KR101684489B1 - Novel Promoter and Methods of production of hydrogen using thereof - Google Patents

Abstract

The present invention relates to a novel promoter and a method for producing hydrogen using the novel promoter. Through transcriptome analysis using RNA sequencing, we provide a strong promoter of new endogenous production. The present invention also provides a protein production method using the promoter. The present invention also provides a recombinant vector comprising the promoter and a host cell substituted with the recombinant vector. The present invention provides a method for producing hydrogen using the host cell. The promoter according to the present invention is more potent than any known promoter. Therefore, the strain substituted with the promoter according to the present invention has a remarkably higher hydrogen production rate than that of the wild type in the hydrogen production capacity. Therefore, the mutant Thermococus onnurineus NA1 prepared according to the present invention has a high hydrogen production rate as well as a high strain growth rate, thereby greatly increasing the hydrogen production efficiency.

Description

[0001] The present invention relates to novel promoters and methods for producing hydrogen using the same,

The present invention relates to a promoter for enhancing hydrogen productivity in archaea and a method for producing hydrogen using the promoter.

Metabolic engineering improves the productivity of various useful materials by optimizing the genetic control process in cells. Promoter engineering is one of the suitable strategies of metabolic engineering to regulate transcription of the target gene by regulating the promoter, and various promoters include E. coli , Caulobacter crescentus , Trichoderma reesei , and it is characterized by utilizing in several organisms such as Bacillus strains (Bacillus strains), Streptomyces (Streptomycetes), thermophilic archaea Gogh (Hyperthermophilic archaea).

Selection of suitable promoters is an important factor in metabolic engineering and various approaches have been developed for this. As a part of this, when a gene is inserted into a specific gene, a reporter gene that expresses the gene by expression of fluorescence can be utilized. When the promoter and reporter gene are conjugated, the amount of expression of the corresponding promoter can be known. Such promoter-reporter gene analysis has been viewed as a standard approach for selecting promoters and measuring the activity of promoters, and its application has extended to the genome-wide expression assay region. Commonly used reporter genes include chloramphenicol acetyltransferase ( cat ), beta-galactosidase ( lacZ ), aminoglycoside phosphotransferase ( aph ), alpha Amylase ( amy ), and green fluorescent protein ( gfp ). Gene expression profile analysis techniques such as transcriptomics or proteomics have been used for efficient promoter selection methods on a vast genome wide scale. Microarray analysis in transcriptome profiling enabled large-scale detection of relative transcript levels. Microarray data represents the strength of the promoter at the transcription level, but additional confirmation is also required due to the dynamic range of detection at a relatively limited transcription level. Recently, next-generation high-capacity sequencing technology has become possible in all areas of transcript measurement. RNA sequencing enabled the enormous number of transcription start sites to be measured, and as a result localization of promising promoters and the measurement of promoter activity became possible.

Thermococcus onnurineus NA1, which is a hyperthermophilic archaeon, is a gene encoding a CODH enzyme, hydrogenase, Na ⁺ / H ^{+ With} the help of the antiporter enzyme system, hydrogen (H ₂ ) can be produced using carbon monoxide (CO). However, it was necessary to develop a strain having improved hydrogen productivity.

Accordingly, it is an object of the present invention to provide a promoter capable of increasing hydrogen (H ₂ ) productivity. It is still another object of the present invention to provide a recombinant vector containing the promoter and a host cell transformed with a recombinant vector.

The present invention also provides a gene expression method, a protein production method, and a hydrogen production method using the promoter and the host cell.

In order to solve the above problems, there is provided a promoter comprising SEQ ID NO: 1 in a first form of the present invention.

In a second aspect of the present invention, the promoter of SEQ ID NO: 1 is provided.

In a third aspect of the present invention, there is provided a recombinant vector into which the promoter of SEQ ID NO: 1 is inserted.

In a fourth aspect of the present invention, there is provided a host cell transformed with a recombinant vector into which a promoter of SEQ ID NO: 1 is inserted.

In a fifth aspect of the present invention, there is provided a host cell comprising a promoter whose promoter sequence is substituted with SEQ ID NO: 1. In the host cell, the host cell is an archaebacterium, more preferably a strain of the genus Thermococcus , even more preferably Thermococcus onnurineus .

