KR101642264B1

KR101642264B1 - Method for screening of interaction inhibitors between YAP or TAZ protein and MAML1 or MAML2 protein

Info

Publication number: KR101642264B1
Application number: KR1020160026187A
Authority: KR
Inventors: 조익훈; 김완태; 김영은
Original assignee: 서울시립대학교 산학협력단
Priority date: 2016-03-04
Filing date: 2016-03-04
Publication date: 2016-07-25

Abstract

The present invention relates to a method for screening interaction inhibitors between YAP or TAZ protein and MAML(mastermind-like)1 or MAML2 protein. More specifically, when MAML1 or MAML2 is interacting with YAP or TAZ and occurrence of MAML1/2 is inhibited, transcriptional activation of the YAP or TAZ is inhibited and WW domain of the TAZ and PPxY sequence of the MAML1/2 are confirmed to play an important role in mutual interaction, and when expression of the MAML1 is inhibited, movement of the YAP in a nucleus is inhibited and movement of a cell is inhibited. The inhibitors capable of inhibiting interaction between the YAP/TAZ and the MAML1/2 through the screening method according to the present invention prevents the YAP/TAZ from moving toward the nucleus, thereby usefully used for inhibiting formation of cancer.

Description

(Method for screening of interaction inhibitors between YAP or TAZ protein and MAML1 or MAML2 protein)

YAP or a TAZ protein and a MAML1 or 2 protein binding inhibitor. By inhibiting the migration of YAP or TAZ to the nucleus through the screening method, an inhibitor that inhibits the formation of cancer can be developed.

The mechanism of cell signaling that regulates size, heart, or liver size of an individual is not well known. Although relatively recent Hippo signaling has been initiated as a basic study to control the size of an individual, recent studies have shown that cancer and its progress have been linked to cancer (Kim and Jho, 2014). The fact that research on Hippo signaling is published in top-notch journals indicates that research in this area is receiving worldwide attention. Hippo signaling has been found to be an evolutionarily conserved pathway in Drosophila and mammals, including humans, where analogues of Drosophila proteins have also been found in mammals and functionally similar. Hippo signaling is a phenomenon that occurs when a mutation in this gene occurs in Drosophila, which is named Hippo because it resembles Hippopotamus. When the mammalian gene Mst1 / 2 is deleted, the size of the liver is observed to increase , Hippo signaling has been shown to play a role in determining the size of the organ within an individual (Halder and Johnson, 2011).

In general, Hippo signaling is regulated by cell density (Kim and Jho, 2014), whereas YAP (Yes-associated protein), which plays a role similar to β-catenin in Wnt signaling when cell density is low, Or TAZ (WW domain-containing transcription regulator protein 1, WWTR1) into the nucleus and bind to the transcription factor TEAD to inhibit apoptosis or to promote the expression of a gene related to cell proliferation, Enables continuous growth of cells.

Recently, the expression levels of YAP or TAZ have been found to be increased in cancer cells, and the relationship between cancer formation and Hippo signaling has begun to be revealed. However, when the cell density is high, Salvador (SAV), in which activated Mst1 / 2 binds, is activated by proteins that are activated by Kvra or NF2 by an upstream signal that has not been clarified yet. (Lats1 / 2) phosphorylates YAP / TAZ and phosphorylated YAP / TAZ binds to a protein called 14-3-3 to phosphorylate the downstream kinase, Lats1 / 2, into the cytoplasm Which is degraded by the proteasomal degradation pathway. As a result, the cell growth is stopped by promoting apoptosis or inhibiting the expression of a gene involved in cell proliferation.

Thus, it can be seen that the level of expression in the nucleus of YAP / TAZ is closely related to cell growth regulation and cancer formation. Proteins that migrate into the nucleus have a peptide signal called the Nuclear localization signal (NLS). In the case of YAP / TAZ, there is no known method of entry into the nucleus because there is no NLS. One possibility is that it binds to other proteins with NLS and moves into the nucleus. In the case of Wnt signaling, which is known to play a role in the formation of cancer, β-catenin without NLS binds with a protein called FoxM1, (Zhang et al. 2011).

W. Hong et al. Disclosed a study on YAP and TAZ, two important transcription factors of the Hippo pathway, which are closely related to cancer (Seminars in Cell & Developmental Biology 23 (2012) 785-793), Chunling Yi et al. Have shown that the p130 isoform of Angiomotin (Amot-p130) plays a role in YAP-mediated liver epithelial cell proliferation and tumorigenesis (Sci. ra77 (2013)), and how YAP / TAZ moves into the nucleus is not known to date.

Accordingly, the present inventors have found that when an MAML (mastermind-like) 1 or 2 binds to YAP or TAZ and inhibits the expression of MAML1 / 2 while trying to elucidate the mechanism of YAP / TAZ migration into the nucleus, TAZ was inhibited, and the WW domain of TAZ and the PPxY sequence of MAML1 / 2 play an important role in the mutual binding. When the expression of MAML1 is inhibited, the migration of YAP in nucleus is inhibited and the cell , It is possible to use YAP / TAZ and MAML1 / 2 as a target for inhibiting the binding, thereby being useful for the treatment of cancer induced by YAP / TAZ The present invention has been completed.

It is an object of the present invention to provide a method of screening for a binding inhibitor of YAP / TAZ and MAML1 / 2 which inhibits the migration of YAP / TAZ to the nucleus.

In order to achieve the above object,

1) treating the test substance with cells expressing any one or more proteins selected from the group consisting of YAP and TAZ and MAML1 and MAML2; And

2) reducing the binding between the YAP or TAZ protein and the MAML1 or MAML2 protein in the cells of step 1), or identifying a test substance inhibiting the nuclear translocation of YAP or TAZ mediated by MAML1 or MAML2 Cancer screening method.

