according to claim 1, wherein the nucleotide sequence encoding the polypeptide having hypoxanthine phosphoribosyl transferase activity is SEQ ID NO: The method according to claim 1,
Wherein the nucleotide sequence encoding the polypeptide having luciferase activity as set forth in SEQ ID NO: 2 is the sequence set forth in SEQ ID NO: 4.
delete delete A recombinant vector comprising the nucleic acid molecule of any one of claims 1, 3 and 4. 8. The method of claim 7,
Wherein the recombinant vector is lentivirus. A transformant which is introduced into a host cell so as to express the recombinant vector of claim 7. 10. The method of claim 9,
Wherein the host cell is a human dermal fibroblast. The transformant of claim 9 is used to carry out one or more analyzes selected from cytotoxicity analysis, DNA mutation analysis, cell cycle and cell death inhibition rate analysis, flow cytometry analysis and luciferase activity assay, Lt; / RTI &gt; The transformant of claim 9 can be used to perform cytotoxicity analysis, DNA mutation analysis, cell cycle and cell death inhibition analysis, flow cytometry analysis and luciferase activity assay, How to search for substances.

Images