In a sixth aspect of the present invention, there is provided a gene expression method using the promoter of SEQ ID NO: 1.

In a seventh aspect of the present invention, there is provided a protein production method characterized by expressing a desired gene using the promoter of SEQ ID NO: 1 and producing a protein using the gene.

In a eighth form of the present invention, there is provided a protein production method characterized by expressing a target gene using a recombinant vector comprising SEQ ID NO: 1 and producing the protein using the recombinant vector.

In a ninth aspect of the present invention, there is provided a method for producing hydrogen using a strain of the genus Thermococcus comprising a promoter whose promoter sequence is substituted with SEQ ID NO: 1.

In the hydrogen production method, wherein the Thermococcus sp may be Thermococcus onnurineus.

The promoter according to the present invention has the following advantages: (1) the transcription efficiency is about 14 times higher than that of the conventional wild type promoter; (2) the degree of translation is 1.5 to 1.9 times as high as that of the wild type; It is more potent than any promoter. When the promoter was inserted in front of the CODH gene group of Thermococus onnurineus NA1, the hydrogen production rate was about 5 times as high as that of the wild type. Therefore, the strain substituted with the promoter according to the present invention had a remarkably higher hydrogen production rate than that of the wild type in the hydrogen production ability. Also, the growth rate of the conventional wild type strain of Thermococus onnurineus NA1 according to the present invention increased under the condition of supplying carbon monoxide. Therefore, the mutant Thermococus onnurineus NA1 prepared according to the present invention has a high hydrogen production rate as well as a high strain growth rate, thereby greatly increasing the hydrogen production efficiency.

Fig. 1 is an expected picture of the promoter region of the hypothetical gene of the Thermococcus strain, which is the upper part of 100 bp to 1 bp of the hypothalamic gene. BRE is a TFIIB recognition element; TATA is a TATA-box; RBS is a ribosome attachment site; Start indicates the translation initiation site.
2 shows a method for producing a mutant strain KS0510 (accession number: KCTC 12774BP). The TON_1016 of the wild-type CODH gene group was replaced by P _TN0510 . The 3-hydroxy-3-methylglutarin coenzyme A (HMG-CoA) reductase gene of P. furiosus was used as a marker. The dark gray in the figure represents carbon monoxide dehydrogenase, gray is hydrogenase, light gray is for Na ⁺ / H ⁺ reverse transporter (Na ⁺ / H ⁺ antiporter) Gene family.
Figure 3 shows gene expression levels of the CODH gene cluster of the KS0510 mutant strain (Accession No .: KCTC 12774BP). Western blotting analysis of proteins encoding TON_1018 (67.7 kDa), TON_1023 (61.7 kDa). M represents a molecular mass marker, and WT represents a wild type.
Figure 4 shows the expression levels of the KS0510 mutant strain (Accession No: KCTC 12774BP) and other mutant CODH genes. The amount of mRNA of the TON_1018 gene mutated in the KS0510 (PTN0150 promoter), KS0413 (PTN0413 promoter), KS0157 (PTN0157 promoter) and MC01 ( PTK_gdh promoter) mutations was measured by RT-PCR. The relative fold difference was compared to the wild type value.
Figure 5 shows the expression levels of the KS0510 mutant strain (Accession No .: KCTC 12774BP) and other mutant CODH genes. TON_1018 is the result of western blotting of the encoded protein. M represents a molecular mass marker, and WT represents a wild type.
Figure 6 shows the growth rates of strains of wild type (black circle) and KS0510 (white circle) when CO is supplied at a flow rate of 240 ml / min. Cell growth was monitored by measuring the optical density at 600 nm (OD ₆₀₀ ). CO was supplied at an initial flow rate of 40 ml / min and at a flow rate of 240 ml / min from an OD ₆₀₀ approaching about 0.3.
Fig. 7 shows the hydrogen production rate of strains of wild type (black circle) and KS0510 (white circle) when CO is supplied at a flow rate of 240 ml / min. CO was supplied at an initial flow rate of 40 ml / min and at a flow rate of 240 ml / min from an OD ₆₀₀ approaching about 0.3.

