KR101649511B1 - Nucleic Acid Aptamers Specifically Binding to E. coli and Uses Thereof - Google Patents

Abstract

The present invention relates to a nucleic acid plasmid specifically binding to E. coli and a use thereof. More particularly, the present invention relates to a nucleic acid plasmid that specifically binds to E. coli, and more particularly to a plasmid in which the binding affinity to E. coli is increased using the Cell- To an effective detection method of E. coli. Since the aptamer of the present invention is a 2'-F-modified RNA abatumer, unlike general RNA, it is resistant to RNase present in bacteria, so that aptamers can bind to bacteria without being degraded by bacteria, It can be used as a labeling material after being transformed into a die. Since it selectively binds only to Escherichia coli, it can be used for contaminated samples from other bacteria. Since it binds directly to Escherichia coli at room temperature, it can be detected quickly without a separate substance such as a primer .

Description

Nucleic Acid Aptamers Specifically Binding to Escherichia coli and Uses Thereof}

The present invention relates to a nucleic acid plasmid specifically binding to E. coli and a use thereof, and more particularly, to a nucleic acid plasmid having excellent binding affinity to E. coli identified using the Cell-SELEX method and a use thereof .

Recently E. coli to detect the (E. coli), methods studies, has been developed to use a method of culturing bacterial cells in a variety of solid media (Markus et Tzschoppe al . , International Journal of Food Microbiology, 152: 19-30 (2012)). The bacterial detection technology on the solid medium is very simple and inexpensive because it cultivates bacterial cells in a solid medium on petri dish. However, there is a disadvantage in that it takes more than a day to produce colonies by growing bacteria in a solid medium, it is difficult to distinguish them from other bacteria when they are contaminated, and that the number of bacterial cells can not be precisely measured.

In another conventional method, fluorescence intensity was measured using an antibody and a quantum dot (fluorescent material) as a method for detecting E. coli (Luxin Wang et al . , International Journal of Food Microbiology, 156: 83-87 (2012)). Since the test method using the quantum dots uses antibodies selectively binding to E. coli, it is possible to selectively measure the number of E. coli even in a sample contaminated with other bacteria. However, because antibodies are produced in animals and their cells, they are expensive, there is a problem of batch culture variation, and since they are denatured by heat to lose activity, and because of the structure of antibodies, There is a disadvantage in that the signal-to-noise ratio value is small when measured by the signal-to-noise ratio.

In another conventional method, a primer designed specifically for a gene contained in bacteria and a qPCR (quantitative polymerase chain reaction) using this primer were used as a method for detecting E. coli (Alejandro Garrido et al . , International Journal of Food Microbiology, 164: 9298 (2013)). Since the above technique selectively amplifies genes of E. coli, it is possible to selectively measure the number of E. coli even in a sample contaminated with other bacteria. In addition, quantitative measurement results such as Ct (Cycle Threshold) values can be obtained. However, the process of extracting DNA from Escherichia coli and designing a primer to perform qPCR is complicated and requires expensive equipment, and the process of performing qPCR takes more than an hour.

In order to overcome the limitations of the prior art, methods using plumbers have been studied. Aptamer is a single-stranded nucleic acid such as DNA or RNA having a stable tertiary structure and capable of binding to a target molecule with high affinity and specificity. Since 1990, many abundant plasmids have been unearthed that can bind to a variety of target molecules, including small molecule organisms, peptides, and membrane proteins. The aptamer has a characteristic of being able to selectively bind to a target molecule with high binding force and specificity, so that it can be used for distinguishing a specific substance.

Since aptamers can be chemically synthesized, they are inexpensive and have no batch culture variation. They can be chemically modified easily by fluorescent dyes or biotin, There are advantages of long-term preservation, small molecule size, and high signal-to-noise ratio when applied to fluorescence imaging.

SELEX for digestion of platamer was designed by Larry Gold in 1990 and it has been announced that the same method can be used to identify platamers that can bind affinity to a variety of target substances from low molecular weight compounds to high molecular weight proteins. SELEX (Systematic Evolution of Ligands by Exponential Enrichment) is a process for screening a small number of individuals having affinity for a target substance from a randomly synthesized oligonucleotide complex. Single-stranded oligonucleotide libraries used in SELEX include 10 ¹⁵ And has primer sequences for performing PCR reaction at both ends. Individuals bound to the target substance among the formed libraries are distinguished from non-bound individuals, amplified, and made into RNA, which are repeatedly selected. The Cell-SELEX method is a method of extracting a specific tympanic membrane-specific target protein on the cell surface in a way that the cell and the aptamer directly bind to each other. The Cell-SELEX method does not require purification of high-purity proteins unlike the conventional SELEX method using purified proteins. Since Cell-SELEX uniquely identifies the type of target protein when the target protein is present in the cell, The aptamer discovered through SELEX has the advantage that it is easier to use in vivo than the platamer extracted from recombinant proteins produced and isolated from Escherichia coli.

Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

The present inventors have sought to develop a method for effectively detecting Escherichia coli in a living state. As a result, the present inventors isolated / identified novel nucleic acid plasmids that specifically bind to E. coli through the Cell-SELEX method, and when using fluorescent dye-conjugates thereof, the presence or absence of E. coli The presence or absence of E. coli can be accurately detected by using a primer pair targeting the nucleic acid plasmid in the case where the concentration (or number) of E. coli in the sample is low The present invention has been completed.

Accordingly, an object of the present invention is to provide a nucleic acid plasmid.

Another object of the present invention is to provide a composition for detecting E. coli.

It is still another object of the present invention to provide a kit for detecting E. coli.

It is still another object of the present invention to provide a sensor for detecting E. coli.

