KR101648342B1 - -12 -12 helicobacter pylori -12 fucosyltransferase gene and protein with improved soluble protein expression and thereof application for synthesis of -12 fucosyloligosaccharide - Google Patents

Abstract

The invention Helicobacter pylori 26695 (Helicobacter pylori 26695) derived from the α-1,2 Foucault room transferase (α-1,2 fucosyltransferase) of the random firing overt recombinant proteins soluble and therefore how the α-1,2 fucose transferase room created as a result of increasing the protein expression of the A method for expressing the gene, a protein, and the synthesis of? -1,2 fucosyl oligosaccharides using the enzyme.

Description

1,2-fucosyltransferase-derived genes, proteins and α-1,2 fucosyl oligosaccharides derived from Helicobacter pylori increased in soluble protein expression levels {HELICOBACTER PYLORI α-1,2 FUCOSYLTRANSFERASE GENE AND PROTEIN WITH IMPROVED SOLUBLE PROTEIN EXPRESSION, AND THEREOF APPLICATION FOR SYNTHESIS OF α-1,2 FUCOSYLOLIGOSACCHARIDE}

The present invention relates to an enzyme engineering through an increase in soluble protein expression and protein engineering mutation of a helminthic recombinant protein of a-1,2 fucosyltransferase derived from Helicobacter pylori, and relates to an enzyme engineering method of encoding an active type fucosyltransferase The present invention relates to an optimized gene and an expression vector containing it, a method for expressing the gene, and an α-1,2 fucosyltransferase having an improved soluble protein expression.

Breast milk not only provides essential nutrients for infants, but also provides a variety of health benefits beyond the concept of simple nutrients. Milk oligosaccharide is composed of functional ingredients and contains oligosaccharides 5-10 g per liter, 100-200 times more than milk, and more than 130 kinds of milk oligosaccharides have been identified so far. Unlike milk, the content and structural diversity of these oligosaccharides are very specific to breast milk. Among the milk oligosaccharides, fucosyl oligosaccharides are contained in less than 1% of milk, while milk is present in a large amount of about 50 to 80%. In particular, 2'-fucosyllactose, which has a lactose at the reducing end and is linked to galactose by α-1,2 linkages to fucose, is not present in milk, It contains about 2.6 g / L.

First, the prebiotics of lactose-derived fucosyl oligosaccharides in the body promote the growth of beneficial microorganisms such as Lactobacillus and Bifidobacteria, while those of Clostridium and Bifidobacteria It plays a role to prevent the growth of harmful pathogens. This is due to bifidobacteria, which can use short chain fucosyl oligosaccharides as a carbon source. By maintaining the balance of useful microorganism strains, it is possible to prevent or treat diseases such as treatment and prevention of infectious diseases, anticancer action, stimulation of host immune function, Has been studied as having efficacy in promotion.

Secondly, fucosyl oligosaccharides have been studied as inhibitors to prevent attachment of host cells to the intestinal epithelium surface during the initial infection process of noxious bacteria or viruses. 2'-fucosyllactose (Fuc (α-1,2) Galβ1,4Glc) is effective against infant diarrhea caused by Campylobacter jejuni, Helicobacter pylori, Enterotoxigenic E can be a recognition agent for the receptors of Salmonella typhimurium, Clostridium perfringens and norovirus that cause food poisoning and compete to inhibit their invasion can do. A variety of milk-derived fucosyl oligosaccharides including 2'-fucosyllactose serving as such can be applied to various industrial applications such as infant foods and functional foods as well as medicines.

However, milk-oligosaccharides have a disadvantage in that they can not be mass-produced when they are extracted from colostrum. In case of chemical compatibility of fucosyl oligosaccharides, complicated protection-deprotection is required for controlling the oligosaccharide stereostructure and maintaining selectivity. It is difficult to develop a generalized process in the food or pharmaceutical industry due to the necessity of using a toxic reagent.

In this respect, biotechnologically synthesized technology has been recognized as the best alternative for the production of oligosaccharides on an economic scale. The biosynthetic process of fucosyl oligosaccharide requires a very expensive substrate called guanosine 5'-diphosphate fucose (GDP-fuc), which is a donor of fucose, so guanosine 5'- Studies have been conducted to produce fucosyl oligosaccharides from fucosyltransferases by producing guanosine 5'-phosphate-fucose from GDP-mannose or fucose. The catalytic ability of the fucosyltransferase is very important for efficiently transferring fucose from the fucosyl donor guanosine 5'-phosphate-fucose to the receptor substrate.

The α-1,2 fucosyltransferase used in the present invention is an enzyme that transfers fucose by α-1,2 bond to the carbon number 2 of galactose. It originated from Helicobacter pylori 26695 strain and was obtained from Diane E The first was cloned by the Taylor group [Wang G., Molecular genetic basis for the expression of Lewis Y antigen in Helicobacter pylori: analysis of the alpha (1,2) fucosyltransferase gene, Molecular Microbiol ogy, 1999, Vol.31, 1265p]. This α-1,2 fucosyltransferase enzyme was then identified by the Eric Samain group in 2006 as a group of 14 cytosines that could cause frame shifts in the expression of enzymes by another 12 nucleotides ), And revealed substrate activity against lacto-N-tetraose and lactose [Sophie Drouillard, Large-scale synthesis of H-antigen oligosaccharides by expressing Helicobacter pylori α1,2-fucosyltransferase in metabolically engineered Escherichia coli cells, Angewandte Chemie , 2006, Vol. 45, 1778 p].

In order to increase the production efficiency of various α-1,2 fucosyl oligosaccharides including milk-derived fucosyl oligosaccharides having α-1,2 bonds, efficient enzymatic activity of the α-1,2 fucosyltransferase described above is very important , And their inventions were applied to the production of fucosyl oligosaccharides.

In order to synthesize fucosyl oligosaccharides, in vivo and in vitro reactions using guanosine 5'-phosphorus-fucose donor, which is a donor of fucose, and fucosyltransferase expression were simultaneously carried out come. The guanosine 5'-diphosphate-fucose, which is a fucosyltransferase fucose donor, is produced by FKP (L-fucokinase / GDP-fucose pyrophosphorylase) enzyme having two enzymatic activities of the salvage pathway - fucose, from which fucosyl transferase can transfer fucose to a receptor (e.g., lactose). In the in vitro ex vivo reaction using the α-1,2 fucosyltransferase derived from Helicobacter pylori 26695, the FKP enzyme has a relatively higher soluble protein expression level and enzyme activity in E. coli than the α-1,2 fucosyltransferase It was confirmed that the fucosyltransferase reaction itself was a rate determining step in this reaction. In order to increase the fucosyl transfer reaction, which is the rate determining step, it is very necessary to express the soluble protein and increase the enzyme activity of the? -1,2 fucosyltransferase in E. coli.

On the other hand, the α-1,2 fucosyltransferase derived from Helicobacter pylori has a low expression amount of total protein and soluble protein in Escherichia coli so that the fucosyltransfer reaction in the in vivo and in vitro reactions has been difficult. In the case of α-1,2 fucosyltransferase, it was confirmed that the truncated form of the protein was expressed due to the frame shift, which was prevented by the gene sequence conversion in the Eric Samain group and the low soluble protein expression level in E. coli (Tyr) and T7 (Tyr), and the fusion proteins such as thioredoxin and GST were tried to be expressed together. However, the activity of the enzyme was very weak and the expression of the fusion protein was rather active. The enzyme activity was 0.13 nmol / min / mg for the lacto-N-tetraose substrate without the fusion protein [Sophie Drouillard, H-antigen oligosaccharides by expressing Helicobacter pylori α1,2- fucosyltransferase in metabolically engineered Escherichia coli cells, Angewandte Chemie , 2006, Vol. 45, 1778 p]. In addition, Endo and Tetsuo have attempted to produce 2'-fucosyllactose, a milk oligosaccharide, by replacing the 2'-fucosyltransferase gene with a frequently used codon sequence in bacteria, In order to obtain a yield higher than the gram (g), there is a disadvantage that a reaction time of 24 to 48 hours or more is required [WO 01/046400].

In order to industrially mass-produce? -1,2 fucosyl oligosaccharides in vivo or in vitro, it is necessary to increase the amount of soluble protein and increase the enzyme activity in terms of increase in yield and productivity. However, due to the low amount of soluble protein expressed to date, it is difficult to apply effective screening method when performing enzymatic engineering and there is no crystal structure revealed by α-1,2 fucosyltransferase, so enzyme engineering through protein engineering mutation No attempt has been made.

The present invention relates to a method for producing an α-1,2 fucosyl oligosaccharide by producing a mutant of an α-1,2 fucosyltransferase having increased amount of soluble protein through base sequence substitution and protein engineering mutation, α-1,2 fucosyl oligosaccharide production to increase yield and productivity.

It is an object of the present invention to provide a mutant of α-1,2 fucosyltransferase and α-1,2 fucosyltransferase having optimized nucleotide sequences and to produce α-1,2 fucosyl oligosaccharides efficiently will be.

It is also an object of the present invention to improve the productivity and efficiency of? -1,2 fucosyl oligosaccharides through chaperone expression, introduction of fusion proteins, and optimization of reaction conditions.

