KR101686880B1 - Methods for preparing recombinant Asian needle ant allergen Pac c 3 - Google Patents

Abstract

The present invention provides a process for the recombinant production of a Pac c 3 allergen of an ants and a Pac c 3 allergen of the ant colony ants produced thereby. The recombinant antagonist Pac c 3 allergen produced according to the method of the present invention possesses allergen-inducing activity, so that it can diagnose asthma antler allergy and further develops as an immunotherapeutic agent for prevention of asthma allergy.

Description

(Methods for preparing recombinant Asian needle allergen Pac c 3)

The present invention relates to a process for the recombinant production of a Pac antagonist Pac c 3 allergen and a Pac c 3 allergen produced thereby.

The allergic reaction that occurs in our body (usually cockroaches) by insect stings (mainly bees, ants) or sucking insects (mainly mosquitoes), insect faeces or carcass debris is called insect allergy. Symptoms caused by stimuli are mostly localized redness or pain. However, when they are struck simultaneously by many insects, the amount of absorbed substances increases, and systemic reactions such as blood pressure decrease may occur. Except in these cases, serious symptoms are usually caused by allergic reactions. As with the features of the general immune response, once it is shot, it can have systemic severe reactions, and if it is shot again, similar reactions can appear repeatedly.

Some species of ants may have a sting (sting), wangchim ants (Pachycondyla chinensis, Asian needle ant) is the most common cause ants to shoot any ^one. One of the most common symptoms that occur when a wangchim ssoyineun ant anaphylaxis is ^2. Approximately 23% of all ants are allergic to ants, and 2.1% of them have experienced a systemic anaphylactic reaction ³ . The 23 kDa allergen (Pac c 3), an allergen causing anaphylaxis, was identified through proteomic analysis of the abdomen of the ants, including the solitary money ⁴ .

We can use the dock diagnose and treat allergies that have been identified with respect to the insect venom allergies ^5. Furthermore, the usefulness of component-resolved diagnosis with purified allergens has been reported for Hymenoptera allergy ⁶ . Therefore, there is a need for an accurate diagnosis and effective treatment of recombinant allergens for insect allergies, especially allergies caused by anthelmintic ants that are commonly encountered in the vicinity.

Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

 Kim BJ, Kim JH, Kim KG. Korean J Entomol 1998; 28: 145-54.  Kim SS, Park HS, Kim HY, Lee SK, Nahm DH. J Allergy Clin Immunol. 2001; 107: 1095-9.  Cho YS, Lee YM, Lee CK, Yoo B, Park HS, Moon HB. J Allergy Clin Immunol. 2002; 110: 54-7.  Lee EK, Jeong KY, Lyu DP, Lee YW, Sohn JH, Lim KJ, Hong CS, Park JW. Clin Exp Allergy. 2009; 39: 602-7.  Hunt KJ, Valentine MD, Sobotka AK, Benton AW, Amodio FJ, Lichtenstein LM. N Engl J Med 1978; 299 (4): 157-161.  Monsalve RI, Vegaa, Marques L, Mirandae, Fernandez J, Soriano V, Cruz S, Dominquez-Noche C, Sanchez-Morillas L, Armisen-Gil M, Guspi R, Barber D. Allergy 2012; 67 (4): 528-536.

The present inventors have conducted studies to recombinantly produce anthelmintic allergens which can be used for the diagnosis and treatment of asthmatic allergy. As a result, when the Pac c 3 allergen-encoding nucleic acid molecule modified by the modified nucleotide sequence was added to the newly designed 5 'side of the present inventors, it was confirmed that the expressed Pac c 3 allergen was a natural Pac c 3 Confirming that it has an allergen-inducing activity like allergen, thereby completing the present invention.

Accordingly, it is an object of the present invention to provide a method of recombinantly producing a Pac c 3 allergen of a deadly ant.