In addition,

1) treating the test substance to any one or more proteins selected from the group consisting of MAML1 or MAML2 and at least one protein selected from the group consisting of YAP or TAZ; And

2) identifying a test substance which reduces binding between YAP or TAZ protein and MAML1 or MAML2 protein in step 1).

In addition,

1) measuring the level of binding between the YAP or TAZ protein and the MAML1 or MAML2 protein from the test sample;

2) comparing the binding level of the above step 1) with a normal control sample, to provide information on the diagnosis of an individual having a cancer susceptibility.

In the present invention, when the MAML (mastermind-like) 1 or 2 binds to YAP or TAZ and inhibits the expression of MAML1 / 2, the transcriptional activity of YAP or TAZ is inhibited, and the WW domain and MAML1 / 2 PPxY sequence plays an important role in the mutual binding. When the expression of MAML1 is inhibited, it is confirmed that the migration of YAP is inhibited and the migration of cells is inhibited. Thus, the YAP or TAZ protein of the present invention and MAML1 Or 2 protein binding inhibitors can be used to inhibit the formation of cancer by inhibiting the migration of YAP or TAZ into the nucleus.

FIG. 1 is a view showing the combination of MAML1 / 2 and YAP and TAZ.
FIG. 2 is a view showing the binding of MAML1 and YAP through a proximity ligation assay.
FIG. 3 is a diagram showing the binding of MAML1 with YAP and TAZ through Immuno-Fluorescence (IF).
FIG. 4 is a graph showing changes in transcriptional activity of YAP and TAZ due to the inhibition of MAML1 / 2 expression and mRNA expression of target genes of YAP.
FIG. 5 is a diagram showing changes in binding and transcriptional activity with MAML1 due to the deletion of the WW domain (W: tryptophan) of TAZ.
FIG. 6 shows the transcriptional activity of TAZ and YAP by MAML1, MAML2 and MAML3.
FIG. 7 shows inhibition of migration of YAP into the nucleus due to inhibition of MAML1.
Fig. 8 shows inhibition of cell migration due to inhibition of MAML1 / 2.

Hereinafter, the present invention will be described in detail.

The present invention

The YAP (Yes-associated protein, NP_001269030.1) protein is represented by SEQ ID NO: 1, and the TAZ (WW domain-containing transcription regulator protein 1, WWTR1 and NP_056287.1) protein is represented by SEQ ID NO: 2 and MAML1 (mastermind like protein 1, NP_055572. 1) is preferably SEQ ID NO: 3, and MAML2 (mastermind like protein 2, NP_115803.1) has an amino acid sequence of SEQ ID NO: 4, and the binding between YAP or TAZ protein and MAML1 or MAML2 protein of step 2) It is preferred that it is mediated by the WW domain of TAZ (W is tryptophan) and mediated by the PPxY motif of MAML 1 or MAML2 (P is proline, x is any amino acid, Y is tyrosine).

In addition, the identification of the step 2) can be performed by Western blotting, immunoprecipitation assay, proximity ligation assay, dual luciferase reporter assay, or immuno- the cancer is preferably selected from the group consisting of colon cancer, stomach cancer, prostate cancer, breast cancer, kidney cancer, liver cancer, brain tumor, lung cancer, uterine cancer, colon cancer, bladder cancer and pancreatic cancer.

The test substance to be analyzed by the screening method of the present invention may be a single compound, a mixture of compounds (for example, a natural extract or a cell or a tissue culture), an antibody or a peptide, or may be obtained from a library of synthetic or natural compounds. Methods for obtaining libraries of such compounds are known in the art. Synthetic compound libraries are commercially available from Maybridge Chemical Co., Comgenex (USA), Brandon Associates (USA), Microsource (USA) and Sigma-Aldrich (USA) ) And MycoSearch (USA).

In a specific embodiment of the present invention, when a MAML (mastermind-like) 1 or 2 binds YAP or TAZ (see Figures 1 to 3) and inhibits the expression of MAML1 / 2, the transcriptional activity of YAP or TAZ (See FIG. 4), confirming that the WW domain of TAZ and the PPxY sequence of MAML1 / 2 play an important role in the mutual binding (see FIGS. 5 and 6) It was confirmed that migration in the nucleus was inhibited and cell migration was inhibited (see FIGS. 7 and 8).

Therefore, the inhibitor developed through the screening method of the inhibitor of binding of YAP or TAZ protein to MAML1 or 2 protein can be useful for inhibiting the formation of cancer by blocking the migration of YAP or TAZ to the nucleus.

In addition,

Hereinafter, the present invention will be described in detail with reference to Examples and Experimental Examples.

It is to be understood, however, that the following examples and experimental examples are illustrative of the present invention, but the present invention is not limited by the following examples and experimental examples.

< Example 1> Plasmid production

The V5-MAML1 plasmid was purchased from Addgene (USA) (Plasmid # 37049), and the Flag-MAML1 plasmid was obtained from Drs. Lizi Wu (University of Floroda, USA). Flag-YAP and Flag-TAZ plasmids were prepared by PCR. The primers used in this case are as follows:

YAP Forward; TGACAAGGATCCCGGGCAGCA (SEQ ID NO: 5),

Reverse; GCGGCCGCCTATAACCATGTAAGA (SEQ ID NO: 6),

TAZ Forward; AAATGAATCCGGCCTCGGCG (SEQ ID NO: 7),

Reverse; TTACAGCCAGGTTAGAAAGGGCT (SEQ ID NO: 8).