In addition, the object of the present invention is to provide a method for the protein engineering variation of α-1,2 fucosyltransferase, which comprises the steps of protein structure modeling, alanine scanning and substrate docking, To select candidate amino acid substitutions.

The present invention provides optimized gene sequence information encoding an active type of alpha-1,2 fucosyltransferase with increased soluble protein expression.

In addition, a recombinant DNA vector containing an optimized gene encoding an active-type? -1,2 fucosyltransferase, a DNA encoding a fusion protein in front of the DNA encoding the? -1,2 fucosyltransferase is located And a spacer comprising 3 to 60 nucleotides between the DNA encoding the gene of the? -1,2 fucosyltransferase and the DNA encoding the fusion protein. To provide a host cell transformed with a DNA vector.

Also provided is a recombinant DNA vector in which the solubility of a protein is increased by introducing a fusion protein into a fucosyltransferase having an increased expression amount, and a method for effectively expressing the gene.

The present invention also provides a method for increasing the solubility of a protein through simultaneous expression with a chaperone in a fucosyltransferase having an increased expression amount and a method for effectively expressing the gene.

In the present invention, the mutant of SEQ ID NO: 6 in which a single amino acid is changed with respect to the a-1, 2 fucosyltransferase having increased soluble protein, the DNA sequence information encoding the same, a recombinant DNA vector containing the mutant and the recombinant DNA vector Lt; RTI ID = 0.0 > transfected < / RTI >

In addition, the present invention provides the production of? -1,2 fucosyl oligosaccharides using? -1,2 fucosyltransferase.

The present invention also provides a mutation using a substrate binding-model structure through protein structure modeling, alanine scanning, and substrate structure docking for protein engineering mutation of? -1,2 fucosyltransferase Provides candidate amino acid selection methods.

Specifically, the present invention provides the following.

The present invention provides a DNA encoding α-1,2 fucosyltransferase having a homology of at least 88% with that of SEQ ID NO: 1, comprising a recombinant DNA vector comprising the DNA, a host cell transformed with a recombinant DNA vector , And extracts of host cells.

The recombinant DNA vector is characterized in that a DNA encoding a fusion protein is located in front of the DNA encoding the α-1,2 fucosyltransferase, and a recombinant DNA vector encoding a gene encoding the α-1,2 fucosyltransferase And a spacer comprising 6 to 30 nucleotides between the DNA and the DNA encoding the fusion protein.

Also provided are transformed host cells and extracts of host cells, which are transformed with said vectors.

Also provided are transformed host cells, and extracts of host cells, characterized in that the recombinant DNA vector encoding the chaperone protein is further transformed.

Further, there is provided an α-1,2 fucosyltransferase mutant wherein the 249th amino acid of the α-1,2 fucosyltransferase represented by SEQ ID NO: 2 is replaced with another amino acid, wherein the substituted amino acid is tyrosine ), Which is represented by the amino acid sequence of SEQ ID NO: 6, and provides the DNA of SEQ ID NO: 7, which encodes the amino acid sequence of SEQ ID NO: 6. A DNA vector comprising the DNA represented by SEQ ID NO: 7, and an extract of a host cell or host cell transformed with the DNA vector.

Also, the polypeptide of the? -1,2 fucosyltransferase expressed from the transformed host cell of the present invention, the polypeptide of the α-1,2 fucosyltransferase mutant of the present invention, or the α-1 And a peptide linker consisting of 5 to 20 amino acids followed by a polypeptide of 2 fucosyltransferase variants.

Further, it is characterized by using a host cell transformed with a vector containing a DNA encoding an alpha-1,2 fucosyltransferase or an extract of the host cell as a biocatalyst, having a homology of not less than 88% with that of SEQ ID NO: Of the? -Fucosyl oligosaccharide of the present invention.

In the above production method, the vector may be introduced with a DNA encoding a fusion protein in advance of the DNA encoding the alpha-1,2 fucosyltransferase, wherein the DNA encoding the fusion protein is present at a temperature of 15 to 38 DEG C in an amount of 0.005 mM to 5 mM inducer can be used.

In addition, in the above production method, the host cell may further be transformed with a recombinant DNA vector encoding a chaperone protein. In this case, an inducer of 0.001 mM to 2 mM at a temperature of 10 to 35 ° C Can be used.

In the above production method, the concentration of the sugar receptor substrate can be used at a concentration of guanosine 5'-diphosphate fucose (GDP-fuc) substrate or higher, which is a donor of fucose.

The present invention also provides a method for searching for an alpha-1,2 fucosyltransferase mutant comprising the following steps.

(1) a residue selected from the aspartate 115 (D115) of the crystal structure or model structure of the? -1,2 fucosyltransferase within 5 to 10 A, or a substrate binding model of the? -1,2 fucosyltransferase Analyzing a functional residue to perform a saturation mutation through multiple sequence alignment and alanine scanning, in a selected moiety within 5 to 10 A from the site where the receptor substrate binds from the structure,

(2) Performing a colorimetric method using a pH indicator.

The α-1,2 fucosyltransferase having an improved amount of the soluble protein of the present invention can be applied not only to 2'-fucosyllactose, which is a milk-derived oligosaccharide, but also to various high-value-added α-1,2 fucosyl oligosaccharides have.

Specifically, the amount of the soluble protein can be increased by using the mutant of the α-1,2 fucosyltransferase and the α-1,2 fucosyltransferase that have been subjected to the nucleotide sequence optimization of the present invention, and the amount of the milk-derived oligosaccharide 2 '- fucosyllactose as well as various high-value-added?-1,2 fucosyl oligosaccharides. The method of producing? -1,2 fucosyl oligosaccharides of the present invention significantly increases the production yield and productivity of? -1,2 fucosyl oligosaccharides, thereby making it possible to reduce production costs and obtain high added value due to the products.

Further, since the amount of soluble protein of α-1,2 fucosyltransferase has been dramatically increased, screening after enzyme mutation using protein engineering has become possible, and crystal structure of α-1,2 fucosyltransferase ) And α-1,2 fucosyl transferase.

Accordingly, the present invention can be applied to a variety of fields such as infant foods, health supplement additives, therapeutic agents, cosmetics, medicines, and diagnostics through mass production of the α-1,2 fucosyl oligosaccharides.

Figure 1 is a one-port reaction schematic diagram of the synthesis of 2'-fucosyl oligosaccharides using FKP and 2'-fucosyltransferase with ATP, GTP and receptor substrates from L-fucose.
FIG. 2 shows SDS-PAGE of an .alpha.-1,2 fucosyltransferase enzyme extract in which total protein expression amount and soluble protein are increased through nucleotide sequence optimization and simultaneous expression with chaperonin in the present invention. T represents the total protein fraction after cell lysis and S represents soluble protein. FIG. 2 (a) shows the amount of protein expressed in the original α-1,2 fucosyltransferase and the α-1,2 fucosyltransferase after base sequence optimization, and (b) Lt; RTI ID = 0.0 > IPTG < / RTI >
FIG. 3 is a graph showing SDS-PAGE of the amount of protein expressed in the cell extracts of various fusion proteins expressed before the optimized base sequence in the present invention. The arrow indicates the protein size of the α-1,2 fucosyltransferase expressed with the fusion protein.
FIG. 4 shows the yield (%) and yield (g / L) of producing 2'-fucosyllactose from guanosine 5'-phosphate-fucose substrate according to nucleotide sequence optimization, simultaneous expression with chaperon, . In addition, the optimization of nucleotide sequence and introduction of fusion protein (Optimized 2'FT + fusion protein + Rxn optimization) were performed together with optimization of reaction to increase production yield and productivity.
FIG. 5 shows the results of simultaneous expression with chaperone and the yields of 2'-fucosyllactose in the one-port reaction using ATP, GTP, MnSO ₄ as a substrate together with FKP enzyme from L-fucose substrate according to fusion protein expression (%) And production (g / L). In addition, the introduction of the fusion protein and the optimization of the reaction (Optimized 2'FT + fusion protein + Rxn optimization) were performed together with optimization of reaction yield (receptor substrate concentration and buffer solution optimization) to increase production yield and productivity.
FIG. 6 shows SDS-PAGE of total protein and soluble protein yields of S249Y, a single amino acid substitution mutant searched in the present invention, and wild-type cell extracts.

The term used in the present invention is commonly used in the art and anyone skilled in the art can understand the meaning thereof, but here is briefly described as follows:

(1) Fucosyltransferase refers to an enzyme that transfers guanosine 5'-phosphate from a sugar donor phosphoric acid-fucose to a sugar receptor substance.

Unless otherwise specified in the specification of the present invention, 'α-1,2 fucosyltransferase' is an enzyme which transfers fucose to α-1,2 bond to the carbon 2 of galactose. Means a protein having an alpha -1,2 fucosyltransferase activity derived from DNA having a homology of 88% or more with the nucleotide sequence 1 of the present invention.

(2) Lactose, one of the receptor substrates, is an oligosaccharide composed of Galβ1, 4Glc (galactose and glucose linked by a β1,4 bond).