A first aspect of the present invention is a promoter comprising SEQ ID NO: 1. When the term "comprising" is used in this description and the claims, it does not exclude other elements or steps. For purposes of the present invention, the term " consisting of "is considered to be the preferred embodiment of the term" comprising ". The term "promoter" in the present invention is intended to include a nucleotide sequence that is complementary to a upstream region of a coding region, including a binding site for a polymerase and having a transcription initiation activity to the mRNA of a gene downstream of the promoter . The term "operably linked" in the present invention means that the nucleic acid sequence having the promoter activity is operably linked to the transcription initiation of the target gene encoding the enzyme and the functional sequence of the promoter sequence and the gene sequence, Are operatively linked to each other in such a way as to enable gene expression. The promoter comprising SEQ ID NO: 1 includes not only the promoter consisting of SEQ ID NO: 1 but also a promoter having a sequence functionally equivalent to SEQ ID NO: The 'functionally equivalent' refers to a promoter that can be recognized and transcribed by the RNA polymerase even though it is not 100% identical to the promoter of SEQ ID NO: 1 according to the present invention. Such a functionally equivalent promoter may be a promoter having a sequence similar to SEQ. ID. No. 1, but not limited thereto, at least 90% of the nucleic acid sequence. More preferably, the nucleic acid sequence may be a promoter having a sequence similar to that of SEQ ID NO: 1 by 95% or more, and more preferably, a promoter having a sequence similar to SEQ ID NO: 1 by 98% or more.

A second embodiment of the present invention is the promoter of SEQ ID NO: 1. The promoter of SEQ ID NO: 1 is a promoter consisting of only the sequence of SEQ ID NO: 1.

A third embodiment of the present invention is a recombinant vector into which the promoter of SEQ ID NO: 1 is inserted. The term "vector" as used herein refers to an expression vector capable of expressing a desired protein in a suitable host cell, and which comprises an essential regulatory element operably linked to the expression of the gene insert. As used herein, the term " regulatory element "includes promoters for performing transcription, any operator sequences for regulating transcription, sequences encoding suitable mRNA ribosome binding sites, and sequences controlling transcription and translation termination. In addition, the term "host cell" in the present invention means a cell in which a vector is transformed into a host cell to have various genetic or molecular effects in the host cell. In addition, the term "transformed" in the present invention means that DNA is introduced into a host and the DNA becomes replicable as a factor other than a chromosome or by insertion into a chromosome.

As used herein, the term "expression vector" means a nucleic acid vehicle (plasmid) characterized by the presence of one or more "expression cassettes ". As used herein, the term "expression cassette" refers to a genetic construct capable of allowing gene expression of a nucleic acid sequence of interest (i.e., a "heterologous" nucleic acid sequence). The expression cassette should contain a regulatory sequence element that contains information regarding transcription and / or translation regulation, and the regulatory sequence should be "operably linked" to the nucleic acid sequence of interest. An operable linkage is a linkage between a regulatory sequence element and a nucleic acid sequence to be expressed in such a way that gene expression can occur.

The expression vector of the present invention may be, for example, a plasmid, a cosmid, a phagemid, an artificial chromosome, or another vehicle commonly used in genetic engineering. In addition to one or more "expression cassettes" comprising the regulatory sequences described above, the expression vectors typically include one or more multiple cloning sites to facilitate insertion and / or removal of the nucleic acid sequences. The multiple cloning site can be located upstream and downstream of the expression cassettes described above, thereby permitting replacement of the entire cassette. The multiple cloning site may also be located downstream of the promoter control sequence and upstream of the 3'-regulatory sequence within the expression cassette, thereby allowing insertion or replacement of the nucleic acid sequence to be expressed. For stable transfection (see below), the expression vector may further comprise a recognition sequence for a site-specific integrase or recombinase to facilitate recombination and stable integration in the genome of the host cell.

Many methods that can be used to design and / or modify recombinant expression vectors are well established in the art (see, for example, Sambrook, J., and Russel, DW (2001), Molecular cloning: A laboratory manual . Ed) Cold Spring Harbor, NY , Cold Spring Harbor Laboratory Press;.. Ausubel, FM et al (2001) Current Protocols in Molecular reference Biology, Wiley & Sons, Hoboken, NJ, USA). A number of suitable expression vectors for suitable archaea are also commercially available and are well known to those of ordinary skill in the art which may determine which vectors are suitable for expressing nucleic acid molecules of interest in a given environment.