< Example 2> siRNA making

To investigate the expression of MAML1 and MAML2, a synthetic siRNA duplex oligomer ST Pharm was prepared.

siRNA duplex sequences are as follows:

siRNA-MAML1: 5'-GAG GAA TCT TGA CAG CGC C-3 '(SEQ ID NO: 9),

siRNA-MAML2: 5'-GTA ATC AAC CTA ACA CATA-3 '(SEQ ID NO: 10).

Non-specific siRNA duplex oligomers were used as negative control.

< Example 3> Production of transformed cell line

HEK293 cells were dispensed into a 60 mm cell culture dish at a concentration of 5 × 10 ⁵ cells / well. Then, siRNA duplexes and YAP / TAZ expression vectors prepared in Example 2 were diluted with 3 ml of distilled water, 1 M CaCl ₂ , 2 x HeBs (HEPES-buffered saline solution, 50 mM HEPES (pH 7.0) mM Na ₂ HPO ₄ , 10 mM KCl, 280 mM NaCl, 12 mM glucose) to transform the cells. Thereafter, the cells were cultured at 37 ° C under 5% CO ₂ for 4 hours, and then replaced with fresh medium. After 24 hours of transformation, cells were lysed and Western blot was performed by the following method to confirm the transformed cell line.

Specifically, HEK293 cells transformed with V5-MAML1 and HA-TAZ plasmids were suspended in Tris-HCl buffer (20 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1% Triton X- ml EGTA, 2.5 mM sodium pyrophosphate, 1 mM β-glycerophosphate, 1 mM sodium ortho-vanadate, 1 mM PMSF, 1 μg / ml Leupeptin) and the protein concentration in the lysate was measured using the Bradford method -Rad Laboratories, USA). Protein samples were prepared by mixing 60 ㎍ lysate with Tris-HCl buffer, SDS stain (50 mM Tris-HCl, pH 6.8, 4% SDS, 40% Glycerol, 50 mM β-mercaptoethanol) And then electrophoresed at 140 V in a 10% SDS-PAGE gel (10% acrylamide mix: ELPIS Biotech, Korea, 375 mM Tris, pH 8.8, 1% ammonium persulfate, 0.04% TEMED) (Green and Sambrook, Molecular Cloning: 4th Ed., P. 1602, Cold Spring Harber: USA). The separated samples were transferred to a PVDF membrane at 230 mA and then washed with 5% skim milk powder (Merck, USA) with TBST (100 mM Tris-Cl, pH 8.0, 1.5 M NaCl, 0.05% TWEEN 20: AMRESCO, USA) Germany). V5 and HA antibodies were reacted at 4 ° C for 16 hours and then reacted with a secondary antibody (goat anti-mouse IgG-HRP: Santa Cruz Biotechnology, USA, 1: 10,000 dilution) at 25 ° C for 1 hour. The final results were confirmed by the manufacturer's method using an ECL kit (ELPIS Biotech, Korea).

< Experimental Example 1> MAML1 / 2 and YAP / Of TAZ Confirm binding

To confirm the binding of MAML1 / 2 and YAP / TAZ, the following immunoprecipitation experiment was performed.

Specifically, the cells overexpressing MAML1 / 2 and YAP / TAZ were treated with Tris-HCl buffer (20 mM Tris HCl at pH 7.4, 150 mM NaCl, 1% triton X-100, 1 mM EDTA , 1 mM EGTA, 2.5 mM sodium pyrophosphate, 1 mM β-glycerophosphate and 1 mM sodium ortho-vanadate), and then the protein was analyzed by Bradford method (Bradford, MM., Anal. Biochem. 72: 248-254, 1976) (Bio-Rad Laboratories, USA). From the supernatant of the cell lysate, 1000 μg of the protein sample was incubated overnight at 4 ° C. using an HA antibody (Santa Cruz Biotechnology, USA). Then, the cells were incubated with Protein G agarose beads (Fast Flow 10 ml, packed beads 50% slurry, Millipore) for 2 hours at 4 ° C, washed 5 times and then resuspended in SDS dye (1 M Tris-HCl at pH 6.8, 20 % SDS, 0.4% BPB, 20% Glycerol, and β-mercaptoethanol 14.3 M), heated in boiling water at 95 ° C for 10 minutes, and confirmed by Western blotting.

As a result, it was confirmed that overexpressed MAML1 / 2 binds to YAP / TAZ as shown in FIG. 1A, and when the above immunoprecipitation method was performed using a general cell line that is not a plasma cell line, as shown in FIG. 1B Likewise, it was confirmed that intracellular MAMLl binds to YAP / TAZ (Fig. 1).

In addition, Proximity Ligation Assay was performed to confirm binding of MAML1 and YAP / TAZ.

Specifically, the kit was purchased from Sigma-aldrich (Cat # DUO92101) according to the protocol of the manufacturer, and the cells were cultured in a suitable volume on a humid-chamber slide, followed by 4% paraformaldehyde The cells were fixed at 37 ° C for 30 minutes. Then, for the primary antibody reaction, the primary antibody (YAP or MAML1) to be used was diluted to an appropriate concentration (YAP 1: 100, MAML1 1: 100) and then the blocking solution was removed from the slide chamber. The primary antibody was reacted for 2 hours or more, washed 5 times with wash A solution for 5 minutes, and reacted with 1/5 diluted PLA probe at 37 ° C for 1 hour. After one hour, the PLA probe was removed and washed with wash A solution for 5 minutes more than 5 times. Ligation solution containing ligase was added to the sample and reacted at 37 ° C for 30 minutes. The amplification solution containing the polymerase was reacted with the sample at 37 ° C for 100 minutes, washed with wash B solution for 10 minutes or more for 2 minutes, and then immersed in a slide glass The inclusion solution was dropped, covered with a cover glass, and observed under a microscope.