(3) 2'-fucosyl oligosaccharide means an oligosaccharide in which fucose is linked to a galactose moiety by an alpha-1,2 bond, and another sugar is further bonded to galactose.

(4) 2'-fucosyllactose means a triose substance composed of (Fuc (α-1,2) Galβ1, 4Glc) (fucose is linked to galactose of lactose by α-1,2 bond) do.

(5) "Transfection" means introducing DNA as a host and allowing the DNA to replicate as an extrachromosomal factor or by chromosomal integration.

(6) The cell extract means the microorganism extract of the present invention in which the fucosyltransferase is expressed.

(7) The reaction using a cell extract means a reaction using whole cell without disrupting or using the cell contents by disrupting cells containing a specific enzyme.

(8) The codon optimization of a protein is to change the nucleotide sequence encoding the amino acid sequence without changing the amino acid sequence. Usually, codon optimization is used to increase the frequency of codon usage, GC sequence%, formation of RNA secondary structure, elimination of repetitive sequences, preference of tRNA, etc. , It is not limited to any one principle.

(9) Small-sized amino acids are amino acids with small functional groups and include glycine, alanine, serine, threonine, and cystein.

(10) Fusion protein means a protein used by fusing to the N-terminal of a desired protein to induce correct folding of the desired protein, and there is no limitation on the type of fusion protein.

(11) PCR is a Polymerase Chain Reaction (PCR), which means a method of specifically amplifying a certain region of DNA.

(12) Saturation mutagenesis refers to the introduction of changes in various base sequences at designated positions in a gene. A saturation mutation refers to inserting a mutation through PCR by inserting an NNK codon in place of a sequence to be mutated on a primer of a complementary sequence binding to a template strand. In this case, N in the NNK codon means A, T, G and C of the nucleotide, and K means T and G in the NNK codon.

(13) Vector means a polynucleotide consisting of a single strand, a double strand, a circular or super helical DNA or RNA, and may contain components operatively connected at appropriate distances to produce a recombinant protein.

Such components may include a replication origin, a promoter, an enhancer, a 5'mRNA leader sequence, a ribosome binding site, a nucleic acid cassette, a termination and a polyadenylation site, or a selectable marker form, One or more may be missed. The nucleic acid cassette may contain a restriction enzyme site for insertion of a recombinant protein to be expressed. In a functional vector, a nucleic acid cassette contains a nucleic acid sequence to be expressed containing a translation initiation site and a termination site. If necessary, a vector capable of inserting two kinds of cassettes into a vector may be used. Lt; / RTI >

(14) The gene inserted into the recombinant vector can be used for expressing E. coli strains BW25113 (DE3), BL21 (DE3), etc., but it may be different depending on the type of the inserted vector. Such vectors and expression strains can be readily selected by those skilled in the art.

(15) The pH indicator is used mainly for determining the neutralization point while titrating, or for determining the concentration of hydrogen ion. The indicator is an acid type and a base type according to the hydrogen ion index, and the color tone is different, and this region is called a discoloring region. The concentration of hydrogen ions can be measured according to the absorbance by spectrophotometry.

(16) Specific activity refers to activity per unit amount of pure protein from which impurities and other proteins have been removed through purification of the enzyme. It is usually 1 mg per 1 mg of enzyme which catalyzes 1 μmol of substrate change per minute It is expressed in units.

Hereinafter, the present invention will be described in more detail.

The present invention provides DNA encoding α-1,2 fucosyltransferase having homology of at least 88% with SEQ ID NO: 1.

The DNA represented by SEQ ID NO: 1 can be obtained from SEQ ID NO: 3, which replaces 12 nucleotides of DNA encoding the amino acid sequence (SEQ ID NO: 2) of the? -1,2 fucosyltransferase from Helicobacter pylori 26695, . ≪ / RTI > The obtained DNA of SEQ ID NO: 1 and the DNA of SEQ ID NO: 3 have a homology of 87%. The optimized SEQ ID NO: 1 of the present invention is more effective than the SEQ ID NO: 3 in the overall protein expression.

The present invention provides a recombinant DNA vector comprising the DNA encoding the? -1,2 fucosyltransferase.

In the recombinant DNA vector, a DNA encoding a fusion protein may be located in front of the DNA encoding the alpha-1,2 fucosyltransferase (N-terminal). Fusion protein refers to a protein used by fusing to the N-terminus of a desired protein to induce correct folding of a desired protein. Examples of the fusion protein include F-ePGK, N-ePGK, ArsC, GMPK, ACK, and the like, but are not limited thereto.

a spacer comprising a nucleotide may be provided between the DNA encoding the gene of the? -1,2 fucosyltransferase and the DNA encoding the fusion protein, and the spacer may include a sequence recognizing the restriction enzyme.

The spacer means a DNA sequence between genes, and the nucleotide of the spacer is preferably 3 to 60, more preferably 3 to 45, most preferably 6 to 30 nucleotides.

The present invention provides a host cell transformed with the recombinant DNA vector and a cell extract of the host cell.

The host cell may be additionally transfected with a recombinant DNA vector encoding a chaperone protein. The DNA encoding the chaperone protein may be contained in the same vector as the DNA encoding the alpha-1,2 fucosyltransferase or may be contained in a different vector, respectively, and when it is contained in a different vector, And can be sequentially transformed.

The chaperone may be a chaperone including, but not limited to, dnaK-dnaJ-grpE, trigger factor. As one embodiment of the present invention, a GroEL / GroES chaperone was used.

The cell extract means the microorganism extract of the present invention in which the fucosyltransferase is expressed.

The present invention provides an? -1,2 fucosyltransferase mutant wherein the 249th amino acid of the? -1,2 fucosyltransferase represented by SEQ ID NO: 2 is substituted with another amino acid other than serine .

The 249th amino acid of the mutant may be substituted with any amino acid, and preferably the substituted amino acid is tyrosine (Y). The amino acid sequence substituted with tyrosine is shown in SEQ ID NO: 6, and the DNA encoding the same is shown in SEQ ID NO: Due to the substitution of the amino acid sequence of SEQ ID NO: 249, the fucosyltransferase soluble protein is increased.

The present invention provides a recombinant vector comprising the DNA of SEQ ID NO: 7, a host cell transformed with the recombinant vector comprising the DNA of SEQ ID NO: 7, and an extract of the host cell, which encode the alpha-1,2 fucosyltransferase mutant .

The present invention provides a peptide linker consisting of an amino acid behind a polypeptide of an alpha-1,2 fucosyltransferase. The linker is preferably a small or flexible amino acid, more preferably a glycine, an alanine, a serine, a threonine, and a cystein. ≪ / RTI > The amino acid of the peptide linker is preferably 2 to 40 amino acid residues, more preferably 4 to 30 amino acid residues, and most preferably 5 to 20 amino acid residues.

Through the linkage of the peptide linker, a vector containing an alpha-1,2 fucosyltransferase-peptide linker-tag gene can be produced. A tag can be used for enzyme purification using affinity chromatography, and a preferable tag can be selected by a person skilled in the art. The tag may include both a peptide tag and a protein tag, and a histidine tag is used as an embodiment of the present invention. Using the vector containing the linker tag gene, it is possible to purify the soluble protein of the? -1,2 fucosyltransferase to a high purity.

The present invention relates to a host cell transformed with a vector containing a DNA encoding an alpha-1,2 fucosyltransferase or an extract of the host cell having a homology of at least 88% with SEQ ID NO: 1 as a biocatalyst 2-fucosyl oligosaccharide of the present invention.

The vector used in the above production method may be introduced with a DNA encoding a fusion protein in advance of the DNA encoding the alpha -1,2 fucosyltransferase.

A spacer between the DNA encoding the gene of the? -1,2 fucosyltransferase and the DNA encoding the fusion protein may have a nucleotide, and the spacer may include a sequence recognizing the restriction enzyme. The nucleotides of the spacer are preferably 3 to 60, more preferably 3 to 45, and most preferably 6 to 30 nucleotides.

When the DNA encoding the fusion protein is introduced, an inducer of 0.005 mM to 5 mM is preferably used at a temperature of 15 ° C to 38 ° C, more preferably 0.01 mM to 3 mM, and most preferably from 0.1 mM to 1 mM at a temperature of from 18 [deg.] C to 37 [deg.] C. When the above condition is satisfied, there is an excellent effect that the soluble protein expression amount of? -1,2 fucosyltransferase is increased.

D-1-thiogalactopyranoside (IPTG) is used when the lac operon is used, arabinose and trp (arabinose) are used when the ara operon is used, When an oprene is used, indoleacrylic acid and the like may be used, but the present invention is not limited thereto.

The host cell used in the above production method can additionally be transduced with a recombinant DNA vector encoding a chaperone protein. The DNA encoding the chaperone protein may be contained in the same vector as the DNA encoding the alpha-1,2 fucosyltransferase or may be contained in a different vector, respectively, and when it is contained in a different vector, And can be sequentially transformed.

