KR101668593B1 - Populus albaPopulus glandulosa ns-LTP A promoter of ns-LTP gene derived from Populus albaPopulus glandulosa specifically expressing at apical and root meristem plant - Google Patents

Abstract

The present invention relates to a plant-specific expression vector for apical and apical meristems including a promoter of the mosaic tree-derived ns-LTP gene specifically expressed in the apical and apical meristems, a 5 'untranslated region (5'-UTR) A plant transformed with the expression vector, and a step of introducing the expression vector into a plant, wherein the plant is transformed with the expression vector.

Description

A promoter of ns-LTP gene derived from Populus alba × Populus glandulosa, which is specifically expressed in the apical and apical meristems of plants, is a promoter of ns-LTP gene (Populus alba × Populus glandulosa specifically expressing at apical and root meristem plant}

The present invention relates to a promoter of ns-LTP (non-specific lipid transfer protein) gene derived from Populus alba x P. glandulosa which is specifically expressed in the apical and apical meristem of a plant, And a promoter of the moss-bearing tree-derived ns-LTP gene specifically expressed in the apical meristem, 5 'untranslated region (5'-UTR) A plant transformed with an expression vector, and a step of introducing the expression vector into a plant.

Regulation of gene expression in specific tissues is very useful for controlling plant growth, breeding, and understanding of gene function. It also plays an important role in research to obtain useful genes from transgenic plants using genetic engineering techniques.

Since such a study requires a promoter that regulates the expression of a gene in a tissue-specific manner, various plant-derived promoters have been reported for various purposes. Promoters are used to limit the expression of genes depending on systemic or tissue-specific and developmental stages Function or the like.

The most commonly used promoters include the promoter of the 35S RNA (CaMV 35S) gene derived from cauliflower mosaic virus (Nature. 1985; 313, 810-812) and the rice-derived actin (The Plant Cell. 1990; 2, 163-171) and maize-derived ubiquitin gene promoter (Transgenic Research. 1996; 5, 213-218).

They are also widely used for the production of transformants as promoters capable of maximizing the expression level of foreign useful genes have.

Promoters that inhibit tissue-specific expression of exogenous useful genes include promoters of plant-derived albicans (rbcS) genes (Plant Mol Biol. 2000; 44 (1), 99-106) that induce expression in photosynthetic tissues such as leaves, (IbMADS) gene promoter (Korean Patent Laid-Open Publication No. 2004-0067290) which induces expression in root and root, These are widely used for the accumulation of useful proteins and the production of useful substances.

Promoters that express foreign useful genes according to developmental stages of the plant include seed-specific promoters of the glutelin gene from rice (Plant Mol Biol. 1990; 14 (1), 41-50) and soybean-derived lectins (Plant Physiol. 1994; 105 (1), 405-876), which is a promoter of the PDS gene derived from tomato-derived fruit-specific expression, 413) .

However, since the promoters induce the expression of exogenous useful genes only in the apical and apical meristems of plants, it is possible to control the expression of the exogenous useful genes by controlling only the initial stages of the plant and to increase the growth and yield, As such, there is an urgent need to develop such a promoter.

Thus, the present inventors have completed the present invention by confirming that the promoter of the ns-LTP gene isolated from Echinochloa can induce the expression of the target gene only in the apical and apical meristems of plants.

Accordingly, an object of the present invention is to provide a promoter capable of suppressing gene expression in other tissues and expressing it only in the apical and apical meristem.

Another object of the present invention is to provide an expression vector for plant transformation comprising the promoter.

It is still another object of the present invention to provide a transgenic plant capable of regulating the growth and yield of a plant by introducing the expression vector and regulating the traits of shoot and root growth.

Yet another object of the present invention is to provide a method for controlling the growth and yield of a plant by introducing the expression vector into a plant.

In order to achieve the above object, the present invention provides a promoter of the ns-LTP gene, which is composed of the nucleotide sequence of SEQ ID NO: 1 and is specifically expressed in the apical and apical mitotic tissues.

Further, the present invention provides a primer set for amplifying a promoter of the ns-LTP gene comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 2 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 3.

The present invention also provides an expression vector comprising an ns-LTP promoter.

The present invention also provides a transgenic plant into which an expression vector has been introduced.

In addition, the present invention provides a method of expressing a plant in a genomic and apical meristematic structure, which comprises introducing an expression vector into a plant.

The promoter of the ns-LTP gene according to the present invention is specifically active in the apical and apical meristems of a plant, and expresses a gene related to growth or development specifically in apical and apical meristems of a plant, And thus can be effectively used for the development of plant-specific gene expression plants of apical and apical meristems.