It is another object of the present invention to provide a method for detecting E. coli in a sample.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

In one embodiment of the invention, the invention is a nucleic acid aptamer selected from the group consisting of SEQ ID NOS: 1 to 8, wherein the nucleic acid aptamer is selected from the group consisting of Escherichia lt; RTI ID = 0.0 > E. coli . < / RTI >

In another aspect of the present invention, the present invention provides a method for detecting Escherichia coli in a sample comprising the steps of: (a) contacting a sample with the nucleic acid abstamator described above; And (b) detecting the presence or absence of E. coli in the reaction product of step (a).

The present inventors have sought to develop a method for effectively detecting Escherichia coli in a living state. As a result, the present inventors isolated / identified novel nucleic acid plasmids that specifically bind to E. coli through the Cell-SELEX method, and when using fluorescent dye-conjugates thereof, the presence or absence of E. coli The presence or absence of E. coli can be accurately detected by using a primer pair targeting the nucleic acid plasmid in the case where the concentration (or number) of E. coli in the sample is low .

Cell-SELEX (Systematic Evolution of Ligands by Exponential Enrichment) is a powerful model applied to various fields (especially cancer research and treatment) designed to select a pressure probe for target detection. The Cell-SELEX model utilizes a link between oligonucleotides and molecules present on the extracellular surface. Briefly, the Cell-SELEX method comprises (i) preparing library molecules using PCR; (ii) a round of (a) identifying a sequence binding to a target cell (a positive selection step); (b) removing the sequence binding to the non-target cell in the identified sequence (negative selection step); And (c) PCR amplifying the non-binding sequences in the step (b) to produce an oligonucleotide pool capable of binding to a target cell; And (iii) concentrating the oligonucleotide pool to a more specific oligonucleotide pool through repetition of the round (e.g., 10-15 rounds). Finally, the selected oligonucleotide pool can be cloned by PCR amplification and identified by sequencing to identify potential nucleic acid primers. In addition, the oligonucleotide-cell junctions that are recognized by the Cell-SELEX method can provide the following information: (a) the specificity of the tympanic membrane (regardless of the molecular configuration of the cell surface, ≪ / RTI > (b) the diversity of the target (the selection process can acquire the specificity of various plumbers for a large number of molecules (especially proteins) present on the cell surface); (c) functionality as a biomarker (target of platemer obtained through selection process may be applied to separation of specific cells); And (d) molecular information about the actual structure and distribution of cell surface molecules.

The present invention provides a nucleic acid plasmid capable of specifically binding to E. coli and a method of identifying the same (Cell-SELEX method).

In the present invention, a library pool is prepared using the nucleic acid sequence of SEQ ID NO: 9 represented by the following general formula 1:

1

SEQ ID NO: 10 (ATACCAGCTTATTCAATT) -40 of arbitrary nucleotide sequence (N ₄₀₎ - SEQ ID NO: 11 (AGATAGTAAGTGCAATCT)

In some embodiments of the invention, the 40 random nucleotide sequences in the library pool include sequences synthesized by adding dNTPs at a ratio of dG: dA: dT: dC = 1: 1: 1: 1, no.

The present invention is used to obtain a pool of nucleic acid abstamor candidates capable of specifically binding to E. coli using a library pool consisting of a total of 76 nucleotides (see Fig. 1).

First, an RNA library pool is prepared by in vitro transcription of the nucleic acid library pool composed of SEQ ID NO: 9. The prepared RNA pool is reacted with a target cell (for example, Escherichia coli) to remove unbound RNA, and the RNA bound to the target cell is amplified by PCR to prepare a first filtered RNA library pool (one round) . The round process is repeated using the filtered RNA library pool (positive selection step). Depending on the reaction conditions between the target cell and the RNA library pool, the number of rounds to be carried out in the positive selection step can be varied.

In certain embodiments of the invention, the present invention repeats the positive selection step for 1 to 20 times, more specifically 1 to 15 times, and more particularly 1 to 10 times.

In some embodiments of the invention, the target cells of the invention are selected from the group consisting of Escherichia It includes coli).

The term "E. coli used in the present invention (Escherichia coli) ", as well as non-pathogenic E. coli penicillin, streptomycin, chloramphenicol, ampicillin, cephalosporin or tetracycline antibiotics such as - encompasses the E. coli strain containing the resistance of E. coli strain, for example, Chapter hemorrhagic Escherichia coli (E. coli enterohemorrhagic Enterotoxigenic E. coli (ETEC), enteropathogenic E. coli (EPEC), enteroinvasive E. coli (EIEC)), enteric collecting E. coli ( E. coli ) enteroaggregative E. coli include (EAggEC)) and urinary tract pathogenic E. coli (E.coli uropathogenic (UPEC)), but the embodiment is not limited thereto.

The non-target cells are then reacted with a pool of finally selected RNA libraries. The RNA bound to the non-target cell (e. G., Bacillus subtilis) is removed and an unbound RNA pool is reacted with the target cell (e. G., E. coli). The resulting ligated RNA was amplified by PCR to produce a first filtered RNA library pool (11 rounds). The round process is repeated using the filtered RNA library pool (12 rounds; voice selection step). In addition, the number of rounds of the negative selection step carried out through the continuous reaction between the RNA library pool identified in the positive selection step and the non-target cell and the target cell can be variously determined.

In certain embodiments of the present invention, the present invention relates to a method wherein the voice selection step is repeated from 1 to 5 times, more specifically from 1 to 4 times, more specifically from 1 to 3 times, Repeat 1 to 2 times.

As a result, the present invention provides a nucleic acid plasmid capable of specifically binding to E. coli with high affinity from the library pool consisting of SEQ ID NO: 9.

The term " nucleic acid aptamer " as used herein refers to a single-stranded oligonucleotide molecule (DNA or RNA) typically having a length of less than or equal to 100-mer, , The T base in the nucleotide sequence is represented by U base, and this fact is apparent to those skilled in the art. In addition, the nucleic acid aptamer of the present invention may have a stable tertiary structure and bind to a target molecule with high affinity and specificity, and may be in a linear or cyclic form.