Another object of the present invention is to provide a recombinant Pac c 3 allergen of the bat ants produced by the above method.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

According to one aspect of the present invention, the present invention provides a method of recombinantly producing a Pac antagonist Pac c 3 allergen comprising the steps of:

(a) transforming a vector comprising a Pac c 3 allergen-encoding nucleic acid molecule of a Prickly ant into a yeast, wherein the Pac c 3 allergen-encoding nucleic acid molecule has a nucleotide sequence of SEQ ID NO: 1 at the 5 ' Have;

(b) culturing the transformed yeast of step (a) to express Pac c 3 allergen; And

(c) separating the Pac c allergen from the yeast cultured in step (b) or a culture thereof.

The present inventors have conducted studies to recombinantly produce anthelmintic allergens which can be used for the diagnosis and treatment of asthmatic allergy. As a result, when the Pac c 3 allergen-encoding nucleic acid molecule modified by the modified nucleotide sequence was added to the newly designed 5 'side of the present inventors, it was confirmed that the expressed Pac c 3 allergen was a natural Pac c 3 And allergen - inducing activities as well as allergens.

Hereinafter, the production method of the present invention will be described in detail.

(a) Transformation of yeast

In step (a), the nucleotide sequence of the first sequence of the sequence listing is added at the 5 'end and the yeast is transformed with a vector containing the modified Pac c 3 allergen-encoding nucleic acid molecule. The nucleotide sequence of Sequence Listing 1 is an additional sequence designed by the present inventors for recombinant production of Pac antagonist Pac c 3 allergen using yeast.

One of the features of the present invention is that recombinantly produced Pac c 3 allergens from the antagonistic ants Pac c 3 allergen-encoding nucleic acid molecule with the additional base sequence of Sequence Listing 1 sequence added at the 5 ' It is a point. As shown in the following examples, when Pac antagonist Pac c 3 allergen-encoding nucleic acid molecule prepared by adding the nucleotide sequence of Sequence Listing 1 to the 5 'side was expressed in yeast, the expressed Pac c 3 allergen And allergen-inducing activities such as reacting with IgE antibodies (see FIG. 2-3).

As used herein, the term "Pac c 3 allergen" is the major causative agent of migrating ant allergy, and is an allergen that can cause severe anaphylaxis. Pac c 3 allergens are also called Venom allergen 5 or 23 kDa allergens. The nucleotide sequence and amino acid sequence of the Pac c 3 allergen of the bryozoan ants were assigned to NCBI by GenBank accession no. EU516327 (SEQ ID No. 4) and ACA96507 (SEQ ID No. 5).

According to one embodiment of the present invention, the Pac c 3 allergen-encoding nucleic acid molecule of the modified wild-type ant which is modified by adding the nucleotide sequence of the first sequence of SEQ ID NO: 5 to the 5'-end thereof comprises the nucleotide sequence of SEQ ID NO: And encodes the protein of the third sequence of the sequence listing (Pac c 3 allergen).

The base sequence added to the 5 'side of the Pac c 3 allergen-encoding nucleic acid molecule is also interpreted to include a sequence showing substantial identity with the sequence set forth in the sequence listing. The above-mentioned substantial identity is determined by aligning the above-described sequence of the present invention with any other sequence as much as possible and analyzing the aligned sequence using an algorithm commonly used in the art. Homology, more preferably 70% homology, even more preferably 80% homology, even more preferably 90% homology. Alignment methods for sequence comparison are well known in the art. Various methods and algorithms for alignment are described by Smith and Waterman, Adv. Appl. Math. (1981) 2: 482 ; Needleman and Wunsch, J. Mol. Bio. (1970) 48: 443; Pearson and Lipman, Methods in Mol. Biol. (1988) 24: 307-31; Higgins and Sharp, Gene (1988) 73: 237-44; Higgins and Sharp, CABIOS (1989) 5: 151-3; Corpet et al., Nuc. Acids Res. (1988) 16: 10881-90; Huang et al., Comp. Appl. BioSci. (1992) 8: 155-65 and Pearson et al., Meth. Mol. Biol. (1994) 24: 307-31. The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al., J. Mol. Biol. (1990) 215: 403-10) is accessible from NBCI and the like, and is available on the Internet as blastp, blasm, blastx, tblastn and tblastx It can be used in conjunction with a sequence analysis program. BLSAT is available at www.ncbi.nlm.nih.gov/BLAST/. A comparison of sequence homology using this program can be found at www.ncbi.nlm.nih.gov/BLAST/ blast_help.html.