As a result, as shown in FIG. 2, it was confirmed that MAML1 and YAP / TAZ were also bound to each other through the close-fitting test (FIG. 2).

Immunofluorescence (IF) was also performed to confirm binding of MAML1 / 2 and YAP / TAZ.

Specifically, 3.7% paraformaldehyde was added to the transformed NIH3T3 cells and fixed at room temperature for 20 minutes. Then, the cells were washed three times with PBS, and treated with 0.1% Triton-X100 for 15 minutes to increase the permeability of the cells. After washing 3 times with PBS, the cells were treated with 10% FBS (fetal bovine serum) for 1 hour. Anti-HA and anti-VSVG antibodies were diluted in 10% FBS and reacted for 2 hours at room temperature (or overnight at 4 ° C). After washing three times for 10 minutes with 1% FBS, the secondary antibody (Alexa Fluor 546 goat anti -rabbit IgG, Alexa Fluor 488 goat anti-mouse IgG) were diluted in 10% FBS, reacted for 2 hours in the dark room, and washed 3 times for 10 minutes with 1% FBS. During the second wash, 300 ng / ml DAPI was added to 1% FBS. Then, the sealing solution was dropped on the slide glass, and then the cover glass was covered. The surrounding filling solution was removed, covered with enamel, and observed with a microscope.

As a result, as shown in FIG. 3, when YAP / TAZ was overexpressed alone, it was mainly present in the cytoplasm. However, when MAML1 was overexpressed simultaneously, it was confirmed that YAP / TAZ migrated into the nucleus (FIG.

< Experimental Example 2> MAML1 / 2 is YAP / Of TAZ Confirming that it promotes transcriptional activity

The following experiments were performed to confirm the effect of MAML1 / 2 on the transcriptional activity of YAP / TAZ.

Specifically, to inhibit the expression of MAML1 or MAML2, siRNAs prepared in Example 2 were mixed to inhibit the expression of MAML1 and MAML2, and a dual luciferase assay (YAP / TAZ) Transcriptional activity was measured.

The medium was removed from the transformed HeLa cells cultured on a 12-well plate, and 150 Pass of 1X Passive Lysis Buffer (5 占 PLB: Promega) was added thereto, followed by dissolving at room temperature for 15 minutes. The lysates were centrifuged at 750 × g for 5 minutes and 10 μl of the supernatant was used for the measurement. Add 50 μl of LARII (Promega) to the sample, measure the firefly luciferase activity in the luminometer, add 50 μl of Stop & Glo (50 × Stop & Glo substrate, buffer: Promega) and measure the Renilla luciferase activity in the luminometer And the measured values were corrected.

As a result, as shown in Fig. 4, it was confirmed that the activity by YAP / TAZ was decreased due to the inhibition of MAML1 / 2 expression (Fig. 4A), and also the endogenous target genes of YAP / TAZ The decrease in expression was confirmed by real-time PCR (Fig. 4B). The sequences of the primers used are as follows.

CTGF, for: AGGAGTGGGTGTGTGACGA (SEQ ID NO: 11);

rev: CCAGGCAGTTGGCTCTAATC (SEQ ID NO: 12);

ANKRD1, for: AGTAGAGGAACTGGTCACTGG (SEQ ID NO: 13);

rev: TGGGCTAGAAGTGTCTTCAGAT (SEQ ID NO: 14);

CYR61, for: CAGGACTGTGAAGATGCGGT (SEQ ID NO: 15);

rev; GCCTGTAGAAGGGAAACGCT (SEQ ID NO: 16);

HES1, for: GGCTGGAGAGGCGGCTAA (SEQ ID NO: 17);

rev: GAGAGGTGGGTTGGGGAGTT (SEQ ID NO: 18);

NRARP, for: TGCACCAGTCGGTCATCG (SEQ ID NO: 19);

rev: TTGACCAGCAGCTTCACGAG (SEQ ID NO: 20);

GAPDH, for: AGCCACATCGCTCAGACAC (SEQ ID NO: 21);

rev: GCCCAATACGACCAAATCC (SEQ ID NO: 22).

< Experimental Example 3> MAML1 / 2 and YAP / Of TAZ Identification of domains critical to binding.

In order to confirm the domain of YAP / TAZ important for binding of MAML1 / 2 and YAP / TAZ, the following experiment was performed.

As shown in FIGS. 5B to 5D, the plasmid obtained by removing the WW domain (W, tryptophan) from the TAZ was prepared as shown in FIG. 5A. As a result of the experiments of Experiments 1 and 2, When the WW domain was removed, it was confirmed that TAZ could not migrate into the nucleus even when MAML1 was simultaneously overexpressed (FIGS. 5B and 5C), indicating that the transcription activity of TAZ did not increase (FIG. 5D).

MAML1, MAML2, and MAML3 were present in the mammal, confirming that the PPxY sequence thought to be important for binding with the WW domain of YAP / TAZ was not present in MAML3 (Fig. 6A) As shown in FIG. 6B, it was confirmed that MAML1 and MAML2 increased transcription activity of YAP or TAZ while MAML3 without PPxY domain had no effect (FIG. 6B ).

< Experimental Example 4> MAML1 / 2 is essential for cell migration.

In order to confirm the effect of inhibition of MAML1 / 2 expression on cell migration, the following experiment was conducted.

Specifically, the adhesion cell wound healing assay was performed using the HEK293A cell line transformed with the siRNA-MAML1 / 2 and YAP prepared in Example 2, and the cell line was sterilized using a plastic tip And then incubated at 37 ° C and 5% CO ₂ for 18 hours. The cell migration ability was measured by a microscope in real time. In addition, the expression of YAP was anti-YAP antibody and the expression of MAML1 was performed by immunofluorescence of <Experimental Example 1> using anti-MAML1 antibody.