The nucleic acid sequence to be expressed by using the expression vector of the present invention may be a monocystron (i.e., protein coding including a single polypeptide or fusion protein) or a polycistron (i.e., two or more individual polypeptide or protein coding) .

A fourth aspect of the present invention is a host cell transformed with a recombinant vector into which a promoter of SEQ ID NO: 1 is inserted. The host cell is an Escherichia coli, preferably a strain of the genus Thermococcus , more preferably, but not exclusively, Thermococcus onnurineus .

A fifth aspect of the present invention is a host cell comprising a promoter whose promoter sequence is substituted with SEQ ID NO: 1. The host cell is an Escherichia coli, preferably a strain of the genus Thermococcus , more preferably, but not exclusively, Thermococcus onnurineus .

A sixth aspect of the present invention is a gene expression method using the promoter of SEQ ID NO: 1.

Using the promoter can be inserted into the upstream region of the target gene. In order to produce hydrogen, the promoter can be inserted into the upper region of the CODH gene of strain Themococcus onnurineus NA1. The promoter can be inserted using a marker while inserting the promoter. The marker can be selected in various ways, and is preferably a 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase gene.

A seventh aspect of the present invention is a protein production method characterized by expressing a gene of interest using the promoter of SEQ ID NO: 1 and using the gene to produce a protein.

An eighth aspect of the present invention is a protein production method characterized by expressing a target gene using a recombinant vector comprising SEQ ID NO: 1 and producing a protein using the recombinant vector.

A ninth aspect of the present invention is a method for producing hydrogen using a strain of the genus Thermococcus comprising a promoter whose promoter sequence is substituted with SEQ ID NO: 1. Wherein the Thermococcus sp is not be limited to, preferably, one of Thermococcus onnurineus.

Hereinafter, the present invention will be described in more detail by way of examples. However, the following examples illustrate the present invention, and the contents of the present invention are not limited to these examples.

[Example 1]

Selection of new strong promoters by RNA-seq

Strain, medium and culture conditions

The wild-type strain of T. onnurineus NA1 (KCTC10859) and its mutants KS0157, KS0413 and MC01 were cultured in yeast extract-peptone-sulfur (YPS) medium. In order to cultivate under the condition that CO was supplied, 100% CO 2 gas was supplied to modified medium (MM) medium 1 (MM1-CO medium). For total RNA extraction and western blotting, the strain was cultured in a 125 ml serum bottle at 80 ° C with a working volume of 80 ml, to an exponential growth phase. For the batch culture in bioreactor, the strain was cultured in a 3-liter bioreactor (Fermentec, Cheongwon, Korea), its working volume was adjusted to 2 liters, MM1 contained 1% yeast extract And Holden trace element / Fe-EDTA solution (Holden et al. 2001) more than 10 times. The stirring speed was 300 rpm and the pH was adjusted with 0.2M NaOH so that the pH was between 6.1 and 6.2 at 3.5% NaCl. 100% CO 2 was supplied at a feed rate of 240 ml / min using a mass flow controller (MKPrecision, Seoul, Korea). By placing the medium in an anoxic chamber (Coy Laboratory Products, Grass Lake, USA) filled with an oxygen-free gas mixture (N ₂ : H ₂ : CO ₂ , 90: 5: 5), the cluster remained anaerobic , And a pure argon gas was applied to the bioreactor as a microsparger.

Mutation production

The P _TN0510 promoter of T. onnurineus NA1 was obtained by amplifying the 100 bp upstream region of the start codon of TON_0510 using genomic DNA of the P _TN0510 _F / P _TN0510 _R primer set. The sequence of the P _TN0510 promoter of T. onnurineus NA1 shown in Fig . 1 is as follows.