In certain embodiments of the invention, the nucleic acid amplimers of the invention comprise SEQ ID NO: 1 or SEQ ID NO: 5, or fragments, derivatives or analogs thereof, and more particularly SEQ ID NOs: The oligonucleotide comprises any one of oligonucleotides selected from the group consisting of SEQ ID NO: 8 or fragments, derivatives or analogues thereof, and more specifically any oligonucleotide selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 8, But is not limited thereto.

In some embodiments of the invention, each nucleotide in the nucleic acid plasmid of the invention comprises at least one or more chemical variants that are the same or different. For example, at the 2 'position of the ribose, it may be a nucleotide in which the hydroxyl group is substituted with any atom or group.

In some embodiments of the present invention, the modified nucleotide analogues in the present invention are those in which the hydroxyl group at the 2 'position of the ribosome of the nucleotide is replaced by a hydrogen atom, a fluorine atom, an -O-alkyl group, But is not limited thereto. For example, wherein the modified nucleotide analogue is a hydrogen atom, a fluorine atom or a group -O- (such as: -O-CH _3), -O- acyl group (e.g., -O-CHO), amino group (e.g., -NH ₂ ), and any of the atoms or groups described above may be pyrimidine or purine nucleotides.

In certain embodiments of the invention, the nucleic acid amplimer of the present invention may comprise 20 to 200 nucleotide sequences, more specifically 23 to 100 nucleotide sequences, and more particularly 24 to 90 nucleotide sequences, Of the nucleotide sequence of SEQ ID NO: 1, and even more specifically, 25 to 80 nucleotide sequences.

When the number of nucleotides is less than 40 in the production of nucleic acid platamer, it is suitable for mass production through easy chemical synthesis, and thus it can be highly economical, and exhibits high in vivo stability and low toxicity due to simple chemical modification .

In some embodiments of the invention, the detection of a nucleic acid plasmid of the invention in conjunction with a target cell (e. G., E. coli) includes, but is not limited to, fluorescence detection and gene amplification.

In certain embodiments of the invention, the nucleic acid aptamer of the present invention can be directly coupled to a label that generates a detectable signal, which can be a moiety that can be easily detected by a detection method known in the art detecting moiety. For example, the label that generates the detectable signal may be a chemical label (e.g., biotin), a fluorescent label, a radioactive label (e.g., I ¹²⁵ and C ¹⁴ ), a luminescent label, a chemiluminescent label, and a fluorescence resonance energy transfer labels, but are not limited thereto.

Fluorescent labels that can be used in the present invention can be any of those known in the art, examples of which are (the number of parentheses is the maximum emission wavelength in nanometers): TAMRA 582, (506), YO-PRO ™ -1 509, YOYO ™ -1 509, Calcein 517, FITC 518, FluorX ™ 519, Alexa ™ 520, Rhodamine 110 520 ), 5-FAM 522, Oregon Green 500 (522), Oregon Green 488 (524), RiboGreen 525, Rhodamine Green 527, Rhodamine 123 529, Magnesium Green 531, , Calcium Green (533), TO-PRO ™ -1 533, TOTO1 533, JOE 548, BODIPY 530/550 550, Dil 565, BODIPY TMR 568, BODIPY 558/568 568), BODIPY 564/570 (570), Cy3TM (570), AlexaTM 546 (570), TRITC 572, Magnesium Orange 575, Phycoerythrin R & B 575, Rhodamine Phalloidin 575, (576), Pyronin Y (580), Rhodamine B (580), Rhodamine Red (590), Cy3.5 (596), ROX (608), Calcium Crimson (TM) Texas Red (615), TO-PRO ™ -3 (660), TOTO3 (612), N-Red Red (628), YO-PRO ™ -3 (631), YOYO ™ -3 (631), R-phycocyanin 660), DiD DilC (5) (665), Cy5 (670), Thiadicarbocyanine (671) and Cy5.5 (694).

Suitable fluorescent labels are disclosed in many references: Pesce et al . editors, FLUORESCENCE SPECTROSCOPY (Marcel Dekker, New York, 1971); White meat al . , FLUORESCENCE ANALYSIS: A PRACTICAL APPROACH (Marcel Dekker, New York, 1970); Berlman, HANDBOOK OF FLUORESCENCE SPECTRA OF AROMATIC MOLECULES, 2nd EDITION (Academic Press, New York, 1971); Griffiths, COLOR and CONSTITUTION OF ORGANIC MOLECULES (Academic Press, New York, 1976); Bishop, editor, INDICATORS (Pergamon Press, Oxford, 1972); Haugland, HANDBOOK OF FLUORESCENT PROBES AND RESEARCH CHEMICALS (Molecular Probes, Eugene, 1992); Pringsheim, FLUORESCENCE AND PHOSPHORESCENCE (Interscience Publishers, New York, 1949); Haugland, RP, HANDBOOK OF FLUORESCENT PROBES AND RESEARCH CHEMICALS, Sixth Edition, Molecular Probes, Eugene, Oreg., 1996; U.S. Patent Nos. 3,996,345 and 4,351,760.

In some embodiments of the invention, the nucleic acid overtamer of the invention is labeled with biotin or TAMRA.

In another aspect of the present invention, there is provided a composition for detecting Escherichia coli comprising the nucleic acid plasmid as an active ingredient.

In another aspect of the present invention, there is provided an E. coli detection kit comprising the nucleic acid plasmid as an active ingredient.

The compositions and kits of the present invention basically utilize the nucleic acid abstamators of the present invention described above, and the description common to both of them is omitted in order to avoid the excessive complexity of the present specification.

In some embodiments of the invention, the nucleic acid aptamer of the present invention is a conjugated nucleic acid abundant with a label generating a detectable signal, more specifically the label comprises a fluorescent dye, But is not limited thereto.