When the recombinant DNA vector encoding the chaperone protein is additionally transduced into the host cell, it is preferable to use induction factors of 0.001 mM to 2 mM at a temperature of from 10 캜 to 35 캜, more preferably from 12 캜 to 30 0.01 to 0.5 mM of the inducer may be used at a temperature of 15 to 25 DEG C, most preferably 15 to 25 DEG C. When the above condition is satisfied, there is an excellent effect that the soluble protein expression amount of? -1,2 fucosyltransferase is increased.

D-1-thiogalactopyranoside (IPTG) is used when the lac operon is used, arabinose and trp (arabinose) are used when the ara operon is used, When an oprene is used, indoleacrylic acid and the like may be used, but the present invention is not limited thereto.

The present invention relates to a method for the treatment and / or prophylaxis of diseases or conditions associated with α-1 (1), wherein the concentration of the receptor substrate is used at a concentration of guanosine 5'-diphosphate fucose (GDP-fuc) , 2 fucosyl oligosaccharides. The concentration of the receptor substrate is 1.1 to 20 times, preferably 1.5 to 10 times, more preferably 2 to 5 times the concentration of guanosine 5'-phosphate-fucose.

The sugar receptor substrate means a sugar substrate capable of receiving fucose by an alpha-1,2 fucosyltransferase, and examples thereof include, but are not limited to, galactose or lactose.

The present invention provides a method for searching an? -1,2 fucosyltransferase mutant comprising the following steps.

(1) a residue selected from the aspartate 115 (D115) of the crystal structure or model structure of the? -1,2 fucosyltransferase within 5 to 10 A, or a substrate binding model of the? -1,2 fucosyltransferase Analyzing a functional moiety that will perform a saturation mutation through multiple sequence alignment and alanine scanning in a selected moiety within 5-10 A from the site where the receptor substrate binds from the structure,

(2) Performing a colorimetric method using a pH indicator.

It will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the spirit or scope of the invention as defined by the appended claims. It will be obvious to you.

Foucault  Sequence optimization of transport enzymes

In the present invention, among the candidates of prokaryotic-derived α-1,2 fucosyltransferase, α-1,2 fucosyl oligosaccharides were synthesized by measuring the activity of α-1,2 fucosyl oligosaccharides from H. influenzae 26695 having the amino acid sequence of SEQ ID NO: 1,2 fucosyl transferase was selected. This α-1,2 fucosyltransferase was synthesized by the Eric Samain group [Sophie Drouillard, Large-scale synthesis of H-antigen oligosaccharides by expressing Helicobacter pylori α1,2-fucosyltransferase in metabolically engineered Escherichia coli cells, Angewandte The 14 cytosine bases that can cause frame shift in the translation of mRNA in the expression of the enzyme as described by Chemie , 2006, Vol. 45, Lt; / RTI > nucleotides (SEQ ID NO: 3). However, despite the fact that the temperature and the concentration of IPTG (isopropyl beta-D-1-thiogalactopyranoside) were controlled, the total protein expression amount and soluble protein expression amount was very low as shown in FIG. 2 (a) In the production of fucosyllactose, it was confirmed that the fucose transfer reaction was a rate determining step.

In this case, the nucleotide sequence of SEQ ID NO: 3 was optimized by taking into account both codon usage, GC codon% and stable secondary structure formation of RNA using the "POMBE" program, and the nucleotide sequence of SEQ ID NO: 3 and 87% of the α-1,2 fucosyltransferase of SEQ ID NO: 1. The optimized nucleotide sequence 1 of the present invention is the nucleotide sequence of SEQ ID NO: 3 in the original nucleotide sequence 3 in a state where it is intact without deletion, substitution, or addition to the TAA-like repeating sequence and AAAAAAG sequence in which mutation or frame shift can occur And as shown in FIG. 2 (a), the total protein expression level was increased by 5 times as much as that of the nucleotide sequence 3 at a size of 33 kDa. In addition, the present invention may include a nucleotide sequence encoding a protein having an activity of an alpha-1,2 fucosyltransferase and having 88% or more homology with SEQ ID NO: 1 in addition to the optimized nucleotide sequence of SEQ ID NO: 1.

Foucault  Increase soluble protein expression of transferase

As a method for increasing the amount of soluble protein of? -1,2 fucosyltransferase having an increased total protein expression amount through the present invention, a method of expressing chaperone together and a method of introducing a fusion protein have been used .

In the present invention, a chaperon of GroEL / GroES is used as a specific example, but various chaperones including dnaK-dnaJ-grpE, trigger factor can be used. The vector containing SEQ ID NO: 1 and the vector containing GroEL / GroES were simultaneously transformed into BW25113 (DE3) strain and the expression temperature and the concentration of IPTG were controlled. As a result, as shown in FIG. 2 (b) When IPTG of 0.5 mM or less, preferably 0.1 mM or less, more preferably 0.01 mM or less, was used as an inducer, it was possible to produce more than 60% soluble protein with respect to the total protein amount. The yield of 2'-fucosyllactose production (%) was compared using 5 mM guanosine 5'-diphosphate-fucose, 2.5 mM lactose and 2.5 mM MgCl ₂ using cell extracts simultaneously expressing the chaperone As shown in FIG. 4, the yield was 24.7%, which is 3.2 times higher than the yield before the sequence optimization (7.7%).

Also, the present invention provides a method for increasing the amount of soluble protein of an? -1,2 fucosyltransferase having an increased total protein expression amount, wherein the N-terminal of the? -1,2 fucosyltransferase encoded by SEQ ID NO: Lt; / RTI > The α-1,2 fucosyltransferase of the present invention has a low probability that a protein will form a dimer as a result of protein structure modeling, and in particular, a structure capable of causing steric hindrance around the N- Therefore, the introduction of the fusion protein does not inhibit the activity of the enzyme.

Examples of fusion proteins used in the present invention include F-ePGK ( E. coli phosphoglycerate kinase, 40 kDa), N-ePGK ( E. coli phosphoglycerate kinase, N-domain of phosphoroglycerate phosphorylase , 21 kDa) [Korean Application No. 10-2012-0017666], ArsC (arsenate reductase, 16 kDa) [Jong-Am Song, A novel Escherichia coli solubility enhancer protein for fusion expression of aggregation-prone heterologous proteins, Enzyme and Microbial Technol ogy, 2011, Vol.49, 124p ], GMPK ( guanosine monophosphate kinase of Escherichia coli, guanosine monophosphate kinase, 23 kDa) , ACK ( acetate kinase of Escherichia coli, acetate kinase, 44 kDa), C30K9 ( silkworm derived Protein, 30 kDa) and GST (glutathione S-transferases, 25 kDa). However, the fusion protein that can be introduced into the N-terminus of the? -1,2 fucosyltransferase encoded by SEQ ID NO: 1 is not limited to the fusion proteins described above, and may be any fusion protein that can express the inherently soluble state and other fusion Proteins are also possible.

The gene coding for the fusion protein was followed by a spacer consisting of 6 to 30 nucleotides followed by a restriction enzyme site, followed by ligating the gene of SEQ ID NO: 1 and finally producing a recombinant DNA vector of SEQ ID NO: 1 to which the fusion protein was linked Respectively.

In the present invention, the obtained DNA vector was used to obtain an active α-1,2 fucosyltransferase having an increased amount of soluble protein. The vector was transformed into strain BW25113 (DE3), and the protein was expressed at a temperature of 18 ° C to 37 ° C using inducible factors of 0.1 mM to 1 mM. As shown in FIG. 3, It was confirmed that expression of 1,2 fucosyltransferase into soluble was induced.

All of the fusion proteins used in the present invention exhibited a high level of total protein expression and solubility when the fusion proteins were individually expressed, and when the fusion proteins and the proteins with the alpha-1,2 fucosyltransferase were expressed The fucosyltransferase activity of α-1,2 fucosyltransferase was slightly different and the size of the fusion protein and α-1,2 fucosyltransferase (F- ePGK: 73 kDa, N-ePGK: 54 kDa, ArsC: 49 kDa, GMPK: 56 kDa, ACK: 77 kDa, C30K9: 63 kDa, GST: 58 kDa). As shown in FIG. 3, the soluble protein expression level of the α-1,2 fucosyltransferase was increased before the use of the fusion protein except for the GST and C30K9 fusion proteins.

The activity of the α-1,2 fucosyltransferase to which the fusion protein was ligated was determined using a cell extract using 2 mM guanosine 5'-diphosphate-fucose, 2.5 mM lactose, 2.5 mM MgCl ₂ , The relative yields of fucosyllactose production were compared with those of soluble protein and the results were proportional. The yield of the fucosyllactose production reaction using the α-1,2 fucosyltransferase expressed together with the chaperone carried out in the present invention is similar to or higher than that of GMPK, ACK, ArsC, N-ePGK and F-ePGK 1,2 fucosyltransferase may be used. More preferably, an alpha-1,2 fucosyltransferase to which F-ePGK, N-ePGK and ArsC are fused may be used.