T. onnurineus NA1 P _TN0510 promoter: 5'-TTCCACAGTATTGAGGGTCTTTTCCTTAAGTTTGGGGAGAAAGCTATATAAGCTTTTTCAGTGCATTAATGTATGAAGTAATCCCACGGAGGTGAAGAAA-3 '(SEQ ID NO: 1)

pUC118_P _TN0510 _HMG pfu plasmid inverse (inverse) PCR and source remove P _TN0413 in pUC118_P _TN0413 _HMG pfu plasmid using Ivs_pUC118_P _TN0413 _HMG_F / Ivs_pUC118_P _TN0413 _HMG_R primer pair to P _TN0510 to step SLIC (sequence and ligation independent cloning) method And ligated.

produced by ligating the P _TN0413 step SLIC method (sequence and ligation independent cloning method) - pUC118_P _TN0413 _HMG pfu plasmid pUC118_P _gdh _HMG pfu remove P _gdh from plasmid wants to inverse (inverse) PCR using Ivs_pUC118_F / Ivs_pUC118_R primer pair Respectively.

The pUC118_P _gdh _HMG pfu plasmid was constructed using the glutamate dehydrogenase from T. kodakarensis KOD1 and the HMG-CoA reductase gene from P. furiosus (HMG).

The P _gdh promoter of T. onnurineus was obtained by amplifying the region of the start codon of 300 bp of TON_0157 using genomic DNA of the P _TN0157 _F / P _TN0157 _R primer set.

The pUC118_P _TN0510 _HMG pfu plasmid was transformed with T. onnurineus NA1 wild type strain and cultured in the presence of 10 μM simvastatin as a selection marker. The KS0515 mutant strain was constructed by applying the gene disruption system used in T. kodakarensis KOD1, which replaced TON_1016 in the CODH gene group with P _TN0510 . In the process, homologous recombinants were confirmed by PCR using the D1016_confirm_F / D1016_confirm_R primer pair.

The nucleotide sequences of the primers are shown in Table 1 below.

primer Base sequence P _TN0510 _F 5'-ctcctctatttccattttcttcacctccgtgggat-3 '
(SEQ ID NO: 2) P _TN0510 _R 5'-tgagtgatggttgggttccacagtattgagggtct-3 '
(SEQ ID NO: 3) Ivs-pUC118_P _TN0413 _HMG_F 5'-cccaaccatcactcaaatact-3 '(SEQ ID NO: 4) Ivs_pUC118_P _TN0413 _HMG_R 5'-atggaaatagaggagattata-3 '(SEQ ID NO: 5) D1016_confirm_F 5'-gaggtagtccagccttgagc-3 '(SEQ ID NO: 6) D1016_confirm_R 5'-ttgttggcgttaaggacaac-3 '(SEQ ID NO: 7)

RNA extraction and RNA sequencing

RNA was prepared with TRIzole reagent (Invitrogen, Caelsbad, USA), followed by manufacturer's instructions, but slight modifications were made. The amount and quality of the total RNA was determined using an RNA electrometer (Agilent 2100 Bioanalyzer, Palo Alto, USA) Integrity Number) (Schroeder et al . 2006). In each sample, 10 μg of total RNA with a RIN value of greater than 8.0 was injected as a reagent and treated with the rRNA removal kit Ribo-Zero for bacteria (Epicenter, Madison, USA). The resulting sequencing library of mRNA samples was run on a TruSeq Stranded Total RNA Sample Prep Kit (Illumina, San Diego, USA) according to the manufacturer's instructions. Sequencing was performed on a HiSeq 2500 (Illumnia, San Diego, USA) to generate paired-end reads of the directional 100 base pair. Quality-filtered reads were mapped to standard genome sequencing (NCBI Bioproject ID PRJNA59043) using GLC Genomic Workbench 6.5 (CLC bio, Arhus, Denmark). Relative transcript abundance was calculated as RPKM units (reads per kilobase and total sequencing per million reads).

Quantitative RT-PCR and western blotting

To remove genomic DNA from whole RNA samples, 8 units of RNAse-free DNase I (Thermo Scientific Fermentas, St. Leon-Rot, Germany) was added to 8 μg of RNA and incubated at 37 ° C for 30 min. Ethanol precipitate. The RNA was quantitated with a NanoDrop 2000 UV-Vis spectrophotometer (Thermo Scientific, West Palm Beach, USA), and 1 μg of the RNA was extracted from 40 units of Moloney murine leukemia virus reverse transcriptase (Thermo Scientific Fermentas, St. Leon- And 5 μM random hexamer and 1 mM deoxynucleoside triphosphate (dNTP) for 1 hour at 37 ° C in reverse transcription buffer. The reaction products were sequentially diluted to an appropriate concentration for RT-PCR, and the samples were amplified using SYBR green real-time PCR master mix (Toyobo, Osaka, Japan). Amplified signals were detected using the StepOnePlus system (Applied Biosystems, Foster City, USA). The sequences of the primers used in RT-qPCR are as follows.