The composition of the present invention can be applied to the diagnosis of E. coli-induced diseases. For example, the E. coli-induced disease is selected from the group consisting of bacterial-induced gastroenteritis, urinary tract infection, neonatal meningitis, hemolytic uremic syndrome (HUS), peritonitis, mastitis, Pneumonia, hemorrhagic colitis (HC), secretory diarrhea with inflammation or inflammation, and food poisoning.

The term " diagnosing " as used herein includes determining whether an object currently has a particular disease or disorder, or determining the prognosis of an object that has suffered a particular disease or disorder.

In some embodiments of the invention, the sample in the amount of E. coli that can be detected according to the method of the present invention 10 ¹ -10 ⁷ cells / g, can be more specifically, 10 ² -10 ⁶ cells / g.

Since the nucleic acid plasmid of the present invention and the primer pair related thereto can specifically detect E. coli, it is possible to rapidly and accurately detect E. coli in a sample (for example, biological sample, natural product, food, etc.) have. That is, the product amplified by the primer pair of the present invention (for example, SEQ ID NO: 10 and SEQ ID NO: 11) for the nucleic acid plasmid bound to the E. coli in the sample can be an index for the presence of E. coli in the sample, Can be used for the diagnosis of induced diseases.

In some embodiments of the invention, the gene amplification of the present invention is performed according to a polymerase chain reaction (PCR). In some embodiments of the invention, the primers of the invention are used for amplification reactions.

PCR is the most well-known nucleic acid amplification method, and many variations and applications thereof have been developed. For example, touchdown PCR, hot start PCR, nested PCR and booster PCR have been developed by modifying traditional PCR procedures to enhance the specificity or sensitivity of PCR. In addition, multiplex PCR, real-time PCR, differential display PCR (DD-PCR), rapid amplification of cDNA ends (RACE), inverse polymerase chain reaction inverse polymerase chain reaction (IPCR), vectorette PCR and TAIL-PCR (thermal asymmetric interlaced PCR) have been developed for specific applications. For more information on PCR, see McPherson, MJ, and Moller, SG PCR . BIOS Scientific Publishers, Springer-Verlag New York Berlin, Heidelberg, NY (2000), the teachings of which are incorporated herein by reference.

The term " amplification reaction " as used herein refers to a reaction to amplify a nucleic acid molecule. A variety of amplification reactions have been reported in the art and include polymerase chain reaction (PCR) (US Patent Nos. 4,683,195, 4,683,202, and 4,800,159), reverse-transcription polymerase chain reaction (RT-PCR; Sambrook et al., Molecular Cloning . A Laboratory Manual , 3rd ed. The method of Miller, HI (WO 89/06700) and Davey, C. et al (EP 329,822), multiplex PCR (McPherson and Moller, 2000), ligase chain reaction LCR), Gap-LCR (WO 90/01069), repair chain reaction (EP 439,182), transcription-mediated amplification (TMA; WO 88/10315), self- (US Ser. No. 6,410, 276), consensus sequence primed polymerase chain reaction (CP), and the like. -PCR; U.S. Patent No. 4,437,975), arbitrarily primed polymerase chain reaction (AP-PCR; U.S. Patent Nos. 5,413,909 and 5,861,245), nucleic acid sequence based amplification NASBA; US But are not limited to, those disclosed in U.S. Patent Nos. 5,130,238, 5,409,818, 5,554,517 and 6,063,603), strand displacement amplification and loop-mediated isothermal amplification (LAMP) Do not. Other amplification methods that may be used are described in U.S. Patent Nos. 5,242,794, 5,494,810, 4,988,617, and U.S. Patent No. 09 / 854,317.

As used herein, the term " primer " means an oligonucleotide in which the synthesis of a primer extension product complementary to a nucleic acid chain (template) is induced, that is, the presence of a polymerizing agent such as a nucleotide and a DNA polymerase, It can act as a starting point for synthesis at suitable temperature and pH conditions. Specifically, the primer is a deoxyribonucleotide and a single strand. The primers used in the present invention may include naturally occurring dNMPs (i.e., dAMP, dGMP, dCMP and dTMP), modified nucleotides or non-natural nucleotides. In addition, the primers may also include ribonucleotides.

The primer should be long enough to be able to prime the synthesis of the extension product in the presence of the polymerizing agent. The appropriate length of the primer is determined by a number of factors, such as temperature, application, and the source of the primer. As used herein, the term " annealing " or " priming " means that oligodeoxynucleotides or nucleic acids are apposited on a template nucleic acid primer, wherein the polymerase comprises a nucleotide polymerizing the nucleotide to form a template nucleic acid plasmid Conditions for nucleic acid hybridization suitable for forming complementary nucleic acid molecules in a portion thereof are described in Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001) and Haymes, BD, et al., Nucleic Acid Hybridization , A Practical Approach , IRL Press, Washington, DC (1985).

A variety of DNA polymerases can be used in the amplification of the present invention and include "Klenow" fragments of E. coli DNA polymerase I, thermostable DNA polymerase and bacteriophage T7 DNA polymerase. Specifically, the polymerase is a thermostable DNA polymerase from a variety of bacterial species, including Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis , Thermis flavus , Thermococcus literalis , and Pyrococcus but are not limited to, furiosus (Pfu).

When performing the polymerization reaction, it is preferable to provide the reaction vessel with an excessive amount of the components necessary for the reaction. The excess amount of the components required for the amplification reaction means an amount such that the amplification reaction is not substantially restricted to the concentration of the component. It is desirable to provide the reaction mixture with such joins as Mg ^{2 +} , dATP, dCTP, dGTP and dTTP to such an extent that the desired degree of amplification can be achieved. All enzymes used in the amplification reaction may be active under the same reaction conditions. In fact, buffers make all enzymes close to optimal reaction conditions. Thus, the amplification process of the present invention can be carried out in a single reaction without changing conditions such as the addition of reactants.

In the present invention, the annealing is carried out under stringent conditions that allow specific binding between the target nucleic acid primer and the primer. The stringent conditions for annealing are sequence-dependent and vary with environmental variables.