For example, since the first sequence of the sequence listing is a nucleotide sequence encoding Thr Asp Tyr Glu Asp Leu Lys (Sequence Listing 6), the term " amino acid having an aliphatic hydroxyl group-acidic amino acid-aromatic amino acid- acidic amino acid- Quot; amino acid-aliphatic amino acid-basic amino acid ", can be made into a base sequence encoding a peptide. In addition, modifications of the Sequence Listing first sequence include addition, deletion, or non-conservative substitution or conservative substitution of nucleotides.

The vector of the present invention comprises a plasmid vector as a means for expressing a desired gene (Pac c 3 allergen-coding nucleic acid molecule of a corymbranus antigens to which a sequence of SEQ ID NO: 1 is added) in a host cell (yeast cell) Can be transformed into a suitable host and then integrated into the genome itself. The vector system can be constructed through various methods known in the art, and specific methods are described in Sambrook et al., Molecular Cloning, A Laboratory Manual , Cold Spring Harbor Laboratory Press (2001) Are incorporated herein by reference.

Transformation into yeast cells in the present invention may be carried out by any method of introducing the nucleic acid into an organism, cell, tissue or organ, and may be carried out by selecting a suitable standard technique according to the host cell as is known in the art can do. Such methods include electroporation, protoplast fusion, calcium phosphate (CaPO ₄ ) precipitation, calcium chloride (CaCl ₂ ) precipitation, agitation with silicon carbide fibers, Agrobacterium mediated transformation, PEG, dextran sulfate, Pectamine, and dry / depressant-mediated transformation methods, and the like.

In the present invention, as host cells, for example, Pichia pastoris , Hansenula polymorpha , Candia boidini , Pichia methanolica , Yeast cells such as Ogataea minuta can be used.

According to one embodiment of the present invention, the host cell of the present invention is pichia pastoris.

(b) Expression of Pac c 3 allergen

In step (b), the transfected yeast is cultured to express Pac 3 allergen.

Culturing of the transformed yeast can be carried out according to a suitable culture medium and culture conditions known in the art. Such a culturing process can be easily adjusted according to the strain selected by those skilled in the art. Such various culturing methods are disclosed in various publications (e.g., James M. Lee, Biochemical Engineering , Prentice-Hall International Editions, 138-176).

The culture medium for culturing the transformed yeast preferably contains an inorganic nitrogen source or an organic nitrogen source, which is necessary for the growth of host cells. Examples of the carbon source include glucose, dextran, soluble starch, sucrose, and methanol. Examples of the inorganic or organic substances include ammonium salts, nitrates, amino acids, corn steep liquer, peptone, casein, bovine extract, soybean bag and potato extract. (Nutrients such as sodium chloride, calcium chloride, sodium dihydrogenphosphate, inorganic salts such as magnesium chloride, vitamins, and antibiotics (tetracycline, neomycin, ampicillin, and kanamycin). During the culture, the conditions such as the temperature, the pH of the medium and the incubation time can be appropriately adjusted so as to be suitable for cell growth and mass production of the protein.

In the present invention, a large amount of Pac c 3 allergen can be expressed through fermentation of a yeast strain. For example, in the case of using pichia pastoris as a host cell, a microorganism is cultured at a high concentration by supplying a carbon source, and then methanol is injected to induce mass production of Pac c 3 allergen.