codh_F: 5'-gttcgagaatcctgctggtctt-3 '(SEQ ID NO: 8)

codh_R: 5'-agcaactggcaagtctgaaatg-3 '(SEQ ID NO: 9)

mch_F: 5'-tgccatcttctcggctttg-3 '(SEQ ID NO: 10)

mch_R: 5'-gctctgctatgtccattatgtattctct-3 '(SEQ ID NO: 11)

mnh_F: 5'-ccgtaggaaccacgatgtacttt-3 '(SEQ ID NO: 12)

mnh_R: 5'-ccgtcaaatcggcaagattaa-3 '(SEQ ID NO: 13)

The relative amounts of each gene were normalized according to the amount of corresponding 16S rRNA and then derived from the C _T (cycle threshold) value using the relative standard curve.

Western blotting was performed using chemiluminescent staining samples containing Immun-Star horseradish peroxidase chemiluminescence kit (Bio-Rad, Hercules, USA). Polyclonal antibodies were incubated in rabbits with resistance to proteins encoded by TON_1018 and TON_1023, respectively. The protein was overexpressed in Escherichia coli of Rosetta (DE3) pLysS, purified with His-Bind resin (Vovagen, Madison, USA) and immunoprecipitated and serum collected to produce the corresponding rabbit antibody followed by a serum-collection process.

Analysis method

Cell growth was monitored by measuring the optical density at ₆₀₀ nm (OD ₆₀₀ ) using a BioPhotometer plus UV-Vis spectrophotometer (Eppendorf, Hamburg, Germany). To determine the linear correlation, we measured the amount of cellular protein in the cell lysate using the DC protein assay kit (Bio-Rad, Hercules, USA) while measuring the distance between the protein content and the optical density of the biomass The dry weight (DCW) was indirectly calculated based on the assumption that the protein constitutes about 50% of the cell dry weight. The unit value of OD ₆₀₀ was 0.361 g / liter. The H ₂ production rate in the bioreactor experiment was calculated based on the content of H ₂ in the gas, and the gas flow rate was measured with a wet gas meter (Shinagawa, Tokyo, Japan). The total amount of H ₂ was measured using a YL6100 gas chromatograph (GC) (YL Instrument Co., Anyang, Korea) equipped with a Molsieve 5A column (Supelco, Bellefonete, USA), a Porapak N column (Supelco), a thermoconductive sensor and a flame ionization detector . Argon was used as the carrier gas at a flow rate of 30 ml / min.

By replacing well-known strong promoters such as glutamate dehydrogenase or s-layer protein in front of the CODH gene group, it was determined that H ₂ production was improved from CO or steelmaking exhaust gases.

After enriching the RNA of all transcripts by reducing the rRNA, the RNA samples extracted from T. onnurineus NA1 cultured in 100% CO 2 for two bioproducts using the HiSeq 2500 sequencer (Illimnia) RNA-seq was performed to detect the promoter. Sequencing produced 36 million readings and 41.3 million leads in each sample, and 85% of them were able to map to the genome. Sixty-five percent of this lead was mapped to rRNA or tRNA, while 16% was mapped to the coding sequence and 4% to the intergenic region.

As an attempt to identify strong promoters, the relative transcript abundance of each RNA transcript was calculated in RPKM, and the promoters with the highest 20 high RPKM values were selected ( Table 2 ). They corresponded to genes related to formate salts, carbohydrate metabolism, oxidative stress defense, and oxidation reactions. The gene encoding TON_0510 has the second highest RPKM value.