The kit of the present invention may further include other components in addition to the above components. For example, if the kit of the invention applied to a PCR amplification process, the kit of the present invention optionally, reagents required for PCR amplification, for example, buffers, DNA polymerase (e.g., Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis , Thermis flavus , Thermococcus A thermostable DNA polymerase obtained from literalis or Pyrococcus furiosus (Pfu)), may include a DNA polymerase and dNTPs joinja. The kit of the present invention may be made from a number of separate packaging or compartments containing the above reagent components.

The kit for detecting Escherichia coli of the present invention may further comprise a buffer solution and containers for performing and analyzing the detection if necessary, such as a bottle, a sachet, an envelope, a tube, Ampoule, and the like, which may be partially or wholly formed from plastic, glass, paper, foil, wax, and the like. The container may be fitted with a cap which is initially part of the container or can be fully or partially detachable, which may be attached to the container by mechanical, adhesive, or other means. The container may also be equipped with a stopper, which is accessible to the contents by the injection needle. The kit may include an external package, and the external package may include instructions for use of the components.

In another embodiment of the present invention, the present invention relates to a method for producing Escherichia coli coli detection sensor.

The sensor of the present invention basically uses the above-described nucleic acid plummeter of the present invention, and the description common to both of them is omitted in order to avoid the excessive complexity of the present specification.

Nucleic acid aptamers of the present invention may be incorporated into a solid support such as beads, particles, dipsticks, fibers, filters, membranes and glass slides, and solid supports such as silane or silicate supports, either directly or indirectly, Such as an ionic bond, an electrostatic bond, a hydrophobic bond, a hydrogen bond, a covalent bond, a hydrophilic bond, or a van der Waals bond. In addition, the solid support comprises at least one substantially rigid surface on which the nucleic acid platelets can be immobilized immovably. At this time, the nucleic acid aptamer can be immobilized by any conventional chemical coupling method. For example, by binding biotin to the end of the nucleic acid plamper to form a complex, immobilizing streptavidin on the surface of the chip or the like, and reacting the biotin with streptavidin immobilized on the surface of the substrate, The apta can be immobilized on the substrate surface.

Since the aptamer of the present invention is a 2'-F-modified RNA strand, it is resistant to RNase existing in bacteria different from the general RNA, so that the aptamer can bind to bacteria without being degraded by the bacteria.

The aptamer of the present invention may be used as a labeling substance after being transformed into a fluorescent dye or may be used for measurement in a precision sensor by an enzyme-linked immunosorbent assay (ELISA), and the present aptamer may be selectively bound to E. coli alone Therefore, it can be used for contaminated samples from other bacteria.

Furthermore, since the aptamer of the present invention binds directly to E. coli at room temperature, it can be detected rapidly without any additional material such as a primer.

Therefore, the aptamer of the present invention can be used without expensive equipment, large and heavy equipment, and complicated equipment, so that a more efficient and user-friendly detection and measurement method is possible.

FIG. 1 is a schematic diagram showing a method for producing an RNA compression device of the present invention using Cell-SELEX. FIG.
FIG. 2 shows the results of (a) measurement of the binding affinity of RNA pools of each round to E. coli and Bacillus subtilis using RT-qPCR (real-time quantitative PCR) and (b) FIG. 5 shows a comparison of the binding pattern of the N ₄₀ library through 12 rounds of RNA pool to E. coli.
Figure 3 (a) N ₄₀ library, the comparison and (b) OD ₆₀₀ value changes according to the time variation of Ec3 and Ec28 apta meogun a diagram showing the comparison of the number of pull-down (pull down) by each of the RNA pool bacteria .
Figure 4 (a) OD ₆₀₀ of 0.3 be when the N ₄₀ library, Ec3 and 28 apta comparison of the binding patterns to E. coli meogun and (b) OD ₆₀₀ of 0.8 il N ₄₀ libraries of time, Ec3 and Ec28 apta meogun Of E. coli. ≪ tb >< TABLE >
Figure 5 (a), and illustrates the sequence and hence the structure in accordance with the Ec3 and Ec28 aptamer of the present invention schematically, (b) is for the E. coli of the cutting sequence formed from the N ₄₀ library and Ec3 and Ec28 aptamer group Binding affinity.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

Example

Example 1: Preparation of RNA Abutamer that specifically binds to Escherichia coli

1-1. DNA  Manufacture of library

PCR (polymerase chain reaction) was performed using template DNA of 76 (nt) nucleotides in length with a random nucleotide sequence of 40 (nt) nucleotides long as 5'-ATACCAGCTTATTCAATT (N) ₄₀ AGATAGTAAGTGCAATCT- (≫ 10 < ¹⁵ > DNA). The DNA library was custom-made in yarn IDT (Integrated DNA Technologies, Inc .; USA), the addition ratio of dNTP dA: dG: dC: dT = 1: 1: 1: 1 and finally 10 to ¹⁵ or more different as A random library having a nucleotide sequence was prepared, and a T7 promoter sequence was included in the 5 'portion. The PCR is that before using the Solg ^TM chosen polymerase kit carried out at 95 ℃ for 5 minutes denaturation step; Three cycles of one cycle consisting of 30 seconds at 95 占 폚, 30 seconds at 53 占 폚 and 30 seconds at 72 占 폚; And final extension step at 72 ° C for 10 min. The final PCR mixture was purified by polyacrylamide gel (PAGE) after ethanol precipitation.

1-2. 2'-F-modified ( modified ) RNA  Manufacture of library

In vitro by a DNA library using the DuraScribe ^® T7 transcription kit (Epicentre Biotechnologies) (in 2'-F (fluorine) -substituted RNA was prepared through an in vitro transcription reaction. The transcription reaction was carried out at 37 ° C for 16 hours and then with 1 μl of DNase for 30 minutes at 37 ° C. The 2'-F-modified RNA prepared above was purified using a nucleotide removal kit (Qiagen).