FIG. 1 shows the nucleotide sequence of the promoter of the mosaic tree-derived ns-LTP gene used in the production of an expression vector according to an embodiment of the present invention.
Fig. 2 shows that the promoter of the nas-LTP gene derived from the moss-like tree is expressed in a tissue-specific manner.
FIG. 3A shows the structure of the pBI121 vector used in the production of an expression vector according to an embodiment of the present invention.
3B shows the structure of a transformant vector capable of using the promoter of the nas-LTP gene derived from the moss-like tree as an expression-regulating promoter.
Fig. 4 shows the result of gDNA-PCR analysis of a transgenic plant expressing the GUS gene as a promoter of the ns-LTP gene derived from the mushroom-derived tree.
FIG. 5 is a photograph showing a mushroom transgenic plant in which the GUS gene is expressed as a promoter of the ns-LTP gene derived from the mushroom-derived tree.
FIG. 6 shows the results of confirming the expression level of the GUS gene in the mosaic virus transgenic plants expressing the GUS gene as a promoter of the ns-LTP gene derived from the mosquito-borne tree.
FIG. 7 shows the results of confirming that the plant-specific expression of GUS gene was expressed through GUS staining in a moss-bearing transgenic plant in which the GUS gene is expressed as a promoter of the ns-LTP gene derived from the mushroom-derived tree.

The present invention provides a promoter of the ns-LTP gene consisting of the nucleotide sequence of SEQ ID NO: 1 and specifically expressed in the apical and apical mitotic tissues.

The promoter of the present invention is a promoter of Populus alba x P. glandulosa ).

1, the promoter region of the 758 bp ns-LTP gene and the 126 bp 5 'untranslated region (5-UTR) of the promoter region of the promoter of the present invention are 884 bp in total. ).

Since the promoter of the ns-LTP gene of the present invention induces specific expression of apical and apical meristems, it can be effectively used for development of apical and apical meristem-specific gene expression plants.

Further, the present invention provides a primer set for amplifying a promoter of the ns-LTP gene comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 2 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 3.

The present invention also provides an expression vector comprising a promoter of the ns-LTP gene.

The expression vector of the present invention may be a transforming binary vector that can be permanently expressed in a plant into which the foreign gene is introduced.

In addition, the expression vector according to the present invention may be pBI121-pPagns-LTP having the gene map shown in Fig. 3B.

Referring to FIG. 3B, the expression vector according to the present invention can be prepared by replacing the 35s promoter by being located in front of the β-glucuronidase (GUS) gene of the pBI121 vector shown in FIG. 3A.

The present invention also provides a transgenic plant into which the above expression vector has been introduced.

Promoters that can limit the expression of exogenous useful genes at specific stages of the developmental stage of plants can be usefully used to regulate plant growth. In particular, the regulation of the expression of the foreign useful gene in the early developmental stage of the plant is an important factor for regulating the growth and yield.

Chute vertices, including the ends and periphery of the stem, induce cell division and develop plant organs such as stems and leaves. In the early developmental stages of roots, all cells in apical meristems usually divide at the same rate to develop roots, and as time passes, cells in the center of the mitotic tissue become inactive.

Therefore, inducing the expression of exogenous useful genes only in the apical and apical meristems of plants can increase the growth and yield by controlling only the initial stage of development of the plant.

The transgenic plant of the present invention can specifically express the promoter of the ns-LTP gene consisting of the nucleotide sequence of SEQ ID NO: 1 in the frontal and apical meristems.

In the transgenic plant of the present invention, the plant may be a willow tree or a tree.

In the transgenic plant of the present invention, the willow tree and the tree may lie in a strabismus. Examples of the above-mentioned Salicaceae tree include a willow tree, a hashish tree, a new willow tree, Populus deltoides , Populus davidiana , Populus alba , Populus maximowiczii), hyeonsasi trees (Populus alba × P. There is tremula . glandulosa), poplar (Populus nigra , Japanese poppy ( Populus sieboldii , Populus simonii ), but the present invention is not limited thereto.

In addition, the present invention provides a method for expressing a plant in a genomic and apical meristematic structure, comprising the step of inserting the promoter of the ns-LTP gene into an expression vector and then introducing the expression vector into which the promoter is inserted do.

In the expression method of the present invention, a method of introducing an expression vector into a plant may be a known method such as a method using Agrobacterium (Choi et al, 2005, J Plant Biol 48: 351355), a method using a gene gun So that detailed description thereof will be omitted.