As a result, as shown in FIG. 7, when siRNA was used to inhibit the expression of MAML1, it was confirmed that YAP was not present in the nucleus.

As shown in FIG. 8, when the YAP was overexpressed, the cell migration was increased. However, when the expression of MAML1 / 2 was inhibited using siRNA, cell migration was remarkably inhibited even when YAP was overexpressed (FIG. 8) .

<110> University of Seoul Industry Cooperation Foundation. <120> Method for screening of interaction inhibitors between YAP or TAZ protein and MAML1 or MAML2 protein <130> 16P-01-012 <160> 22 <170> KoPatentin 3.0 <210> 1 <211> 508 <212> PRT <213> Homo sapiens <400> 1 Met Asp Pro Gly Gln Gln Pro Pro Gln Pro Ala Pro Gln Gly Gln 1 5 10 15 Gly Gln Pro Pro Ser Gln Pro Pro Gln Gly Gln Gly Pro Pro Ser Gly 20 25 30 Pro Gly Gln Pro Ala Pro Ala Ala Thr Gln Ala Ala Pro Gln Ala Pro 35 40 45 Pro Ala Gly His Gln Ile Val His Val Arg Gly Asp Ser Glu Thr Asp 50 55 60 Leu Glu Ala Leu Phe Asn Ala Val Met Asn Pro Lys Thr Ala Asn Val 65 70 75 80 Pro Gln Thr Val Pro Met Arg Leu Arg Lys Leu Pro Asp Ser Phe Phe 85 90 95 Lys Pro Pro Glu Pro Lys Ser His Ser Arg Gln Ala Ser Thr Asp Ala 100 105 110 Gly Thr Ala Gly Ala Leu Thr Pro Gln His Val Arg Ala His Ser Ser 115 120 125 Pro Ala Ser Leu Gln Leu Gly Ala Val Ser Pro Gly Thr Leu Thr Pro 130 135 140 Thr Gly Val Val Ser Gly Pro Ala Ala Thr Pro Thr Ala Gln His Leu 145 150 155 160 Arg Gln Ser Ser Phe Glu Ile Pro Asp Asp Val Pro Leu Pro Ala Gly 165 170 175 Trp Glu Met Ala Lys Thr Ser Ser Gly Gln Arg Tyr Phe Leu Asn His 180 185 190 Ile Asp Gln Thr Thr Thr Trp Gln Asp Pro Arg Lys Ala Met Leu Ser 195 200 205 Gln Met Asn Val Thr Ala Pro Thr Ser Pro Pro Val Gln Gln Asn Met 210 215 220 Met Asn Ser Ala Ser Gly Pro Leu Pro Asp Gly Trp Glu Gln Ala Met 225 230 235 240 Thr Gln Asp Gly Glu Ile Tyr Tyr Ile Asn His Lys Asn Lys Thr Thr 245 250 255 Ser Trp Leu Asp Pro Arg Leu Asp Pro Arg Phe Ala Met Asn Gln Arg 260 265 270 Ile Ser Gln Ser Ala Pro Val Lys Gln Pro Pro Pro Leu Ala Pro Gln 275 280 285 Ser Pro Gln Gly Gly Val Met Gly Gly Ser Asn Ser Asn Gln Gln Gln 290 295 300 Gln Met Arg Leu Gln Gln Leu Gln Met Glu Lys Glu Arg Leu Arg Leu 305 310 315 320 Lys Gln Gln Glu Leu Leu Arg Gln Val Arg Pro Gln Ala Met Arg Asn 325 330 335 Ile Asn Pro Ser Thr Ala Asn Ser Pro Lys Cys Gln Glu Leu Ala Leu 340 345 350 Arg Ser Gln Leu Pro Thr Leu Glu Gln Asp Gly Gly Thr Gln Asn Pro 355 360 365 Val Ser Ser Pro Gly Met Ser Gln Glu Leu Arg Thr Met Thr Thr Asn 370 375 380 Ser Ser Asp Pro Phe Leu Asn Ser Gly Thr Tyr His Ser Arg Asp Glu 385 390 395 400 Ser Thr Asp Ser Gly Leu Ser Met Ser Ser Tyr Ser Val Pro Arg Thr 405 410 415 Pro Asp Phe Leu Asn Ser Val Asp Glu Met Asp Thr Gly Asp Thr 420 425 430 Ile Asn Gln Ser Thr Leu Pro Ser Gln Gln Asn Arg Phe Pro Asp Tyr 435 440 445 Leu Glu Ala Ile Pro Gly Thr Asn Val Asp Leu Gly Thr Leu Glu Gly 450 455 460 Asp Gly Met Asn Ile Glu Gly Glu Glu Leu Met Pro Ser Leu Gln Glu 465 470 475 480 Ala Leu Ser Ser Asp Ile Leu Asn Asp Met Glu Ser Val Leu Ala Ala 485 490 495 Thr Lys Leu Asp Lys Glu Ser Phe Leu Thr Trp Leu 500 505 <210> 2 <211> 400 <212> PRT <213> homo sapiens <400> 2 Met Asn Pro Ala Ser Ala Pro Pro Leu Pro Pro Pro Gly Gln Gln 1 5 10 15 Val Ile His Val Thr Gln Asp Leu Asp Thr Asp Leu Glu Ala Leu Phe 20 25 30 Asn Ser Val Met Asn Pro Lys Pro Ser Ser