1-3. Specific binding to E. coli RNA  Manufacturing of Pools (1-10 rounds)

RNA library (ordered by Integrated DNA Technologies, using the prepared DNA library _{[5'-ATACCAGCTTATTCAATT (N 40)} AGATAGTAAGTGCAATCT-3 '] and DuraScribe ^® T7 transcription kit, Ltd.) and the E. coli cells (ATCC, PTA-7296) After incubation, only RNA binding to E. coli was eluted. The eluted RNA was reverse transcribed using an ImProm-II Reverse transcription system (Promega) to prepare DNA, and the DNA was amplified by MyTaq ™ DNA polymerase (Bioline) PCR to prepare a DNA pool Respectively. RNA pools were prepared by in vitro transcription reaction using the above DNA pool as a template with a DuraScribe ( ^R) T7 transcription kit. The prepared RNA pool was further cultured with E. coli. The reactions were run for a total of 10 replicates.

1-4. Bacillus subtilis Bacillus subtilis ) ≪ / RTI > RNA RTI ID = 0.0 > E. < / RTI > RNA  Pool Manufacturing (11-12 rounds)

RNA pools and Bacillus subtilis cells (ATCC, 14593) prepared by the above Experimental Methods (1-1 to 1-3) were cultured and centrifuged to obtain only supernatant. After collecting the collected supernatant and E. coli cells, only RNA binding to E. coli was eluted. Wherein the eluted RNA was reverse transcribed using the ImProm-IIReverse transfer system the back made of DNA, MyTaq ^TM DNA polymerases to the amplification by PCR using after preparing the DNA pools, DuraScribe the DNA pool as a template ^® T7 transcription kit The RNA library was prepared through transcription reaction using the in vitro . The prepared RNA pool was further cultured with Bacillus subtilis. The reactions were carried out a total of two times.

1-5. RNA Selection of

Bacillus subtilis cells were washed twice with washing buffer (50 mM Tris-base, 5 mM KCl, 100 mM NaCl, 1 mM MgCl ₂ , 0.05% Tween-20, pH 7.4) Was mixed with 1 ml of the buffer and reacted at room temperature for 45 minutes. The culture was centrifuged at 6,000 rpm for 4 minutes, and only supernatant was obtained. Next, the E. coli cells were washed twice with washing buffer, and reacted with the supernatant collected at room temperature for 30 minutes. The culture was washed at 6,000 rpm for 4 minutes and then washed twice with wash buffer. 300 μl of washing buffer was added to the washed E. coli and allowed to react at 85 ° C for 5 minutes. The culture was centrifuged at 12,000 rpm for 1 minute, and only supernatant was obtained. 300 μl of acid-phenol: chloroform (PCI) alcohol (Abion) was added to the collected supernatant and subjected to voltexing, followed by centrifugation at 12,000 rpm for 5 minutes to obtain supernatant. To the obtained supernatant was added 300 μl of chloroform and vortexed, followed by centrifugation at 12,000 rpm for 5 minutes to obtain only supernatant. The obtained supernatant was subjected to ethanol precipitation to obtain RNA.

1-6. Preparation of cDNA

RNAs bound to E. coli were reverse transcribed using an ImProm-II Reverse Transcription System to prepare cDNA. The PCR mixture consisted of 4 μl of RNA, 0.5 μl of RTase, 0.5 μl of dNTP mix, 1 μl of 50 nM N ₄₀ down primer (SEQ ID NO: 12), 2 μl of 5 × RT buffer, 25 mM MgCl ₂ 1.2 and 0.8 μl of water. The PCR conditions were 5 min at 25 ° C, 60 min at 42 ° C, and 15 min at 70 ° C.

1-7. PCR standardization and PCR

DNA prepared by Experimental Method 1-6 and MyTaq polymerase kit were used. Denaturation step in which PCR is carried out at 95 DEG C for 5 minutes; 16 cycles of amplification step consisting of one cycle consisting of 30 seconds at 95 DEG C, 30 seconds at 53 DEG C and 30 seconds at 72 DEG C; And a final extension step at 72 ° C for 10 minutes. In the amplification step, PCR mixtures were collected at 8, 10, 12, 14 and 16 cycles and stored at 4 ° C, respectively. 100 ng of the DNA library prepared by the PCR reaction and the PCR mixtures were electrophoresed on a 10% polyacrylamide gel at 150 V for 30 minutes and then observed under UV through EtBr (Ethidium bromide) staining. After selecting a PCR cycle with a concentration close to the DNA library, PCR was performed on all cDNAs with the selected PCR cycles. The PCR mixture was ethanol precipitated and separated / identified using the Minielute PCR Purification Kit (Qiagen).

1-8. In bito  Transcriptional response

After the PCR standardization and PCR, the purified DNA was subjected to an in vitro transcription reaction using a DuraScribe ( ^R) T7 transcription kit to prepare 2'-F-modified RNA. The 2'-F-modified RNA was stored at 37 ° C for 16 hours and then added with 1 μl of DNase for 30 minutes at 37 ° C. The prepared RNA was purified using a nucleotide removal kit.

Example  2: specifically binding to E. coli RNA Abtamer's  Concentration Verification ( enrichment test )

The RNA pool of each round into a 1 ml wash buffer in each E. coli 10 ⁹ 100 pmol each dog and Bacillus subtilis 10. ⁹ incubated at room temperature for 30 minutes. Each round of cDNA was obtained by heat elution, acid-phenol: chloroform extraction, ethanol precipitation and cDNA synthesis. The cDNAs of each round were quantitated by RT-qPCR using SYBR green, and the binding strengths of each round of E. coli and Bacillus subtilis were compared. The results are shown in Fig.

As can be seen in FIG. 2, RT-qPCR and fluorescence microscopy confirmed that the RNA pool was enriched with RNAs bound to E. coli after a total of 12 rounds. As a result of comparing the binding affinities of 0 (N ₄₀ library), 5, 10, and 12 rounds of the RNA to E. coli and Bacillus subtilis by RT-qPCR, the binding affinity for E. coli was increased, And the binding affinity for the protein was decreased (Fig. 2A).