(c) Separation of Pac c 3 allergen purification

In step (c), Pac c 3 allergen is separated and purified from the cultured yeast or culture thereof to finally obtain a recombinant Pac c 3 allergen.

According to one embodiment of the present invention, the finally obtained recombinant Pac c 3 allergen comprises the amino acid sequence of SEQ ID NO: 3.

In the present invention, the separation and purification of Pac c 3 allergen expressed from the cultured transformed yeast or a culture thereof (for example, culture supernatant) can be carried out using protein separation and purification methods commonly used in the art . For example, separation by solubility using ammonium sulfate or PEG, ultrafiltration by molecular weight, separation by various chromatographies (made for size, charge, hydrophobicity, or affinity-based separation) Can be used, and usually the above methods are combined and separated and purified.

According to one embodiment of the present invention, the separation tablet is obtained by concentrating the culture supernatant through ammonium sulfate precipitation, then dialyzing the precipitate with buffer, and then purifying it by chromatography.

According to one embodiment of the present invention, the concentration of ammonium sulfate is 50-75% (w / v). In one particular example, the concentration of ammonium sulfate is 65-75% (w / v).

According to one embodiment of the invention, the chromatography is affinity chromatography. In one particular example, the affinity chromatography is Ni-affinity chromatography.

The features and advantages of the present invention are summarized as follows:

(I) The present invention provides a process for the recombinant production of a Pac antagonist Pac c 3 allergen and a Pac antagonist Pac antagonist produced thereby.

(Ii) The recombinant antagonistic Pac c 3 allergen produced according to the method of the present invention has an allergen-inducing activity, so that it can diagnose allergic allergy by using it and further develops as an immunotherapeutic agent for prevention of allergic allergy .

Figure 1 shows the purification results of a recombinant 23 kDa allergen. Protein (5 [mu] g) was separated on a 12% acrylamide gel under reducing conditions and stained with Coomassie Brilliant Blue.
Figure 2 shows the IgE reactivity of a recombinant 23 kDa allergen. The dotted line represents the cutoff value.
Figure 3 shows the results of IgE immunoblot analysis. The goat ant thistle money extract was separated on 12% SDS-PAGE and transferred to a PVDF membrane. M: Molecular weight, E: Coomassie blue stain extract, P: Recombinant Pac c 3 IgE reactive component detected by serum isolated from patient not previously incubated with allergen, I: Recombinant Pac c 3 allergen IgE-reactive component detected with serum separated from patients who had previously undergone incubation, N: control buffer.
FIG. 4 is a photograph of a purified Pac c 3 having a different N-terminal sequence, in which a Pac c 3 allergen-encoding nucleic acid molecule of a quail ant, added to the 5 'side of the sequence other than the first sequence of the sequence listing, Show. M: Size marker, P: Protein secreted in P: medium was pooled and loaded onto Ni-column. W: Protein bound unbound when W: 20 mM imidazole was used to wash proteins bound to Ni-resin weakly ) One protein, E1-E5: Protein purified with elution buffer containing 1 mL 250 mM imidazole each. The left figure shows the molecular weight (kDa).