ranking Expression gene protein RPKM Index One TON_0868 Superoxide reductase 50926.0 2 TON_0510 Hypothetical protein 30811.9 3 TON_0544 Alcohol dehydrogenase 30770.2 4 TON_1564 4Fe-4S binding protein (4Fe-4S binding protein) 30277.6 5 TON_1573 Formate transporter 26101.1 6 TON_0847 Alkyl hydroperoxide reductase subunit C (Alkyl hydroperoxide reductase subunit C) 26024.7 7 TON_0829 Peroxiredoxin 24470.3 8 TON_1563 Formate dehydrogenase subunit alpha (Formate dehydrogenase subunit alpha) 21601.5 9 TON_0157 Glutamate dehydrogenase (Glutamate dehydrogenase) 20969.4 10 TON_0594 Sugar binding protein 14619.1 11 TON_0747 Hypothetical protein 13634.5 12 TON_0413 S-layer protein (S-layer protein) 11037.7 13 TON_1510 Transcriptional regulator 9162.2 14 TON_0659 Sugar-phosphate nucleotidyltransferase 7654.8 15 TON_0867 Rubredoxin 6857.6 16 TON_0234 Hypothetical protein 6842.7 17 TON_1426 Protease subunit 2 (proteasome subunit 2) 6192.5 18 TON_0577 Hypothetical protein 5957.1 19 TON_1058 Membrane protease subunit < RTI ID = 0.0 > 5648.4 20 TON_0866 Rubrerythrin 5351.2

Homologous nucleotide sequence searches using the BLASTP program (Altschul et al ., 1997) on the protein database of the National Center for Biotechnology Information (NBCI) showed that the TON_0510 gene is a member of the Thermococcales strains, Thermococcus sp. 4557 (WP_014012107.1, 78% identity), Thermococcus sp. CL1 (WP_014788026.1, 74%), Thermococcus zilligii (WP_029550986.1, 66%), Thermococcus sp. A501 (AIU70382.1, 67%), Thermococcus nautilus (AHL22042.1, 60%).

The present inventors have found that Thermococcus sp. 4557 and Thermococcus sp. The upstream region of 1 bp to 100 bp of the initiation codon of ATG translation of the CL1 gene could be detected. The nucleotide sequence revealed that the TFIIB recognition element (BRE), TATA-box and ribosome binding site (RBS) were conserved ( FIG. 1 ).

[Example 2]

Gene expression by strong promoter

TON_0510 to determine the intensity of the gene promoter by replacing the open reading frame (open reading frame (ORF)) for TON_1016 to encrypt transcription factors (transcriptional regulator) to 100bp upper area of P _TN0510, CODH gene group for P _TN0510 ( Fig. 2 ). & Lt ; / RTI > The KS0510 mutant strain (accession number: KCTC 12774BP) was prepared by this method. The strain was deposited with KCTC 12774BP on March 27, 2015 at the Korea Research Institute of Bioscience and Biotechnology. TON_1018, TON_1023, and TON_1031 genes coding for the CODH and multiple hydrolase substructures and Na ⁺ / H ⁺ reverse transcriptase substructures are present in the CODH gene group. The expression levels of these genes are determined by quantitative RT-PCR and Western blotting Lt; / RTI > Quantitative RT-PCR analysis revealed that TON_1018, TON-1023 and TON_1031 genes of KS0510 expressed 14, 6.6 and 4 times more than wild type, respectively. Consistent with the transcriptional data, the degree of translation of TON_1018 and TON_1023 increased 1.9-fold and 1.5-fold, respectively, in the KS0157 mutant strain compared to wild type ( FIG. 3 ). This result indicates that P _TN0510 functions as a stronger promoter than the original genotype. The KS0510 mutant (accession number: KCTC 12774BP) showed higher levels of TON_1018 expression in both transcription and translation ( FIG. 4 ) when compared to other strains, such as KS0413 and KS0157, which are known to have strong promoters on the CODH gene cluster, RNA-sequencing data ( Fig. 5 ).

[Example 3]

Analysis of KS0510 mutation growth and H ₂ production

Based on the transcription and translation of the CODH gene cluster of the KS0510 mutation (accession number: KCTC 12774BP), the increase in H ₂ productivity and growth for the mutant CO was predicted, and it was predicted that the flow rate of 100% CO was 240 ml / min In a bioreactor. Mutant strains grew much better with up to 5-fold increase in biomass production over wild type (Figure 6). Over the course of the incubation period, mutant strains showed up to 5 times higher H ₂ productivity than the wild type (FIG. 7). As shown in Table 3, the KS0510 mutant (accession number: KCTC 12774BP) exhibited a maximum specific growth rate, maximum H ₂ production rate, and biomass production, as compared with other mutants that were replaced with wild type or strong promoters Showed a much improved dynamics index of maximum non-hydrogen yield and hydrogen production ( Table 3 ). This demonstrates that selection of new strong promoters through RNA-seq is a very effective approach to improving the production of target proteins.