The amount of soluble protein expressed in the a- One ,2 Foucault  Transferase Fucosyllactose  production

Using the present invention, α-1,2 fucosyltransferase, which is an α-1,2 fucosyl oligosaccharide derived from milk, was produced using α-1,2 fucosyltransferase having increased amount of soluble protein. As described above, the yield of 2'-fucosyllactose production (%) was determined using 5 mM guanosine 5'-diphosphate-fucose, 2.5 mM lactose and 2.5 mM MgCl ₂ using cell extracts simultaneously expressing chaperone. As a result, as shown in FIG. 4, the yield was 24.7%, which is 3.2 times higher than the yield before the sequence optimization (7.7%). When the fusion protein is introduced at the N-terminus of the alpha-1,2 fucosyltransferase, the production yield of 2'-fucosyllactose is similar to that of coexpression with chaperone or from 1.4 to 2 times Respectively.

In the present invention, the reaction conditions were optimized to further increase the productivity and yield of 2'-fucosyllactose. The concentration of guanosine 5'-diphosphate-fucose as a donor substrate was fixed at 5 mM under a sodium phosphate buffer solution , And the reaction rate was doubled or more than that in the above reaction by increasing the concentration of the lactose, which is a receptor substrate, to 10 to 20 mM. This not only accelerates the reaction rate of the enzyme by increasing the concentration of the receptor substrate but also increases the yield of the relatively low lactose substrate relative to that of the phosphate-fucose substrate of guanosine 5'-2'-fucosyl Thereby enabling economic production of lactose. When 2'-fucosyllactose was produced by introducing the above-mentioned optimized method using a cell extract of cells producing α-1,2 fucosyltransferase to which F-ePGK was linked among the fusion proteins, Similarly, the yield of 2'-fucosyllactose was improved to 90%, and 2.2 g / L of 2'-fucosyllactose was produced. Productivity (g / L / h) was also reduced from 3 hours to 12 hours, which was 14 times higher than 0.05 g / L / h when compared with chaperone before optimization of the reaction conditions. / h.

 In addition, the cell extracts of cells producing α-1,2 fucosyltransferase in which the FKP enzyme of salvage pathway and the fusion protein were linked were used to optimize the concentration of the receptor substrate from 5 mM L-fucose substrate When the one-pot reaction was carried out, 2'-fucosyllactose was produced in 84% yield (2.05 g / L) in 8 hours, which resulted in the optimization of the concentration of the receptor substrate And a productivity increase (0.26 g / L / h) of 4.4 times. The yield in the one-port reaction is shown in FIG.

The concentration of L-fucose used in the one-pot reaction of the present invention can be further improved, and accordingly the yield of 2'-fucosyllactose can also be increased.

α- One ,2 Foucault  Substrate of transferase Coupling - Model  Selection of mutant candidate amino acids using structure Mutant  Selection

Because the α-1,2 fucosyltransferase lacks enzymes with high homology among the proteins whose crystal structure has been revealed, profile-profile alignment was performed by extracting the secondary structure of the protein from the amino acid sequence, Through Bradyrhizobium Derived fucosyltransferase, human-derived α-1,6 fucosyltransferase and heptosyltransferase I & Ⅱ derived from Escherichia coli. The homology between these template proteins and the? -1,2 fucosyltransferase of the present invention is 15, 14, and 12%, respectively. Using the amino acid sequence of the sought template proteins, alignment was carried out by aligning the sequences retained through multiple sequence alignment with the α-1,2 fucosyltransferase and filling the gaps. Respectively.

Finally, amino acid sequence alignment, protein secondary structure alignment and "Fold Finder" (KIAS) optimize the energy of the protein's global structure and increase the accuracy of the amino acid side chain structure. In addition, the binding site of guanosine 5'-diphosphate-fucose, which is a donor substrate, is the same as that of C. elegans , which is the PDB structure having the highest structural similarity among all the proteins to which guanosine 5'-diphosphate- ) Derived fucosyl transferase I was used to dock guanosine 5'-phosphate-fucose into the model structure.

In the case of lactose, a receptor substrate, glutamate and aspartate candidates that could be candidates for essential key amino acid residues that could act in the fucosyltransferase reaction to select binding sites were selected and replaced with alanine Aspartate 115 (D115), whose activity was completely reduced, was searched. The lactose substrate was docked on D115 to detect seven residues within 5-10 Å around lactose and saturation mutations were performed on these residues. The gene of SEQ ID NO: 1 to which the fusion protein was linked was used as a template DNA for producing the mutant. After the saturation mutation, the amount of soluble protein was increased, and the screening was effectively carried out by the colorimetric method using the pH indicator.

Production of 2'-fucosyllactose using a cell extract of S249Y, which is a single amino acid substitution mutant of the present invention, showed that the initial reaction rate U / mL was 0.96 U / mL, Was 33% higher than the state (0.72 U / mL). As a result of confirming the total expression amount and soluble protein amount of the mutant cell extracts, the mutant was found to have a higher amount of soluble protein than the wild type strain as shown in FIG.

In the present invention, the single amino acid substitution mutant S249Y of the S-129 of the? -1,2 fucosyltransferase exhibits the amino acid sequence of SEQ ID NO: 6 and the 249th amino acid position is substituted with all possible amino acids other than serine Enzymes having fucosyltransferase activity are all possible. The DNA encoding the protein of SEQ ID NO: 6 is SEQ ID NO: 7 and may also include all DNA sequences encoding all other possible substitutable amino acids at the 249th amino acid position.

α- One ,2 Foucault  Purification of transport enzymes and measurement of intrinsic activity

1,2 fucosyltransferase-peptide linker-tag gene due to the difficulty of purifying the protein even with an increased amount of soluble protein. Were constructed. A tag can be used for purification of an enzyme using affinity chromatography, and can include both a peptide tag and a protein tag. In addition, the peptide linker can be a linker consisting of small or flexible amino acids, such as glycine or serine. In the present invention, 5 to 20 glycine and serine amino acids were used as linkers and a histidine tag was used. As a result, it was possible to purify the soluble protein of? -1,2 fucosyltransferase with high purity.

In the present invention, the intrinsic activity of 2'-fucosyllactose production in the wild strain was measured to be 0.44 μmole / min / mg. As a result, the lactone N- tetra Enzymatic activity of 0.13 nmol / min / mg on the substrate [Sophie Drouillard, Large-scale synthesis of H-antigen oligosaccharides by expressing Helicobacter pylori α1,2-fucosyltransferase in metabolically engineered Escherichia coli cells, Angewandte Chemie , 2006, Vol. 45, 1778p]. On the other hand, the intrinsic activity of mutant S249Y showed almost the same value as that of wild-type.

The α-1,2 fucosyltransferase having an increased amount of soluble protein produced by the present invention can be used not only for the production of the 2'-fucosyllactose mentioned above but also for the production of Lactodifucotetraose, Fuc (α-1,2) Galβ1 , 4Glc (? -1,3) Fuc), LNFP I (Fuc (? -1,2) Gal? 1,3GlcNAc? 1,3Gal? 1,4Glc), TFLNH (Trifucosyllactose-N-hexose) and LNDFHI (Lacto-N-difucohexose I) And can be applied to the production of various α-1,2 fucosyl oligosaccharides as well.

The specific method of the present invention will be described in detail as an example, but the technical scope of the present invention is not limited to these examples.

[Example 1] α-1, 2 Foucault  Production of an expression vector containing the gene for the transferase and an increase in the amount of soluble protein expressed

1-1 . α- One , 2 Foucault  Production of expression vector containing gene of transferase

In the present invention, the codon usage, the GC codon, and the codon usage are calculated using the "POMBE" program while maintaining the original amino acid sequence (SEQ ID NO: 2) And the stable secondary structure formation of RNA were all considered, and the gene of SEQ ID NO: 1 having the homology of 87% with SEQ ID NO: 3 which is the original nucleotide sequence was synthesized.

In the present invention, a gene encoding the α-1,2 fucosyltransferase of SEQ ID NO: 1 is cloned into a T-vector and then a sense primer having an NdeI restriction enzyme recognition sequence (SEQ ID NO: 4) And an antisense primer (SEQ ID NO: 5) having a Xho I restriction enzyme recognition sequence were prepared. The PCR was carried out in a buffer solution for DNA polymerase reaction, 0.2 mM dNTP, 2.5 mM MgCl ₂ , 50-100 ng of template DNA cloned in T-vector, and 100 pmol of the primer pairs shown in SEQ ID NOs: 4 and 5, respectively pfu DNA polymerase. The reaction conditions were 30 times at 95 ° C for 5 minutes, at 95 ° C for 30 seconds (denaturation), at 55 ° C for 1 minute (annealing), and at 72 ° C for 1 minute (elongation). The amplified PCR product was treated with restriction enzymes NdeI and XhoI, respectively, and inserted into a pET24ma vector having a T7 promoter. The vector used in the present invention may also include all expression vectors having various promoters including T7 promoter.

1-2 . Chaperone  The α- One ,2 Foucault  Increase the soluble protein of the transferase

In the present invention, chaperone was co-expressed to increase the amount of soluble protein of? -1,2 fucosyltransferase. The pBAD vector containing GroEL / GroES was transformed into the BW25113 (DE3) strain simultaneously with the pET24ma vector in which SEQ. ID. No. 1 was cloned, and inoculated into LB medium containing ampicillin and kanamycin antibiotics. After shaking culture for 10 hours, a portion of the culture medium Ampicillin, kanamycin antibiotic, and 1 mM arabinose. After incubation at 30 to 37 ° C, IPTG was added at a concentration of 0.5 to 1 at OD600 of 0.01 to 0.5 mM, and expression was induced at a temperature of 25 ° C or lower for 15 to 20 hours.