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

Example

Materials and Experiments

Expression and purification of recombinant allergens

23 pCR the open reading frame in kDa allergen ^ⓡ II-TOPO vector (Invitrogen, Carlsbad, CA, USA ) was obtained by PCR amplification using the cloned cDNA as the template to. The primer sequences used were as follows: forward primer (SEQ ID No. 7, 5'- CTCGAG AAAAGAGAGGCTGAAGCT ACTGATTACGAAGATTTAAAA ACTGAAGGCGGCGCGGTG-3 '), reverse primer (SEQ ID No. 8, 5'- GCGGCCGC TT AATGATGATGATGATGATG TTGGTATATTGGTG CGCC-3' . The underlined aaaagagaggctgaagct sequence was introduced for signal cleavage and the actgattacgaagatttaaaa sequence, shown underlined and italicized, was introduced into the forward primer to be appended to the N-terminal amino acid sequence of the native allergen. Six histidine sequences (underlined) for the purification of the recombinant protein were introduced into the reverse primer. For cloning into the pPIC9 yeast expression vector (Invitrogen), the Xho I and Not I restriction enzyme recognition sites were added to the primer sequences. The PCR amplified DNA fragments were ligated to pCR4 TOPO vector (Invitrogen) and then digested with Xho I and Not I restriction enzymes. The cleaved DNA fragment was subcloned into pPIC9 vector. Yeast GS115 cells were transformed with Stu I-linearized plasmid using the Pichia EasyComp kit (Invitrogen). His + transformants growing in histidine-deficient medium were grown on RDB plates (1 M sorbitol, 1% dextrose, 4 x 10 ^-5 % biotin, 1.34% yeast nitrogen base without amino acids and 0.005% L-glutamic acid, L - isoleucine, L-leucine, L-lysine, L-methionine). The integration of cDNA into the yeast genome was confirmed by PCR using genomic DNA (template) isolated from each colony using 5'AOX and 3'AOX primers. Clones with properly inserted cDNA were incubated for 24 hours at a temperature of 30 < 0 > C. The culture supernatant was concentrated to an ammonium sulfate precipitate (70%). The precipitate was dissolved and dialyzed with binding buffer (10 mM imidazole, 300 mM NaCl and 50 mM sodium phosphate, pH 8.0). The recombinant proteins were purified using Ni-nitrilotriacetic acid resine (Qiagen, Valencia, CA, USA) and elution buffer (250 mM imidazole, 300 mM NaCl and 50 mM sodium phosphate, pH 8.0). Protein concentrations were quantified by Bradford assay (Biorad, Hercules, Calif., USA) and the purified proteins were analyzed under reducing conditions using 12% polyacrylamide gels containing sodium dodecyl sulfate .

Unlike the above recombinant 23 kDa allergen, a 23 kDa allergen having a different amino acid sequence at the N-terminus was prepared. For this, the prPac c 3F2 primer (5'-CTCGAGAAAAAA ACTGATTACGAAGATTTAAAA ACTGAAGGCGGCGCGGTG-3 '; SEQ ID NO: 9 sequence) was used as the forward primer and the reverse primer was as described above. The protein separated by the medium was purified using Ni-NTA resin.

Serum sample

Six of the seven sera collected from ant anaphylactic patients were used in the experiments. Eight sera isolated from individuals with house dust mite allergy and 16 sera isolated from healthy persons were also used in this experiment.

Specific reactivity of IgE to recombinant protein

100 [mu] l of recombinant protein (2 [mu] g / ml dissolved in 50 mM sodium carbonate, pH 9.6) was coated onto the microtiter plate. After washing with PBS (PBST) containing 0.05% Tween 20, the plates were blocked with 3% skim milk dissolved in PBST. The cells were then incubated for 1 hour with 50 [mu] l / well of serum diluted 1: 4 in PBST containing 1% bovine serum albumin. IgE antibody was detected with biotinylated goat anti-human IgE antibody (Vector, Burlingame, CA, USA) and streptavidin-peroxidase (Sigma-Aldrich, St. Louis, Mo., USA). Color development was induced using 3,3 ', 5,5'-tetramethylbenzidine (Kirkegaard and Perry Laboratories, Gaithersburg, Md., USA). After addition of 0.5 M H ₂ SO ₄ , the absorbance was measured at 450 nm. The cut-off value was calculated as the standard deviation of the mean absorbance + 2 x negative control.