Trp Arg Lys Lys Ile Leu 35 40 45 Pro Glu Ser Phe Phe Lys Glu Pro Asp Ser Ser Ser Ser Ser Gln 50 55 60 Ser Ser Thr Asp Ser Ser Gly Gly His Pro Gly Pro Arg Leu Ala Gly 65 70 75 80 Gly Ala Gln His Val Arg Ser His Ser Ser Pro Ala Ser Leu Gln Leu 85 90 95 Gly Thr Gly Ala Gly Ala Gly Ser Pro Ala Gln Gln His Ala His 100 105 110 Leu Arg Gln Gln Ser Tyr Asp Val Thr Asp Glu Leu Pro Leu Pro Pro 115 120 125 Gly Trp Glu Met Thr Phe Thr Ala Thr Gly Gln Arg Tyr Phe Leu Asn 130 135 140 His Ile Glu Lys Ile Thr Thr Trp Gln Asp Pro Arg Lys Ala Met Asn 145 150 155 160 Gln Pro Leu Asn His Met Asn Leu His Pro Ala Val Ser Ser Thr Pro 165 170 175 Val Pro Gln Arg Ser Met Ala Val Ser Gln Pro Asn Leu Val Met Asn 180 185 190 His Gln His Gln Gln Gln Met Ala Pro Ser Thr Leu Ser Gln Gln Asn 195 200 205 His Pro Thr Gln Asn Pro Pro Ala Gly Leu Met Ser Met Pro Asn Ala 210 215 220 Leu Thr Thr Gln Gln Gln Gln Gln Gln Lys Leu Arg Leu Gln Arg Ile 225 230 235 240 Gln Met Glu Arg Glu Arg Ile Arg Met Met Arg Gln Glu Glu Leu Met Arg 245 250 255 Gln Glu Ala Ala Leu Cys Arg Gln Leu Pro Met Glu Ala Glu Thr Leu 260 265 270 Ala Pro Val Gln Ala Ala Val Asn Pro Pro Thr Met Thr Pro Asp Met 275 280 285 Arg Ser Ile Thr Asn Ser Ser Asp Pro Phe Leu Asn Gly Gly Pro 290 295 300 Tyr His Ser Arg Glu Gln Ser Thr Asp Ser Gly Leu Gly Leu Gly Cys 305 310 315 320 Tyr Ser Val Pro Thr Thr Pro Glu Asp Phe Leu Ser Asn Val Asp Glu 325 330 335 Met Asp Thr Gly Glu Asn Ala Gly Gln Thr Pro Met Asn Ile Asn Pro 340 345 350 Gln Gln Thr Arg Phe Pro Asp Phe Leu Asp Cys Leu Pro Gly Thr Asn 355 360 365 Val Asp Leu Gly Thr Leu Glu Ser Glu Asp Leu Ile Pro Leu Phe Asn 370 375 380 Asp Val Glu Ser Ala Leu Asn Lys Ser Glu Pro Phe Leu Thr Trp Leu 385 390 395 400 <210> 3 <211> 1016 <212> PRT <213> Homo sapiens <400> 3 Met Val Leu Pro Thr Cys Pro Met Ala Glu Phe Ala Leu Pro Arg His 1 5 10 15 Ser Ala Val Met Glu Arg Leu Arg Arg Ile Glu Leu Cys Arg Arg 20 25 30 His His Ser Thr Cys Glu Ala Arg Tyr Glu Ala Val Ser Pro Glu Arg 35 40 45 Leu Glu Leu Glu Arg Gln His Thr Phe Ala Leu His Gln Arg Cys Ile 50 55 60 Gln Ala Lys Ala Lys Arg Ala Gly Lys His Arg Gln Pro Pro Ala Ala 65 70 75 80 Thr Ala Pro Ala Pro Ala Ala Pro Ala Pro Arg Leu Asp Ala Ala Asp 85 90 95 Gly Pro Glu His Gly Arg Pro Ala Thr His Leu His Asp Thr Val Lys 100 105 110 Arg Asn Leu Asp Ser Ala Thr Ser Pro Gln Asn Gly Asp Gln Gln Asn 115 120 125 Gly Tyr Gly Asp Leu Phe Pro Gly His Lys Lys Thr Arg Arg Glu Ala 130 135 140 Pro Leu Gly Val Ala Ser Ser Asn Gly Leu Pro Pro Ala Ser Pro 145 150 155 160 Leu Gly Gln Ser Asp Lys Pro Ser Gly Ala Asp Ala Leu Gln Ser Ser 165 170 175 Gly Lys His Ser Leu Gly Leu Asp Ser Leu Asn Lys Lys Arg Leu Ala 180 185 190 Asp Ser Ser Leu His Leu Asn Gly Gly Ser Asn Pro Ser Glu Ser Phe 195 200 205 Pro Leu Ser Leu Asn Lys Glu Leu Lys Gln Glu Pro Val Glu Asp Leu 210 215 220 Pro Cys Met Ile Thr Gly Thr Val Gly Ser Ile Ser Gln Ser Asn Leu 225 230 235 240 Met Pro Asp Leu Asn Leu Asn Glu Glu Glu Trp Lys Glu Leu Ile Glu 245 250 255 Glu Leu Asn Arg Ser Val Pro Asp Glu Asp Met Lys Asp Leu Phe Asn 260 265 270 Glu Asp Phe Glu Glu Lys Lys Asp Pro Glu Ser Ser Gly Ser Ala Thr 275 280 285 Gln Thr Pro Leu Ala Gln Asp Ile Asn Ile Lys Thr Glu Phe Ser Pro 290 295 300 Ala Ala Phe Glu Gln Glu Gln Leu Gly Ser Pro Gln Val Arg Ala Gly 305 310 315 320 Ser Ala Gly Gln Thr Phe Leu Gly