In the expression method of the present invention, the plant may be a willow and a tree.

In the above-described expression method of the present invention, the willow tree and the tree may lie on a limb, and examples of the limousine ( Salicaceae ) tree include a willow, a wasp, and a new willow. Tree ( Populus deltoides , Populus davidiana , Populus alba , Populus maximowiczii), hyeonsasi trees (Populus alba × P. There is tremula . glandulosa ), poppies ( Populus nigra ), Japanese sashimi ( Populus sieboldii , Populus simonii ), but the present invention is not limited thereto.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are intended to illustrate the present invention, but the scope of the present invention is not limited by the following examples.

< Example  1> From the Emperor's Tree ns - LTP  Isolation of the promoter of the gene and determination of the base sequence

Populus tree alba x P. glandulosa ) from the genomic DNA isolated from the ns-LTP gene A primer set consisting of a forward primer (CAAAACAGCATCTCATCCTTCA: SEQ ID NO: 2) and a reverse primer (GGCAAGTGAATAAGACCAACG: SEQ ID NO: 3) was prepared so as to specifically amplify the promoter.

Genomic DNA was extracted from leaves of Rhododendron japonicus and then polymerase chain reaction (PCR) was performed using the above primer set to obtain the ns-LTP gene The promoter 884 bp (SEQ ID NO: 1) was isolated.

The polymerase chain reaction was denatured at 95 ° C for 10 minutes, followed by 30 cycles of reaction at 94 ° C for 1 minute, 55 ° C for 40 seconds, and 68 ° C for 2 minutes, and PCR was carried out at 68 ° C for 10 minutes.

The obtained 884 bp PCR product was inserted into the PCR cloning vector pGEM-T (Promega Madison, Wis., USA) to confirm the nucleotide sequence. The results are shown in FIG.

1, the nucleotide sequence of the PCR product is a 758 bp ns-LTP gene promoter region (7th to 764th bases) and a 126 bp 5 'UTR region of the ns-LTP gene (765th to 890th Second base).

1, the first to sixth bases and the 891st to 896th bases are restriction enzyme sites.

< Example  2> Mishima  origin ns - LTP  Promoter tissue-specific expression analysis of genes

In order to investigate whether the promoter of the ns-LTP gene of the mosquito-borne ns-LTP gene was expressed in a tissue-specific manner, the expression level of the ns-LTP gene promoter was examined by qRT-PCR using a mosquito tree cultured for 4 weeks in the cabin. Respectively.

At this time, 1 μl of cDNA synthesized with 1 μg / μl of RNA from young roots and aged roots, stem, young leaves and aged leaves was added to 2 × iQ ^™ SYBR Green supermix (Bio Rad, Hercules, (Agccaccgaataccaatgag: SEQ ID NO: 4) and reverse primer (tgttttgtggagctgtgagg: SEQ ID NO: 5) prepared based on the promoter base sequence of the gene were carried out in a total volume of 20 μl containing 10 pmol each.

In addition, qRT-PCR was performed at 95 ° C for 1 minute using a CFX96 real-time system (Bio Rad, Hercules, USA), followed by 40 cycles of reaction at 95 ° C for 15 seconds, 56 ° C for 15 seconds, and 72 ° C for 20 seconds , And allowed to react at 72 ° C for 5 minutes. At this time, Actin2 was used as a control gene to quantify the expression level.

As shown in Fig. 2, the promoter of the ns-LTP gene derived from Echinochloa sp. Is not expressed or hardly expressed in senescent leaves, aged roots and stems, while it is expressed 7 times or more than 40 times in young leaves and young roots As a result, it was confirmed that the promoter of the nas-LTP gene derived from Echinochloa spp. Was specifically expressed at the early stage of development.

< Example  3> Production of plasmid for transformation

From the moss-bearing tree-derived ns-LTP gene isolated in Example 1 In order to transform the promoter into a tree in the mosquito, the pBI121 vector shown in Fig. 3A, in which the GUS gene was inserted, was used to transform ns-LTP A carrier for analyzing the promoter function was prepared.

The Hind III restriction enzyme recognition site was added to the 5 'primer (aagctttttacgtacgggcaatgcta: SEQ ID NO: 6) and the Bam HI restriction enzyme recognition site was added to the 3' primer (cagtagcttgtcgacattttgaggatcc: SEQ ID NO: 7) Respectively.

The p35S of the pBI121 vector was removed and the amplified PCR products were cut into Hin dIII and Bam HI for insertion in front of the GUS gene.