IgE immunoblot and IgE inhibition

Allergen extracts extracted from the drinking water prepared in the previous method ( Clin Exp Allergy . 2009; 39: 602-7) were electrophoresed on a 12% polyacrylamide gel containing sodium dodecyl sulfate. Proteins separated by electrophoresis were transferred to a polyvinylidine difluoride membrane (GE Waters & Process Technologies, Trevose, Pa., USA). Alleles were detected using 5% non-steroidal anti-PBST inhibitors and serum samples from 5 patients who were positive for recombinant proteins by ELISA (1: 4 ratio of PBST containing 1% BSA) Dilution). Allergen-specific IgE antibodies were detected for 1 hour using alkaline phosphatase conjugated goat anti-human IgE antibody (Sigma-Aldrich) diluted 1: 1000 and incubated with nitro blue tetrazolium and 5-bromo Chloro-3-indolyl-phosphate (Promega, MD, WI, USA).

For inhibition immunoblotting, serum samples were incubated overnight at 4 [deg.] C with 20 [mu] g / ml of recombinant protein. Immunoblotting was then performed using the serum in the incubated state with the recombinant protein.

Experiment result

Production of recombinant allergens

Expression levels of the recombinant proteins were confirmed every 24 hours for 4 days. Secretion of the recombinant protein was confirmed only at 24 hours of expression in the culture medium. The recombinant protein was precipitated with 50-70% ammonium sulfate. The protein concentrated in 70% ammonium sulphate was purified by Ni-affinity chromatography. Protein yield was 2.78 mg per liter of yeast culture. Figure 1 shows the purification results of a recombinant 23 kDa allergen.

IgE Reactivity of Recombinant Proteins

Of the six sera used in the experiment, five sera (83.3%) were positive for the recombinant protein (Fig. 2). In the IgE inhibition immunoblot analysis, IgE reactivity to the 23 kDa allergen was completely inhibited by pre-incubation treatment with the recombinant protein (Figure 3).

Also, as shown in Fig. 4, when the Pac-3 different from the 23-kDa allergen was expressed in the yeast, the expressed Pac-3 allergen did not react with the IgE antibody.

conclusion

As described above, a homologous recombinant 23 kDa allergen corresponding to antigen 5 was successfully produced from yeast ( Pichia ) from the biting ants. The recombinant protein thus produced showed good allergenic activity. All serum samples used in this experiment were obtained from a patient with an anaphylactic history and the serum IgE antibody reacted with the recombinant protein. Therefore, the recombinant 23 kDa allergen produced according to the method of the present invention is useful for the diagnosis and treatment of allergy It can be useful.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the present invention. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