As a result of coexpression with chaperonin, it was possible to produce soluble protein with 60% or more relative to the total amount of protein. Using the cell extract coexpressed with chaperonin, 5 mM guanosine 5'-phosphate-fucose, 2.5 The yield of 2'-fucosyllactose production (%) was compared using mM lactose and 2.5 mM MgCl _2. The yield was 24.7%, which was 3.2 times higher than the yield before sequence optimization (7.7%) as shown in FIG. 4 .

1-3 . The α- One ,2 Foucault  Increase the soluble protein of the transferase

In the present invention, in order to increase the amount of the soluble protein of the? -1,2 fucosyltransferase, the N-terminus of the? -1,2 fucosyltransferase obtained in Example 1-1 (SEQ ID NO: 1) - A vector with a fusion protein introduced at its end was constructed. First, a fusion protein gene was cloned into a pET24ma vector. Among the fusion proteins, gene sequences of F-ePGK, N-ePGK, ArsC, GMPK and ACK were extracted using NCBI database, Primers were prepared. The sense primer was constructed to have Nde I restriction enzyme recognition sequence, and the antisense primer was made to have Sac I restriction enzyme recognition sequence. As the PCR method for amplifying the gene of the fusion protein, each primer pair prepared as described above was used as a template DNA using 50 ng of genomic DNA of E. coli K12, 0.2 mM dNTP, 2.5 mM MgCl ₂ , and a buffer solution for DNA polymerase reaction 100 pmol was added and the reaction was carried out using pfu DNA polymerase. The reaction conditions were 30 times at 95 ° C for 5 minutes, at 95 ° C for 30 seconds (denaturation), at 55 ° C for 1 minute (annealing), and at 72 ° C for 1 minute (elongation).

The amplified PCR product was treated with restriction enzymes NdeI and SacI, respectively, and inserted into a pET24ma vector having a T7 promoter. The vector used in the present invention may also include all expression vectors having various promoters including T7 promoter. In the case of C30K9, the C30K9 gene was amplified in the presence of Nde I and Sac I restriction enzyme recognition sequences under the above conditions using the form cloned in pET28a as the template DNA, and cloned into the pET24ma vector treated with Nde I and Sac I restriction enzymes .

A primer was prepared to clone the gene of? -1,2 fucosyltransferase of SEQ ID NO: 1 into a pET24ma vector in which the genes of F-ePGK, N-ePGK, ArsC, GMPK, ACK and C30K9 were cloned. The sense primer was prepared so that the α-1,2 fucosyltransferase gene sequentially appeared after the spacer consisting of 6 to 30 nucleotides containing the restriction enzyme recognition sequence of Sac I, which has the following base sequence. Examples of the following nucleotide sequences include 'GCATGAGCTCGACGATGACGATAAAATGGCCTTTAAGGTG' or 'GCATGAGCTCATTGATGGCCGCATGGCCTTTAAGGTG' or 'GCATGAGCTCGGTGGAGGCGGTTCAGGCGGAGGTATGGCCTTTAAGGTG'.

The antisense primers were prepared by incorporating the alpha-1,2 fucosyltransferase gene into a peptide linker having a restriction enzyme recognition sequence of Xho I and comprising 5 to 20 glycine or serine, which has the following sequence numbers.

As an example of the sequence number, 'ATATCTCGAGAGAGCCTCCTGAACCATCTAAAGCGTTATACTTCTG' or 'ATATCTCGAGTGAACCTCCGCCAGAGCCTCCACCATCTAAAGCGTTATACTTCTG' or 'ATATCTCGAGAGAGCCACCTCCGCCTGAACCGCCTCCACCATCTAAAGCGTTATACTTCTG' can be used.

Using the primer thus prepared, the α-1,2 fucosyltransferase gene was amplified using the vector prepared in Example 1-1 as the template DNA under the above PCR reaction conditions and treated with Sac I and Xho I restriction enzyme. In addition, the vector cloned with the fusion protein was treated with Sac I and Xho I restriction enzyme to clone the amplified α-1,2 fucosyltransferase gene. In the case of GST protein fusion, the α-1,2 fucosyltransferase gene was amplified using the pGEX 4T-1 vector in which the GST gene was recombined with the Sma I and Xho I restriction enzyme recognition sequences, Vector.

The recombinant vector in which the fusion protein and the α-1,2 fucosyltransferase were cloned was transformed into Escherichia coli strain BW25113 (DE3), inoculated into LB medium containing kanamycin antibiotic, and cultured at 30 to 37 ° C for 5 to 10 hours After shaking culture, a part of the culture liquid And 50 mL of LB medium containing 50 μg mL ^-1 kanamycin antibiotic. After incubation at 30 to 37 캜, 0.1 to 1 mM of IPTG was added at OD 600 at 0.5 to 1, and expression was induced at a temperature of 18 to 37 캜 for 15 to 20 hours.

1-4 . α- One ,2 Foucault  Identification of proteins produced by the availability of transport enzymes

After expression of α-1,2 fucosyltransferase using chaperone and fusion protein, the cultured Escherichia coli cells were centrifuged at 4000 rpm for 10 minutes to recover the cells. The cells were resuspended with distilled water, centrifuged for 10 minutes And the distilled water of the supernatant was removed. The collected cell suspensions were suspended in 5 mL of 20 mM sodium phosphate buffer, and the cells were disrupted with a sonicator to obtain a total fraction (soluble protein + insoluble aggregate) of the protein. After centrifugation at 15,000 rpm for 30 minutes, the supernatant Separately, soluble proteins were obtained. These total fractions and 6 μL of soluble protein were mixed with 3 μL of 3 × SSDS dye and boiled at 100 ° C. for 10 minutes. The boiled sample was injected into 10% acrylamide SDS gel, developed, and the gel was stained with Coomassie staining solution and decolorized to confirm the amount of expressed protein.

Example 2: Preparation of α-1, 2 Foucault  Transferase Fucosyl-lactose  synthesis

In the present invention, 5 mM guanosine 5'-diphosphate-fucose, 10-20 mM lactose, and 10-20 mM lactic acid in 50 mM sodium phosphate buffer solution under optimized reaction conditions to further increase the productivity and yield of 2'-fucosyllactose, 5 mM MgCl ₂ and 20% of the total reaction volume of α-1,2 fucosyltransferase. The reaction rate was confirmed to be 2 times faster than that using 5 mM lactose. When 2 ' -fucosyllactose was produced by introducing the above-described optimized method using a cell extract of [alpha] -1,2 fucosyltransferase to which a fusion protein was linked, production of 2'-fucosyllactose The yield was improved to 90% and yielded 2.2 g / L of 2'-fucosyllactose. Productivity (g / L / h) was also reduced from 3 hours to 12 hours, which was 14 times higher than 0.05 g / L / h when compared with chaperone before optimization of the reaction conditions. / h.

In the one-port reaction using L-fucose, 50 mM sodium phosphate buffer solution containing 5 mM L-fucose, 5 mM ATP, 5 mM GTP, 5 mM MnSO ₄ , 5 mM MgCl ₂ and 10-20 mM lactose Were added to a cell extract of 10% (v / v) FKP and 20% (v / v) α-1,2 fucosyltransferase at 37 ° C. Fucosyllactose was produced with a yield of 84% (2.05 g / L) in 8 hours, a 1.7-fold increase in yield and 4.4-fold productivity (0.26 g / L / h ) (Fig. 5).

For determination of 2'-fucosyllactose, Bio-LC (Dionex, USA) equipped with a PA1 column was used. 100 mM sodium hydroxide was flowed in the same solvent at a flow rate of 0.7 mL / min for 7 minutes, then linearly increasing sodium acetate to 0 to 90 mM for 24 minutes, Fucosyllactose was analyzed. The yield (%) of 2'-fucosyllactose production was calculated according to the formula (? P / S ₀ ) * 100 with the concentration of guanosine 5'-diphosphate-fucose as the initial donor substrate used. In the one-port reaction, the yield was calculated using the concentration of L-fucose as the initial concentration.

[Example 3] α-1,2 Foucault  Transferase Mutant  Library construction and screening

(N is A, C, G or T, and K is a sequence of G or T) in which a TCG sequence corresponding to amino acid position 249 of? -1,2 fucosyltransferase is replaced with an arbitrary sequence The entire vector was PCR-amplified using a primer to construct a library. The α-1,2 fucosyltransferase of the present invention has methionine at the first methionine sequence, and methionine at number 1 when it is in the case of phthalic acid.