The insertion was confirmed by Colony PCR and restriction enzyme treatment to construct the pBI121-pPagns-LTP vector for transformation as shown in Fig. 3B. In Fig. 3B, Nos-Pro and NTPII are antibiotic kanamycin resistance genes.

< Example  4> Using Agrobacterium Mishima  Transformation and selection

To introduce the pBI121-pPagns-LTP vector prepared in Example 3 into plants, Agrobacterium tumefaciens LBA4404.

The transgenic trees were transplanted with Agrobacterium for 15 minutes (Choi et al, 2005, J Plant Biol 48: 351355).

After incubation for 2 days in callus induction medium (MS, 2,4-D 1.0 mg / L, BAP 0.1 mg / L, NAA 0.01 mg / L), callus induction with kanamycin 50 mg / And cultured in the medium for 4 weeks.

(WPM, Zeatin 1.0 mg / L, BAP 0.1 mg / L, NAA 0.01 mg / L, and kanamycin 50 mg / L) to induce shoots from the calli derived from the selection medium. Plants were cultured at 25 ± 2 ° C, 30 μmole m ^-2 S ^-1, 16 hours light condition,

Transformation was confirmed by genomic DNA PCR analysis. A forward primer (cgcacttacaggcgattaaag: SEQ ID NO: 8) and a reverse primer (taataacggttcaggcacagc: SEQ ID NO: 9) capable of amplifying the GUS gene were used for the verification of transgenic mossy trees.

PCR was performed by adding 10 pmol of a forward primer of GUS gene and 10 pmol of reverse primer to Ex-Taq DNA polymerase (Takara, Otsu, Shiga, Japan) and adding GUS gene expressed in ns-LTP promoter Genomic DNA, or 100 pg of genomic DNA of untransformed seedling (WT).

PCR amplification was carried out at 98 ° C for 5 minutes, at 98 ° C for 30 seconds, at 56 ° C for 30 seconds at 72 ° C, and the resultant PCR product was confirmed by electrophoresis on 1.0% agarose gel.

FIG. 5 is a photograph showing a mushroom transgenic plant in which the GUS gene is expressed as a promoter of the ns-LTP gene derived from the mushroom-derived tree.

< Example  5> Mishima  origin ns - LTP  Analysis of GUS gene expression level expressed by promoter of gene

In order to investigate the expression level of the GUS gene expressed as a promoter of the ns-LTP gene derived from the Japanese mushroom-derived tree, pBI121-pPagns-LTP was transfected with the non-transgenic mosaic tree as a control and the expression of the GUS gene was analyzed by q-RT PCR The results are shown in Fig.

In this case, 2 × iQ ^TM a cDNA synthesized with RNA 1 ㎕ 1㎍ / ㎕ of 4-week-old plants 10 [mu] l of SYBR Green supermix (Bio Rad, Hercules, USA) was subjected to a total volume of 20 [mu] l containing 10 pmol of the forward primer of SEQ ID NO: 8 and 10 pmol of the reverse primer of SEQ ID NO:

The above-mentioned qRT-PCR was performed at 95 ° C for 1 minute using a CFX96 real-time system (Bio Rad, Hercules, USA), and the reaction was repeated 40 times at 95 ° C for 15 seconds, 56 ° C for 15 seconds, and 72 ° C for 20 seconds , And allowed to react at 72 ° C for 5 minutes. At this time, Actin2 was used as a control gene to quantify the expression level.

< Example  6> Transformation Mossy GUS  Expression location and activity analysis

In order to investigate the expression pattern of the GUS gene expressed by the promoter of the ns-LTP gene derived from the mushroom-derived tree, pBI121-pPagns-LTP was transfected with pBI121-p35S transgenic mussel and GUS The expression of the gene was observed.

4-week-old plants were immersed in GUS-assay buffer (20 mM of cyclohexyl ammonium salt, 100 mM NaH ₂ PO ₄ H ₂ O, 10 mM of NaEDTA, 0.1% of Triton X-100, pH 7.5) After the treatment, the buffer solution was discarded, immersed in 70% (w / v) ethanol, and repeatedly replaced at 37 ° C for 1 hour until the chlorophyll was completely removed.

pBI121-pPagns-LTP Transgenic trees were observed in GUS blue coloration in the apical and apical meristems, whereas GUS blue coloration was not observed in the non-transgenic trees, and pBI121-p35S transgenic trees showed GUS blue coloration (See Fig. 7).

Referring to FIG. 7, in the case of pBI121-pPagns-LTP transgenic potato trees, GUS blue color development was not observed in various tissues including aged leaves, stems and aged roots of plants, but only in shoots and developing roots, The promoter of the nas-LTP gene derived from the mosquito-borne tree is expressed only in the apical and apical meristems.