<110> INDUSTRY-ACADEMIC COOPERATION FOUNDATION, Yonsei University <120> Methods for preparing recombinant Asian needle ant allergen Pac c          3 <130> PN150064 <160> 9 <170> Kopatentin 2.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence added to 5 'of Pac c 3 sequence <400> 1 actgattacg aagatttaaa a 21 <210> 2 <211> 782 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > Pac c 3-coding nucleotide sequence having SEQ ID NO. 1 at 5 ' <400> 2 actgattacg aagatttaaa aactgaaggc ggcgcggtgc atacgatgtg ccagtacact 60 tcacctcagc cgtcgccaaa ttgtggaact tatagcaatg cgcatataac tgccgctgat 120 aaggagacca tactgaaagt acacaatgac gagcggcaaa aagtcaaggc aggtcaagaa 180 accagaggaa atcctggtcc gcaaccagca gcaagtaata tgccggactt gacttgggat 240 aatgaattag cagcaattgc acaaaggtgg gttaatcagt gcaaaatcgg gcacgatggc 300 tgccgtaatg tagagagata tcaggttggt cagaacatag ccatgtcagg cagtacagct 360 aaaggtccat gcaacatgaa taacttagtc caaatgtgga taaatgaagt gaacgctttg 420 aacgcagcag atgtttctag tatgccgtcg gatggtaact attttatgaa gataggccat 480 tatactcaac tggtgtgggg taaaacaacg aaggtcgggt gtggaataat acaattccta 540 gacggtaaat tctacaaatg ttacttggct tgcaactatg gtccagctgg aaatatgttt 600 ggcgcaccaa tataccaata aactaattaa atttcatcaa atttactgtg caaatgtagc 660 ataagtaatc tgaaaacagt atcgaagtgt aatacgaagg aaagcatatt tctattttct 720 tctctctttg tcaagaattt attcttcaat aaaataaata cagcaataaa aaaaaaaaaa 780 aa 782 <210> 3 <211> 206 <212> PRT <213> Artificial Sequence <220> <223> Pac c 3 amino acid sequence having SEQ ID NO. 6 at N-terminal <400> 3 Thr Asp Tyr Glu Asp Leu Lys Thr Glu Gly Gly Ala Val His Thr Met   1 5 10 15 Cys Gln Tyr Thr Ser Pro Gln Pro Ser Pro Asn Cys Gly Thr Tyr Ser              20 25 30 Asn Ala Hisashi Ile Thr Ala Ala Asp Lys Glu Thr Ile Leu Lys Val His          35 40 45 Asn Asp Glu Arg Gln Lys Val Lys Ala Gly Gln Glu Thr Arg Gly Asn      50 55 60 Pro Gly Pro Gln Pro Ala Ala Ser Asn Met Pro Asp Leu Thr Trp Asp  65 70 75 80 Asn Glu Leu Ala Ala Ile Ala Gln Arg Trp Val Asn Gln Cys Lys Ile                  85 90 95 Gly His Asp Gly Cys Arg Asn Val Glu Arg Tyr Gln Val Gly Gln Asn             100 105 110 Ile Ala Met Ser Gly Ser Thr Ala Lys Gly Pro Cys Asn Met Asn Asn         115 120 125 Leu Val Gln Met Trp Ile Asn Glu Val Asn Ala Leu Asn Ala Ala Asp     130 135 140 Val Ser Ser Met Pro Ser Asp Gly Asn Tyr Phe Met Lys Ile Gly His 145 150 155 160 Tyr Thr Gln Leu Val Trp Gly Lys Thr Thr Lys Val Gly Cys Gly Ile                 165 170 175 Ile Gln Phe Leu Asp Gly Lys Phe Tyr Lys Cys Tyr Leu Ala Cys Asn             180 185 190 Tyr Gly Pro Ala Gly Asn Met Phe Gly Ala Pro Ile Tyr Gln         195 200 205 <210> 4 <211> 761 <212> DNA <213> Artificial Sequence <220> <223> GenBank accession No. EU516327 <400> 4 actgaaggcg gcgcggtgca tacgatgtgc cagtacactt cacctcagcc gtcgccaaat 60 tgtggaactt atagcaatgc gcatataact gccgctgata aggagaccat actgaaagta 120 cacaatgacg agcggcaaaa agtcaaggca ggtcaagaaa ccagaggaaa tcctggtccg 180 caaccagcag caagtaatat gccggacttg acttgggata atgaattagc agcaattgca 240 caaaggtggg ttaatcagtg caaaatcggg cacgatggct gccgtaatgt agagagatat 300 caggttggtc agaacatagc catgtcaggc agtacagcta aaggtccatg caacatgaat 360 aactcttcc aaatgtggat aaatgaagtg aacgctttga acgcagcaga tgtttctagt 420 atgccgtcgg atggtaacta ttttatgaag ataggccatt atactcaact ggtgtggggt 480 aaaacaacga aggtcgggtg tggaataata caattcctag acggtaaatt ctacaaatgt 540 tacttggctt gcaactatgg tccagctgga aatatgtttg gcgcaccaat ataccaataa 600 actaattaaa tttcatcaaa tttactgtgc aaatgtagca taagtaatct gaaaacagta 660 tcgaagtgta atacgaagga aagcatattt ctattttctt ctctctttgt caagaattta 720 ttcttcaata aaataaatac agcaataaaa aaaaaaaaaa a 761 <210> 5 <211> 199 <212> PRT <213> Artificial Sequence <220> <223> GenBank accession No. ACA96507 <400> 5 Thr Glu Gly Gly Ala Val His Thr Met Cys Gln Tyr Thr Ser Pro Gln   1 5 10 15 Pro Ser Pro Asn Cys Gly Thr Tyr Ser Asn Ala His Ile Thr Ala Ala              20 25 30 Asp Lys Glu Thr Ile Leu Lys Val His Asn Asp Glu Arg Gln Lys Val          35 40 45 Lys Ala Gly Gln Glu Thr Arg Gly Asn Pro Gly Pro Gln Pro Ala Ala      50 55 60 Ser Asn Met Pro Asp Leu Thr Trp Asp Asn Glu Leu Ala Ala Ile Ala  65 70 75 80 Gln Arg Trp Val Asn Gln Cys Lys Ile Gly His Asp Gly Cys Arg Asn                  85 90 95 Val Glu Arg Tyr Gln Val Gly Gln Asn Ile Ala Met Ser Gly Ser Thr             100 105 110 Ala Lys Gly Pro Cys Asn Met Asn Asn Leu Val Gln Met Trp Ile Asn         115 120 125 Glu Val Asn Ala Leu Asn Ala Ala Asp Val Ser Ser Met Pro Ser Asp     130 135 140 Gly Asn Tyr Phe Met Lys Ile Gly His Tyr Thr Gln Leu Val Trp Gly 145 150 155 160 Lys Thr Thr Lys Val Gly Cys Gly Ile Ile Gln Phe Leu Asp Gly Lys                 165 170 175 Phe Tyr Lys Cys Tyr Leu Ala Cys Asn Tyr Gly Pro Ala Gly Asn Met             180 185 190 Phe Gly Ala Pro Ile Tyr Gln         195 <210> 6 <211> 7 <212> PRT <213> Artificial Sequence <220> Amino acid sequence encoded by SEQ ID NO. One <400> 6 Thr Asp Tyr Glu Asp Leu Lys   1 5 <210> 7 <211> 63 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 7 ctcgagaaaa gagaggctga agctactgat tacgaagatt taaaaactga aggcggcgcg 60 gtg 63 <210> 8 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 8 gcggccgctt aatgatgatg atgatgatgt tggtatattg gtgcgcc 47 <210> 9 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> prPac c 3F2 primer <400> 9 ctcgagaaaa gaactgatta cgaagattta aaaactgaag gcggcgcggt g 51