By fluorescence microscopy TAMRA modified N ₄₀ library and 12 more RNA than the N ₄₀ Library RNA pools of the resulting 12 round the observed binding patterns to E. coli RNA pool of round to was observed to bind to E. coli (Figure 2b ).

Taken together, these results indicate that twelve rounds of RNA pool were enriched with RNAs with binding specificity to E. coli.

Example  3: TA Cloning  Which is specifically bound to E. coli RNA Abtamer  Identify candidates' sequence

The composition of the cloning vector-DNA mixture contained 3 μl (2.1 ng / μl) of N ₄₀ DNA, 2 μl of vector, 1 μl of buffer A, 1 μl of buffer B, 1 μl of Raga and 2 μl of water, Cloning was performed with TA cloning vector kit. The cloning vector-DNA mixture was added to competent cells and reacted at 4 ° C for 30 minutes and then stored at 42 ° C for 1 minute and at 4 ° C for 5 minutes. The cold competent cells were added to 1 ml of SOB-Mg medium (Super Optimal Broth-Mg medium), and the mixture was slowly stirred at 37 ° C for 1 hour.

The competent cells in the SOB-Mg medium were centrifuged at 3,000 rpm for 2 minutes. The resulting pellet was dissolved in 100 μl of water, and 10 μl of 1 M IPTG (Isopropyl β-D-1-thiogalactopyranoside) Amp (Luria Broth Ampicillin) plate with 20 μl of 5-bromo-4-chloro-indolyl-β-D-galactopyranoside and cultured at 37 ° C. for 16 hours. Thereafter, the resulting white colonies were inoculated into 3 ml of LB-Amp medium and cultured at 37 DEG C for 16 hours with stirring. Plasmid DNA was obtained using plasmid minikits.

Twelve rounds of RNA were subjected to TA cloning, to obtain Ec3 and Ec28 platemer groups as domain sequences. In order to determine the structure of the minimum length sequence required for binding, the truncated sequence was designed and the sequences of the RNA tympanic candidate groups are shown in Table 1.

Sequence of designed RNA abomaker candidates. Clone order Ec3 (SEQ ID NO: 1) ATACCAGCTTATTCAATTGCACGAATTTGCTGTGTTTTTGGGGGGGTCGGGGAGTATAAGATAGTAAGTGCAATCT Ec3_ # 31 (SEQ ID NO: 2) TTCAATTGCACGAATTTGCTGTGTTTTTGGG Ec3_ # 47 (SEQ ID NO: 3) CCAGCTTATTCAATTGCACGAATTTGCTGTGTTTTTGGGGGGGTCGG Ec3_ # 40 (SEQ ID NO: 4) GCACGAATTTGCTGTGTTTTTGGGGGGGTCGGGGAGTATA Ec_28 (SEQ ID NO: 5) ATACCAGCTTATTCAATTTTGCGCTTGTAATGCTGCGTATTGGGTTGGGTGGGTTTGAGATAGTAAGTGCAATCT Ec28_ # 20 (SEQ ID NO: 6) TGCGCTTGTAATGCTGCGTA Ec28_ # 34 (SEQ ID NO: 7) CAATTTTGCGCTTGTAATGCTGCGTATTGGGTTG Ec28_ # 40 (SEQ ID NO: 8) TTGCGCTTGTAATGCTGCGTATTGGGTTGGGTGGGTTTG

Example  4: Biotin - pull down pull down ) Assay method, which specifically binds to E. coli cells RNA Abtamer's  Verification

The binding affinity of E. coli Ec3 and Ec28 typhimurium groups to E. coli was confirmed by biotin-pulldown assay. RNA was incubated with biotin-modified down primer at 95 ° C for 5 min; 30 minutes at 37 占 폚; And annealing at 4 < 0 > C for 30 seconds. The biotin-modified down-primer and annealed RNA were reacted with streptavidin-magnetic beads in binding buffer for 1 hour. The RNA and the magnetic beads were allowed to react with the E. coli in binding buffer for 30 minutes. And washed three times in a magnetic stand with washing buffer. Then, magnetic beads were added to 10 ml of LB medium and the OD ₆₀₀ value was measured with time. The results are shown in Fig.

The As can be seen in the 3, modified by biotin N ₄₀ library, Ec3 and Ec28 pressure to Tamer group pull-down (pull down) observation of a culture plate in which Escherichia coli as a UV-Vis spectroscopy, Ec3 and Ec28 aptamer group N _{40 < / RTI >} library of E. coli cells (FIG. 3A). The amount of the grown E. coli cells, compared to the N ₄₀ library by Ec3 aptamer groups and were respectively 2.94 times and 2.44 times measured in Ec28 aptamer group (FIG. 3b), which a high binding affinity for the E. coli Ec3 and Ec28 aptamer group It means to have.

Example  5: Fluorescence microscopy, which specifically binds to E. coli RNA Verification of

RNA was incubated with TAMRA-modified down-primer at 95 ° C for 5 min; 30 minutes at 37 占 폚; And annealing at 4 DEG C for 30 seconds. After the E. coli 10 ⁸ washed with the washing buffer twice, and reacted for 15 minutes with the modified TAMRA- down primer and an RNA annealing at room temperature. The E. coli culture broth was washed twice with washing buffer, and cells were observed under a fluorescence microscope. The results are shown in FIG.

4, the result is confirmed through a fluorescent microscope when the TAMRA- the binding patterns to E. coli strain Ec3 and Ec28 aptamer group OD ₆₀₀ value of 0.3 (Figure 4a), respectively, and 0.8 (Figure 4b). As a result of observing the binding pattern of the N ₄₀ library to the Escherichia coli of the Ec3 and Ec28 tympanic groups, it was confirmed that the Ec3 and Ec28 tympanic groups were more bound to the Escherichia coli than the N ₄₀ library. Also, it was confirmed that the binding affinity of Ec3 and Ec28 plastomer groups was higher for E. coli grown through binding more than 0.8 when OD ₆₀₀ value was 0.3.