Since the promoter of the ns-LTP gene according to the present invention is specifically active in the apical and apical meristems of a plant, it is possible to specifically express the genes related to growth or development in the apical and apical meristems of plants, It can be very usefully applied to industries in the technical field to be controlled.

<110> Republic of Korea (Korea Forest Research Institute) <120> A promoter of ns-LTP gene derived from Populus alba Populus          glandulosa specifically expressing at apical and root meristem of          plant <130> 9762 <160> 9 <170> Kopatentin 2.0 <210> 1 <211> 884 <212> DNA <213> Populus alba Populus glandulosa <400> 1 tttacgtacg ggcaatgcta tatttattaa taattttgtt gttcacacta cttagttttt 60 ttaaaaaata actaatttat ttttcattaa tgtttattat attttagttt aatttactgt 120 cttctttaat taatgatgac ataaagagat taattaacaa tggtcatttt aaaagaagca 180 ggaactaaaa acatcaaaac atgcatttct tacaatttaa ttaatctgtg aagtgcttga 240 aaaatgttct tctttctttc tttcctgtgc gcagagtact gatcttcagg ccaatttttg 300 ttaggatgtt cttaattatg tattgtacac tagtcacggc cttctttgct tgtctgtgat 360 ccctgacacc attgctgtct attttgggat gacattagaa tgaataataa taataataat 420 aataataata gttcacatga taaaaaccta tatctaaatg gacacgagag tcgtgtccaa 480 tattatatat agaaggctgg tcctggctgt tttctgtatt catatagatg gtgagcaatg 540 gctacgcatc atcgtcacat gcatgcatgt ttgcacagag ccatctcata aactacaaga 600 agaactcagc tagatgtgca aaatttccac taaaatccac tgagccttct agccaccgaa 660 taccaatgag cacccgtgac tcagatggac catggtattg ctcaatccgc cagctccatg 720 gttttaaggt catagccttg ttaaatctgt gcccaatgac cccacccgat gccatttact 780 ttcgtatctt cattgctata taagtcctaa cgtaccattg gctctcctca cagctccaca 840 aaacaagaga caagaaagag atcagtagct tgtcgacatt ttga 884 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 2 tttacgtacg ggcaatgcta 20 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 3 cagtagcttg tcgacatttt ga 22 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 4 cagtagcttg tcgacatttt ga 22 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 5 tgttttgtgg agctgtgagg 20 <210> 6 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 6 aagcttttta cgtacgggca atgcta 26 <210> 7 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 7 cagtagcttg tcgacatttt gaggatcc 28 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 8 cgcacttaca ggcgattaaa g 21 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 9 taataacggt tcaggcacag c 21

Claims (15)

A promoter of the ns-LTP (non-specific lipid transfer protein) gene, which is composed of the nucleotide sequence of SEQ ID NO: 1 and is specifically expressed in the apical and apical meristematic tissues. 2. The promoter of ns-LTP gene according to claim 1, wherein the promoter is derived from a tree of the mosquito. A primer set for amplifying a promoter of a ns-LTP (non-specific Lipid Transfer Protein) gene according to claim 1, comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO: 2 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: An expression vector comprising the promoter of the ns-LTP (non-specific lipid transfer protein) gene described in claim 1. 5. The expression vector according to claim 4, wherein said vector is pBI121-pPagns-LTP having a gene map as shown in Fig. 3B. 5. A transgenic plant into which the expression vector of claim 4 or 5 has been introduced. 7. The transgenic plant according to claim 6, wherein the plant specifically expresses the promoter of the ns-LTP gene consisting of the nucleotide sequence of SEQ ID NO: 1 in the apical and apical meristem. 7. The transgenic plant according to claim 6, wherein the plant is a willow and a tree. 9. The transgenic plant according to claim 8, wherein the willow and the tree are apical trees. 10. The transgenic plant according to claim 9, wherein the amber tree is a moss. 1. A method for producing a plant, comprising the steps of: inserting a promoter of the ns-LTP (non-specific lipid transfer protein) gene described in claim 1 into an expression vector, and then introducing the expression vector into which the promoter is inserted into the plant; Specific expression method. 12. The method according to claim 11, wherein the plant is a willow tree. 13. The method according to claim 12, wherein the willow and the tree are peony trees. 14. The method according to claim 13, wherein the apical timber is a timber timber. The expression method according to claim 11, wherein the expression vector is an expression vector according to claim 4 or 5.

Images