Claims (7)

A method of recombinantly producing a Pac antagonist Pac c 3 allergen comprising the steps of:
(a) transforming a vector comprising a Pac c 3 allergen-encoding nucleic acid molecule of a Pruning ant into a yeast, wherein the Pac c 3 allergen-encoding nucleic acid molecule has a nucleotide sequence of SEQ ID NO: 1 at the 5 'Have;
(b) culturing the transformed yeast in step (a) to express Pac c 3 allergen; And
(c) separating a Pac c 3 allergen consisting of the amino acid sequence of Sequence Listing 3 from the yeast cultured in step (b) or a culture thereof. 2. The method according to claim 1, wherein the Pac c 3 allergen-encoding nucleic acid molecule of the antagonist antagonist to which the nucleotide sequence of the first sequence of SEQ ID NO: 1 is added at the 5 'side is the nucleotide sequence of SEQ ID NO: 2. 2. The method of claim 1, wherein the yeast in step (a) is Pichia pastoris . delete The method of claim 1, wherein step (c) comprises concentrating the yeast culture through ammonium sulfate precipitation, dialyzing the precipitate with buffer, and then performing chromatography to separate the Pac c 3 allergen. 6. The method of claim 5, wherein the concentration of ammonium sulfate is 50-75% (w / v), and the chromatography is affinity chromatography. A recombinant Pac c 3 allergen of the antagonist ants produced by the method of any one of claims 1 to 3 and 5 to 6.

Images