The amplified gene of the fusion protein-fucosyltransferase with increased amount of soluble protein including the vector sequence was transformed into E. coli DH5? After Dpn I enzyme treatment to remove the original plasmid. The mutant gene was extracted from all the colonies generated and transformed into E. coli BW25113 (DE3). Each of the transformed colonies was inoculated into 500 μL of LB medium containing kanamycin at 96-fold, and cultured at 30 to 37 ° C for 18 to 24 hours. After culturing, the culture was partially added with 50 μg mL ^-1 kanamycin and IPTG Were inoculated into 500 [mu] L of fresh LB medium and cultured at 18-30 [deg.] C for 18-40 hours. After centrifugation, the cells were resuspended in 50 μL of BugBuster protein extraction reagent. Cell extracts were obtained after centrifugation, and 10 to 20 μL of them were used for the mutagenesis reaction. 80 to 90 μL of the reaction solution contained 1 to 10 mM Tris buffer solution pH 8.0, 1 to 5 mM guanosine 5'-phosphate-fucose and 5 to 10 mM lactose, 0.1 to 1 mM pH indicator, The cell extract of the transferase was added and the reaction was allowed to proceed at 37 ° C., and the absorbance was measured at a time interval of 30 minutes. The activity measurement by the colorimetric method of the glycosyltransferase is proportional to the productivity of fucosyllactose as a method of measuring the pH change by the hydrogen ion generated when the glycosidic bond between the sugar donor and the receptor is formed. In the present invention, the decrease of the absorbance at 560 nm, in which the red color of phenol red, which is an indicator, is decreased, was analyzed using a spectrum analyzer [Korean Application No. 10-2013-0039938].

[Example 4]: α-1,2 Foucault  Measurement of intrinsic activity of transferase

The wild-type strain and the mutant of the α-1,2 fucosyltransferase to which the fusion protein is linked are transformed into Escherichia coli BW25113 (DE3) and expressed using IPTG in a culture volume of 50 mL. Then, cells are disrupted with a sonicator After centrifugation, a cell extract was obtained. The cell extract was added to the column equilibrated with 50 mM Tris buffer (pH 8.0) supplemented with 5 mM imidazole and 300 mM sodium chloride and allowed to bind with the nickel resin for 1 hour at 0 ° C. Thereafter, the protein that was not bound to the resin was poured off and other proteins that were non-specifically bound to the Tris buffer solution containing 50 mM imidazole were removed. Finally, only the desired protein was eluted with a Tris buffer solution containing 100 mM imidazole. The eluted protein was subjected to a desalting process using a filter column to remove imidazole to obtain only the final active protein. The amount of protein was measured using a Bradford protein quantitation kit and the same amount of protein was used After the reaction, the intrinsic activity was measured.

5 mM GDP-fuc, 10-20 mM Lactose and 5 mM MgCl ₂ were dissolved in 50 mM sodium phosphate (pH 7.4) using the same amount of protein as the wild-type and single amino acid substitution mutants of α-1,2 fucosyltransferase Buffer solution at 37 ° C for 15 minutes to 30 minutes, and the product was quantitatively analyzed by Bio-LC according to the method described in Example 2. The reaction was calculated as the activity per mg enzyme in terms of conversion yield of 10-25% compared to the initial donor substrate concentration. The enzyme activity at this time was defined as the amount of enzyme required to produce 1 μmole of 2'-fucosyllactose per minute at 37 ° C. The intrinsic activity of 2'-fucosyllactose production of the wild-type strain of the present invention was measured to be 0.44 μmole / min / mg, and the intrinsic activity of mutant S249Y was almost the same as that of wild-type strain.

<110> SNU R & DB FOUNDATION <120> HELICOBACTER PYLORI alpha-1,2 FUCOSYLTRANSFERASE GENE AND PROTEIN          WITH IMPROVED SOLUBLE PROTEIN EXPRESSION, AND THEREOF APPLICATION          FOR SYNTHESIS OF alpha-1,2 FUCOSYLOLIGOSACCHARIDE <130> Y14KP-019 <160> 7 <170> Kopatentin 2.0 <210> 1 <211> 906 <212> DNA <213> optimized alpha-1,2 FUCOSYLTRANSFERASE GENE <400> 1 atggccttta aggtggtgca aatctgtgga gggctgggta atcagatgtt tcagtatgct 60 ttcgcaaaat cattgcagaa acacagtaat acccctgtcc tgttagatat cacttctttt 120 gattggagcg atcgtaagat gcaattagaa cttttcccga ttgatctgcc gtatgcgagt 180 gcgaaagaaa ttgccatagc gaaaatgcaa cacctcccca aactagtacg cgatgcgttg 240 aagtgtatgg gattcgaccg tgttagtcag gagattgttt ttgagtacga acctaagctg 300 ctcaaaccat cgcgcctgac atattttttt ggctacttcc aggatccacg atactttgac 360 gctatatcac cgctgattaa gcaaaccttt acgctgccgc caccacctga aaataataa 420 aataaata aaaaagagga agagtaccag tgcaagctgt ctttgatttt ggccgctaaa 480 aacagcgtgt ttgttcatat cagacgtggc gattatgtgg ggatcggttg tcagctgggt 540 attgactatc aaaaaaaggc gcttgagtat atggcaaaac gcgtgccgaa catggaactg 600 tttgtttttt gcgaagacct ggaattcacg cagaatctcg atcttggcta cccttttatg 660 gacatgacca cacgggataa agaagaagag gcctattggg acatgctgct gatgcagtct 720 tgtcagcacg gcattatagc caactcgact tatagctggt gggcagcata cctgatcgag 780 aacccggaaa aaatcattat tggtcccaaa cattggctgt tcggtcatga aaacatcctt 840 tgcaaagaat gggtcaaaat agaatcccat ttcgaggtaa aatcccagaa gtataacgct 900 TTagat 906 <210> 2 <211> 302 <212> PRT <213> HELICOBACTER PYLORI alpha-1,2 FUCOSYLTRANSFERASE protein <400> 2 Met Ala Phe Lys Val Val Gln Ile Cys Gly Gly Leu Gly Asn Gln Met   1 5 10 15 Phe Gln Tyr Ala Phe Ala Lys Ser Leu Gln Lys His Ser Asn Thr Pro              20 25 30 Val Leu Leu Asp Ile Thr Ser Phe Asp Trp Ser Asp Arg Lys Met Gln          35 40 45 Leu Glu Leu Phe Pro Ile Asp Leu Pro Tyr Ala Ser Ala Lys Glu Ile      50 55 60 Ala Ile Ala Lys Met Gln His Leu Pro Lys Leu Val Arg Asp Ala Leu  65 70 75 80 Lys Cys Met Gly Phe Asp Arg Val Ser Gln Glu Ile Val Phe Glu Tyr                  85 90 95 Glu Pro Lys Leu Leu Lys Pro Ser Arg Leu Thr Tyr Phe Phe Gly Tyr             100 105 110 Phe Gln Asp Pro Arg Tyr Phe Asp Ala Ile Ser Pro Leu Ile Lys Gln         115 120 125 Thr Phe Thr Leu Pro Pro Pro Pro Glu Asn Asn Lys Asn Asn Asn Lys     130 135 140 Lys Glu Glu Glu Tyr Gln Cys Lys Leu Ser Leu Ile Leu Ala Ala Lys 145 150 155 160 Asn Ser Val Phe Val His Ile Arg Arg Gly Asp Tyr Val Gly Ile Gly                 165 170 175 Cys Gln Leu Gly Ile Asp Tyr Gln Lys Lys Ala Leu Glu Tyr Met Ala             180 185 190 Lys Arg Val Pro Asn Met Glu Leu Phe Val Phe Cys Glu Asp Leu Glu         195 200 205 Phe Thr Gln Asn Leu Asp Leu Gly Tyr Pro Phe Met Asp Met Thr Thr     210 215 220 Arg Asp Lys Glu Glu Glu Ala Tyr Trp Asp Met Leu Leu Met Gln Ser 225 230 235 240 Cys Gln His Gly Ile Ile Ala Asn Ser Thr Tyr Ser Trp Trp Ala Ala                 245 250 255 Tyr Leu Ile Glu Asn Pro Glu Lys Ile Ile Ile Gly Pro Lys His Trp             260 265 270 Leu Phe Gly His Glu Asn Ile Leu Cys Lys Glu Trp Val Lys Ile Glu         275 280 285 Ser His Phe Glu Val Lys Ser Gln Lys Tyr Asn Ala Leu Asp     290 295 300 <210> 3 <211> 906 <212> DNA <213> HELICOBACTER PYLORI alpha-1,2 FUCOSYLTRANSFERASE GENE <400> 3 atggctttta aggtggtgca aatttgcgga gggcttggga atcaaatgtt tcaatacgct 60 ttcgctaaaa gtttgcaaaa acactctaat acgcctgtgc tgttagatat cacttctttt 120 gattggagcg ataggaaaat gcaattagaa cttttcccta ttgatttgcc ctatgcgagc 180 gcgaaagaaa tcgctatagc taaaatgcaa cacctcccca agctagtaag agacgcgctc 240 aaatgcatgg gatttgatag ggtgagtcaa gaaatcgttt ttgaatacga gcctaaattg 300 ctaaagccaa gccgcttgac ttattttttt ggctatttcc aagatccacg atactttgat 360 gctatatccc ctttaatcaa gcaaaccttc actctaccac caccacccga aaataataag 420 aataaata aaaaagagga agaatatcag tgcaagcttt ctttgatttt agccgctaaa 480 aagacgtgt ttgtgcatat aagaagaggg gattatgtgg ggattggctg tcagcttggt 540 attgactatc aaaaaaaggc gcttgagtat atggcaaagc gcgtgccaaa catggagctt 600 tttgtgtttt gcgaagactt agaattcacg caaaatcttg atcttggcta cccttttatg 660 gacatgacca ctagggataa agaagaagag gcgtattggg acatgctgct catgcaatct 720 tgtcagcatg gcattatcgc taatagcact tatagctggt gggcggccta tttgatagaa 780 aatccagaaa aaatcattat tggccccaaa cactggcttt ttgggcatga gaatatcctt 840 tgtaaggagt gggtgaaaat agaatcccat tttgaggtaa aatcccaaaa gtataacgct 900 ctagat 906 <210> 4 <211> 24 <212> DNA <213> 2'FT cloning sense primer <400> 4 tcgactcata tggcctttaa ggtg 24 <210> 5 <211> 30 <212> DNA <213> 2'FT cloning anti sense primer <400> 5 tcgactctcg agatctaaag cgttatactt 30 <210> 6 <211> 302 <212> PRT <213> amino acids sequence of S249Y <400> 6 Met Ala Phe Lys Val Val Gln Ile Cys Gly Gly Leu Gly Asn Gln Met   1 5 10 15 Phe Gln Tyr Ala Phe Ala Lys Ser Leu Gln Lys His Ser Asn Thr Pro              20 25 30 Val Leu Leu Asp Ile Thr Ser Phe Asp Trp Ser Asp Arg Lys Met Gln          35 40 45 Leu Glu Leu Phe Pro Ile Asp Leu Pro Tyr Ala Ser Ala Lys Glu Ile      50 55 60 Ala Ile Ala Lys Met Gln His Leu Pro Lys Leu Val Arg Asp Ala Leu  65 70 75 80 Lys Cys Met Gly Phe Asp Arg Val Ser Gln Glu Ile Val Phe Glu Tyr                  85 90 95 Glu Pro Lys Leu Leu Lys Pro Ser Arg Leu Thr Tyr Phe Phe Gly Tyr             100 105 110 Phe Gln Asp Pro Arg Tyr Phe Asp Ala Ile Ser Pro Leu Ile Lys Gln         115 120 125 Thr Phe Thr Leu Pro Pro Pro Pro Glu Asn Asn Lys Asn Asn Asn Lys     130 135 140 Lys Glu Glu Glu Tyr Gln Cys Lys Leu Ser Leu Ile Leu Ala Ala Lys 145 150 155 160 Asn Ser Val Phe Val His Ile Arg Arg Gly Asp Tyr Val Gly Ile Gly                 165 170 175 Cys Gln Leu Gly Ile Asp Tyr Gln Lys Lys Ala Leu Glu Tyr Met Ala             180 185 190 Lys Arg Val Pro Asn Met Glu Leu Phe Val Phe Cys Glu Asp Leu Glu         195 200 205 Phe Thr Gln Asn Leu Asp Leu Gly Tyr Pro Phe Met Asp Met Thr Thr     210 215 220 Arg Asp Lys Glu Glu Glu Ala Tyr Trp Asp Met Leu Leu Met Gln Ser 225 230 235 240 Cys Gln His Gly Ile Ile Ala Asn Tyr Thr Tyr Ser Trp Trp Ala Ala                 245 250 255 Tyr Leu Ile Glu Asn Pro Glu Lys Ile Ile Ile Gly Pro Lys His Trp             260 265 270 Leu Phe Gly His Glu Asn Ile Leu Cys Lys Glu Trp Val Lys Ile Glu         275 280 285 Ser His Phe Glu Val Lys Ser Gln Lys Tyr Asn Ala Leu Asp     290 295 300 <210> 7 <211> 906 <212> DNA <213> DNA sequence of S249Y <400> 7 atggccttta aggtggtgca aatctgtgga gggctgggta atcagatgtt tcagtatgct 60 ttcgcaaaat cattgcagaa acacagtaat acccctgtcc tgttagatat cacttctttt 120 gattggagcg atcgtaagat gcaattagaa cttttcccga ttgatctgcc gtatgcgagt 180 gcgaaagaaa ttgccatagc gaaaatgcaa cacctcccca aactagtacg cgatgcgttg 240 aagtgtatgg gattcgaccg tgttagtcag gagattgttt ttgagtacga acctaagctg 300 ctcaaaccat cgcgcctgac atattttttt ggctacttcc aggatccacg atactttgac 360 gctatatcac cgctgattaa gcaaaccttt acgctgccgc caccacctga aaataataa 420 aataaata aaaaagagga agagtaccag tgcaagctgt ctttgatttt ggccgctaaa 480 aacagcgtgt ttgttcatat cagacgtggc gattatgtgg ggatcggttg tcagctgggt 540 attgactatc aaaaaaaggc gcttgagtat atggcaaaac gcgtgccgaa catggaactg 600 tttgtttttt gcgaagacct ggaattcacg cagaatctcg atcttggcta cccttttatg 660 gacatgacca cacgggataa agaagaagag gcctattggg acatgctgct gatgcagtct 720 tgtcagcacg gcattatagc caactatact tatagctggt gggcagcata cctgatcgag 780 aacccggaaa aaatcattat tggtcccaaa cattggctgt tcggtcatga aaacatcctt 840 tgcaaagaat gggtcaaaat agaatcccat ttcgaggtaa aatcccagaa gtataacgct 900 TTagat 906