Dynamic index Wild type KS0510 KS0413 KS0157 MC01 Maximum non-growth rate (h) 0.31 0.88 0.85 0.83 0.72 Maximum hydrogen production rate (mmol / liter · h) 31.8 155.1 61.9 81.6 123.5 Production of biomass 0.09 0.25 0.14 0.18 0.23 Maximum non-hydrogen production rate (mmol / g · h) 93.4 245.1 171.0 124.2 194.7 Hydrogen production rate (mmol / liter · h) 30.2 131.2 103.3 70.9 102.6

Korea Biotechnology Research Institute KCTC12774BP 20150327

<110> Korea Institute of Ocean Science and Technology <120> Novel Promoter and Methods of Production of Hydrogen Using          the <130> PN140043 <160> 13 <170> Kopatentin 2.0 <210> 1 <211> 100 <212> DNA <213> Artificial Sequence <220> <223> T. onnurineus NA1 PTN0510 promoter <400> 1 ttccacagta ttgagggtct tttccttaag tttggggaga aagctatata agctttttca 60 gtgcattaat gtatgaagta atcccacgga ggtgaagaaa 100 <210> 2 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> T. onnurineus NA1 PTN0510_F primer <400> 2 ctcctctatt tccattttct tcacctccgt gggat 35 <210> 3 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> T. onnurineus NA1 PTN0510_R primer <400> 3 tgagtgatgg ttgggttcca cagtattgag ggtct 35 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> T. onnurineus NA1 Ivs-pUC118_PTN0413_HMG_F primer <400> 4 cccaaccatc actcaaatac t 21 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> T. onnurineus NA1 Ivs-pUC118_PTN0413_HMG_R primer <400> 5 atggaaatag aggagattat a 21 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> T. onnurineus NA1 D1016_confirm_F primer <400> 6 gaggtagtcc agccttgagc 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> T. onnurineus NA1 D1016_confirm_R primer <400> 7 ttgttggcgt taaggacaac 20 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> T. onnurineus NA1 codh_F primer <400> 8 gttcgagaat cctgctggtc tt 22 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> T. onnurineus NA1 codh_R primer <400> 9 agcaactggc aagtctgaaa tg 22 <210> 10 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> T. onnurineus NA1 mch_F primer <400> 10 tgccatcttc tcggctttg 19 <210> 11 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> T. onnurineus NA1 mch_R primer <400> 11 gctctgctat gtccattatg tattctct 28 <210> 12 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> T. onnurineus NA1 mnH_F primer <400> 12 ccgtaggaac cacgatgtac ttt 23 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> T. onnurineus NA1 mnH_R primer <400> 13 ccgtcaaatc ggcaagatta a 21

Claims (13)

delete The promoter of SEQ ID NO: 1. A recombinant vector into which the promoter of SEQ ID NO: 1 is inserted. A host cell transformed with a recombinant vector into which the promoter of SEQ ID NO: 1 is inserted. Wherein the promoter sequence is substituted with the promoter of SEQ ID NO: 1. 6. The host cell according to claim 5, wherein the host cell is an archaeal cell. The host cell according to claim 6, wherein the archaebacterium is a strain of the genus Thermococcus . The method of claim 7, wherein the Thermococcus sp is a host cell, characterized in that Thermococcus onnurineus KCTC 12774BP. A gene expression method using the promoter of SEQ ID NO: 1. A protein production method characterized by expressing a target gene using the promoter of SEQ ID NO: 1 and using the same to produce a protein. A method for producing a protein, which comprises expressing a target gene using a recombinant vector comprising SEQ ID NO: 1, and using the recombinant vector to produce a protein. A method for producing hydrogen using a strain of the genus Thermococcus comprising a promoter whose promoter sequence is substituted with SEQ ID NO: 1. 13. The method according to claim 12, wherein the strain of the genus Thermococcus is Thermococcus onnurineus KCTC 12774BP.

Images