Through the above experiment results, Ec3 and Ec28 aptamer group Escherichia coli was confirmed that it has a specific binding affinity, OD ₆₀₀ value the more the increased binding affinity is increased.

Example  6: specifically binding to E. coli RNA Abtamer's  optimization

The secondary structure and binding affinity of cleaved sequences formed from the Ec3 and Ec28 typing groups were confirmed using RT-qPCR. The results are shown in Fig.

As shown in FIG. 5, the truncated sequences may be obtained by fixing the loop structure region, by changing the length of the stem structure region, or by leaving only the random sequence region (Fig. 5A).

And through the RT-qPCR, N ₄₀ library and Ec3 and Ec28 the binding to the Escherichia coli of a truncated sequences affinity as a result Ec3 (31) and Ec28 (20) measuring formed from aptamer group is compared with the N ₄₀ libraries respectively 9.46 Fold and 4.10 times the highest binding affinity among the groups (Fig. 5B).

By measuring the binding affinities of the truncated RNA abundance sequences of various lengths, a platamer with a higher binding affinity and shorter length was obtained.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it will be understood by those skilled in the art that various changes and modifications may be made without departing from the spirit and scope of the invention as defined in the appended claims. It will be obvious. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

<110> AGENT FOR DEFENSE DEVELOPMENT <120> Nucleic Acid Aptamer Specifically Binding to E. coli and Uses          Thereof <130> PT20130761 <160> 12 <170> Kopatentin 2.0 <210> 1 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> Ec3 <400> 1 ataccagctt attcaattgc acgaatttgc tgtgtttttg ggggggtcgg ggagtataag 60 atagtaagtg caatct 76 <210> 2 <211> 31 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > Ec3_ # 31 <400> 2 ttcaattgca cgaatttgct gtgtttttgg g 31 <210> 3 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> Ec3_ # 47 <400> 3 ccagcttatt caattgcacg aatttgctgt gtttttgggg gggtcgg 47 <210> 4 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Ec3_ # 40 <400> 4 gcacgaattt gctgtgtttt tgggggggtc ggggagtata 40 <210> 5 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Ec28 <400> 5 ataccagctt attcaatttt gcgcttgtaa tgctgcgtat tgggttgggt gggtttgaga 60 tagtaagtgc aatct 75 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Ec28_ # 20 <400> 6 tgcgcttgta atgctgcgta 20 <210> 7 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Ec28_ # 34 <400> 7 caattttgcg cttgtaatgc tgcgtattgg gttg 34 <210> 8 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Ec28_ # 40 <400> 8 ttgcgcttgt aatgctgcgt attgggttgg gtgggtttg 39 <210> 9 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> N40 Random Sequence <400> 9 ataccagctt attcaattnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnag 60 atagtaagtg caatct 76 <210> 10 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> N40 Random Sequence_Forward region <400> 10 ataccagctt attcaatt 18 <210> 11 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> N40 Random Sequence_End region <400> 11 agatagtaag tgcaatct 18 <210> 12 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> N40 down primer <400> 12 agattgcact tactatct 18

Claims (16)

Wherein the nucleic acid aptamer is any nucleic acid aptamer selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 4, wherein the nucleic acid aptamer specifically binds to the surface of Escherichia coli . 2. The nucleic acid amplimer according to claim 1, wherein the nucleic acid &lt; RTI ID = 0.0 &gt; 2. The nucleic acid amplimer according to claim 1, wherein the nucleic acid amplimer is a modified nucleotide analogue of at least one nucleotide. 4. The nucleic acid construct according to claim 3, wherein the modified nucleotide analogue is a nucleotide analogue wherein the nucleotide at the 2 'position of the ribosome of the nucleotide is substituted by a hydrogen atom, a fluorine atom, an -O-alkyl group, Tamer. A method for producing Escherichia coli comprising the nucleic acid plasmid according to any one of claims 1 to 4 as an active ingredient coli) detecting composition. 6. The composition of claim 5, wherein the nucleic acid aptamer is a conjugated nucleic acid complex. 7. The composition of claim 6, wherein the detecting moiety is a fluorescent dye. 6. The composition of claim 5, wherein the composition is adapted for the diagnosis of E. coli -induced disease. 9. The method of claim 8, wherein the E. coli-induced disease is selected from the group consisting of bacterial-induced gastroenteritis, urinary tract infection, neonatal meningitis, hemolytic uremic syndrome (HUS), peritonitis, - benign pneumonia, hemorrhagic colitis (HC), secretory diarrhea associated with inflammation or inflammation, or food poisoning. A method for producing Escherichia coli comprising the nucleic acid plasmid according to any one of claims 1 to 4 as an active ingredient coli detection kit. A method for producing Escherichia coli comprising the nucleic acid plasmid according to any one of claims 1 to 4 as an active ingredient coli) detection sensor. A method for producing Escherichia coli in a sample comprising the steps of: E. coli )
(a) contacting a sample with a nucleic acid plasmid according to any one of claims 1 to 4; And
(b) detecting the presence or absence of E. coli in the reaction product of step (a). 13. The detection method according to claim 12, wherein the sample of step (a) is a biological sample, a natural product or a food. 13. The detection method according to claim 12, wherein the nucleic acid amplimer of step (a) is a fluorescent dye-conjugated nucleic acid plasmid. 13. The detection method according to claim 12, wherein the detection of step (b) is carried out through detection of fluorescence derived from a nucleic acid plasmid bound to E. coli. 13. The detection method according to claim 12, wherein the detection of step (b) is carried out through gene amplification to a nucleic acid plasmid bound to E. coli.

Images