Claims (24)

A DNA encoding the alpha -1,2 fucosyltransferase, which comprises the sequence of SEQ ID NO: 1. A recombinant DNA vector comprising the DNA according to claim 1. The recombinant DNA vector according to claim 2, wherein a DNA encoding a fusion protein is located at the 5'-end of the DNA encoding the α-1,2 fucosyltransferase. 4. The recombinant DNA of claim 3, wherein the recombinant DNA has a spacer consisting of 3 to 60 nucleotides between the DNA encoding the gene of the alpha-1,2 fucosyltransferase and the DNA encoding the fusion protein vector. A host cell transformed with a recombinant DNA vector according to claim 2. A host cell transformed with a recombinant DNA vector according to claim 3. A host cell transformed with a recombinant DNA vector according to claim 4. 8. A transformed host cell according to any one of claims 5 to 7, wherein the host cell is further transformed with a recombinant DNA vector encoding a chaperone protein. An extract of a transformed host cell according to any one of claims 5 to 7. A-1,2 fucosyl transfer represented by the amino acid sequence of SEQ ID NO: 6, characterized in that the 249th amino acid of the? -1,2 fucosyltransferase represented by SEQ ID NO: 2 is substituted with tyrosine Enzyme variants. delete 7. A DNA represented by SEQ ID NO: 7 which codes for an? -1,2 fucosyltransferase mutant according to claim 10. A recombinant DNA vector comprising the DNA according to claim 12. A host cell transformed with the recombinant DNA vector of claim 13. 15. Extract of the transformed host cell according to claim 14. A polypeptide of an alpha -1,2 fucosyltransferase expressed from a transformed host cell according to any one of claims 5 to 7 or a polypeptide of an alpha 1,2 fucosyltransferase variant according to claim 10 Wherein the polypeptide comprises a peptide linker consisting of 2 to 40 amino acids at the C-terminus of the polypeptide. 17. The polypeptide according to claim 16, wherein the peptide linker is at least one selected from the group consisting of glycine, alanine, serine, threonine, and cysteine. A vector comprising an α-1,2 fucosyltransferase-encoding DNA comprising the sequence of SEQ ID NO: 1, or an extract of said host cell transformed with a vector comprising DNA encoding α-1,2 fucosyltransferase, 1,2-fucosyl oligosaccharide. 19. The vector according to claim 18, wherein the vector is a DNA fragment encoding a fusion protein comprising a DNA encoding a fusion protein at the 5'-end of DNA encoding an alpha-1,2 fucosyltransferase, &Lt; / RTI &gt; The method of claim 19, wherein an inducer of 0.005 mM to 5 mM is used at a temperature of 15 캜 to 38 캜. 19. The method of claim 18, wherein the host cell is further transformed with a recombinant DNA vector encoding a chaperone protein. The method according to claim 21, wherein an inducer factor of from 0.001 mM to 2 mM is used at a temperature of from 10 캜 to 35 캜. 23. The method according to any one of claims 18 to 22, wherein the concentration of the sugar receptor substrate is at least the guanosine 5'-diphosphate fucose (GDP-fuc) substrate concentration of donor fucose , Wherein the? -Fumarate oligosaccharide is used as the? -Fumarate oligosaccharide. 12. A method for searching for an alpha-1,2 fucosyltransferase variant according to claim 10, comprising the steps of:
(1) a residue selected from the aspartate 115 (D115) of the crystal structure or model structure of the? -1,2 fucosyltransferase within 5 to 10 A, or a substrate binding model of the? -1,2 fucosyltransferase Analyzing a functional moiety that will perform a saturation mutation through multiple sequence alignment and alanine scanning in a selected moiety within 5-10 A from the site where the receptor substrate binds from the structure,
(2) Performing a colorimetric method using a pH indicator.

Images