Pro Ser Ser Ala Pro Val Ser Thr 325 330 335 Asp Ser Pro Ser Leu Gly Gly Ser Gln Thr Leu Phe His Thr Ser Gly 340 345 350 Gln Pro Arg Ala Asp Asn Pro Ser Pro Asn Leu Met Pro Ala Ser Ala 355 360 365 Gln Ala Gln Asn Ala Gln Arg Ala Leu Ala Gly Val Val Leu Pro Ser 370 375 380 Gln Gly Pro Gly Gly Ala Ser Glu Leu Ser Ser Ala His Gln Leu Gln 385 390 395 400 Gln Ile Ala Ala Lys Gln Lys Arg Glu Gln Met Leu Gln Asn Pro Gln 405 410 415 Gln Ala Thr Pro Ala Pro Ala Pro Gly Gln Met Ser Thr Trp Gln Gln 420 425 430 Thr Gly Pro Ser Ser Ser Leu Asp Val Pro Tyr Pro Met Glu Lys 435 440 445 Pro Ala Ser Pro Ser Ser Tyr Lys Gln Asp Phe Thr Asn Ser Lys Leu 450 455 460 Leu Met Met Pro Ser Val Asn Lys Ser Ser Pro Arg Gly Gly Pro 465 470 475 480 Tyr Leu Gln Pro Ser His Val Asn Leu Leu Ser His Gln Pro Pro Ser 485 490 495 Asn Leu Asn Gln Asn Ser Ala Asn Asn Gln Gly Ser Val Leu Asp Tyr 500 505 510 Gly Asn Thr Lys Pro Leu Ser His Tyr Lys Ala Asp Cys Gly Gln Gly 515 520 525 Ser Pro Gly Ser Gly Gln Ser Lys Pro Ala Leu Met Ala Tyr Leu Pro 530 535 540 Gln Gln Leu Ser His Ile Ser His Glu Gln Asn Ser Leu Phe Leu Met 545 550 555 560 Lys Pro Lys Pro Gly Asn Met Pro Phe Arg Ser Leu Val Pro Pro Gly 565 570 575 Gln Glu Gln Asn Pro Ser Ser Val Pro Gl Gln Ala Gln Ala Thr Ser 580 585 590 Val Gly Thr Gln Pro Pro Ala Val Ser Val Ala Ser Ser His His Ser 595 600 605 Ser Pro Tyr Leu Ser Ser Gln Gln Gln Ala Ala Val Met Lys Gln His 610 615 620 Gln Leu Leu Leu Asp Gln Gln Lys Gln Arg Glu Gln Gln Gln Lys His 625 630 635 640 Leu Gln Gln Gln Gln Phe Leu Gln Arg Gln Gln His Leu Leu Ala Glu 645 650 655 Gln Glu Lys Gln Gln Phe Gln Arg His Leu Thr Arg Pro Pro Gln 660 665 670 Tyr Gln Asp Pro Thr Gln Gly Ser Phe Pro Gln Gln Val Gly Gln Phe 675 680 685 Thr Gly Ser Ser Ala Ala Val Ser Gly Met Asn Thr Leu Gly Ser Ser 690 695 700 Asn Ser Ser Cys Pro Arg Val Phe Pro Gln Ala Gly Asn Leu Met Pro 705 710 715 720 Met Gly Pro Gly His Ala Ser Val Ser Ser Leu Pro Thr Asn Ser Gly 725 730 735 Gln Gln Asp Arg Gly Val Ala Gln Phe Pro Gly Ser Gln Asn Met Pro 740 745 750 Gln Ser Ser Leu Tyr Gly Met Ala Ser Gly Ile Thr Gln Ile Val Ala 755 760 765 Gln Pro Pro Gln Ala Thr Asn Gly His Ala His Ile Pro Arg Gln 770 775 780 Thr Asn Val Gly Gln Asn Thr Ser Val Ser Ala Ala Tyr Gly Gln Asn 785 790 795 800 Ser Leu Gly Ser Ser Gly Leu Ser Gln Gln His Asn Lys Gly Thr Leu 805 810 815 Asn Pro Gly Leu Thr Lys Pro Pro Val Val Arg Ser Ser Ala Met 820 825 830 Gly Gly Gln Asn Ser Ser Trp Gln His Gln Gly Met Pro Asn Leu Ser 835 840 845 Gly Gln Thr Pro Gly Asn Ser Asn Val Ser Pro Phe Thr Ala Ala Ser 850 855 860 Ser Phe His Met Gln Gln Gln Ala His Leu Lys Met Ser Ser Pro Gln 865 870 875 880 Phe Ser Gln Ala Val Pro Asn Arg Pro Met Ala Pro Met Ser Ser Ala 885 890 895 Ala Ala Val Gly Ser Leu Leu Pro Pro Val Ser Ala Gln Gln Arg Thr 900 905 910 Ser Ala Pro Ala Pro Ala Pro Pro Thr Ala Pro Gln Gln Gly Leu 915 920 925 Pro Gly Leu Ser Pro Ala Gly Pro Glu Leu Gly Ala Phe Ser Gln Ser 930 935 940 Pro Ala Ser Gln Met Gly Gly Arg Ala Gly Leu His Cys Thr Gln Ala 945 950 955 960 Tyr Pro Val Arg Thr Ala Gly Gln Glu Leu Pro Phe Ala Tyr Ser Gly 965 970 975 Gln Pro Gly Gly Ser Gly Leu Ser Ser Val Ala Gly His Thr Asp Leu 980 985 990 Ile Asp Ser Leu Leu Lys Asn Arg Thr Ser Glu Glu Trp Met Ser Asp 995 1000 1005 Leu Asp Leu Leu Gly Ser Gln 1010 1015 <210> 4 <211> 1156 <212> PRT <213> Homo sapiens <400> 4 Met Gly Asp Thr Ala Pro Pro Gln Ala Pro Ala Gly Gly Leu Gly Gly 1 5 10 15 Ala Ser Gly Ala Gly Leu Leu Gly Gly Gly Ser Val Thr Pro Arg Val 20 25 30 His Ser Ala Ile Val Glu Arg Leu Arg Ala Arg Ile Ala Val Cys Arg 35 40 45 Gln His His Leu Ser Cys Glu Gly Arg Tyr Glu Arg Gly Arg Ala Glu 50 55 60 Ser Ser Asp Arg Glu Arg Glu Ser Thr Leu Gln Leu Leu Ser Leu Val 65 70 75 80 Gln His Gly Gln Gly Ala Arg Lys Ala Gly Lys His Thr Lys Ala Thr 85 90 95 Ala Thr Ala Ala Thr Thr Thr Ala Pro Ala Ala Pro 100 105 110 Pro Ala Ala Ala Ala Ala Ala Ala Pro Pro Pro Pro 115 120 125 Asp Tyr His His His His Gln Gln His Leu Leu Asn Ser Ser Asn Asn 130 135 140 Gly Gly Ser Gly Gly Ile Asn Gly Glu Gln Gln Pro Pro Ala Ser Thr 145 150 155 160 Pro Gly Asp Gln Arg Asn Ser Ala Leu Ile Ala Leu Gln Gly Ser Leu 165 170 175 Lys Arg Lys Gln Val Val Asn Leu Ser Pro Ala Asn Ser Lys Arg Pro 180 185 190 Asn Gly Phe Val Asp Asn Ser Phe Leu Asp Ile Lys Arg Ile Arg Val 195 200 205 Gly Asn Leu Ser Ala Gly Gln Gly Gly Leu Gln Ile Asn Asn Gly 210 215 220 Gln Ser Gln Ile Met Ser Gly Thr Leu Pro Met Ser Gln Ala Pro Leu 225 230 235 240 Arg Lys Thr Asn Thr Leu Pro Ser His Thr His Ser Pro Gly Asn Gly 245 250 255 Leu Phe Asn Met Gly Leu Lys Glu Val Lys Lys Glu Pro Gly Glu Thr 260 265 270 Leu Ser Cys Ser Lys His Met Asp Gly Gln Met Thr Gln Glu Asn Ile 275 280 285 Phe Pro Asn Arg Tyr Gly Asp Asp Pro Gly Glu Gln Leu Met Asp Pro 290 295 300 Glu Leu Gln Glu Leu Phe Asn Glu Leu Thr Asn Ile Ser Val Pro Pro 305 310 315 320 Met Ser Asp Leu Glu Leu Glu Asn Met Ile Asn Ala Thr Ile Lys Gln 325 330 335 Asp Asp Pro Phe Asn Ile Asp Leu Gly Gln Gln Ser Gln Arg Ser Thr 340 345 350 Pro Arg Pro Ser Leu Pro Met Glu Lys Ile Val Ile Lys Ser Glu Tyr 355 360 365 Ser Pro Gly Leu Thr Gln Gly Pro Ser Gly Ser Pro Gln Leu Arg Pro 370 375 380 Pro Ser Ala Gly Pro Ala Phe Ser Ala Asn Ser Ala Leu Ser Thr 385 390 395 400 Ser Ser Pro Ile Pro Ser Val Pro Gln Ser Gln Ala Gln Pro Gln Thr 405 410 415 Gly Ser Gly Ala Ser Arg Ala Leu Pro Ser Trp Gln Glu Val Ser His 420 425 430 Ala Gln Gln Leu Lys Gln Ile Ala Ala Asn Arg Gln Gln His Ala Arg 435 440 445 Met Gln Gln His Gln Gln Gln His Gln Pro Thr Asn Trp Ser Ala Leu 450 455 460 Pro Ser Ser Ala Gly Pro Ser Pro Gly Pro Phe Gly Gln Glu Lys Ile 465 470 475 480 Pro Ser Ser Phe Gly Gln Gln Thr Phe Ser Pro Gln Ser Ser Pro 485 490 495 Met Pro Gly Val Ala Gly Gly Ser Gly Gln Ser Lys Val Met Ala Asn 500 505 510 Tyr Met Tyr Lys Ala Gly Pro Ser Ala Gln Gly Gly His Leu Asp Val 515 520 525 Leu Met Gln Gln Lys Pro Gln Asp Leu Ser Arg Ser Phe Ile Asn Asn 530 535 540 Pro His Pro Ala Met Glu Pro Arg Gln Gly Asn Thr Lys Pro Leu Phe 545 550 555 560 His Phe Asn Ser Asp Gln Ala Asn Gln Gln Met Pro Ser Val Leu Pro 565 570 575 Ser Gln Asn Lys Pro Ser Leu Leu His Tyr Thr Gln Gln Gln Gln Gln 580 585 590 Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln 595 600 605 Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Ser Ser Ile 610 615 620 Ser Ala Gln Gln Gln Gln Gln Gln Gln Ser Ser Ile Ser Ala Gln Gln 625 630 635 640 Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln 645 650 655 Gln Gln Gln Gln Gln Gln Gln Gln Gln Pro Ser Ser Gln Pro Ala Gln 660 665 670 Ser Leu Pro Ser Gln Pro Leu Leu Arg Ser Pro Leu Pro Leu Gln Gln 675 680 685 Lys Leu Leu Leu Gln Gln Met Gln Asn Gln Pro Ile Ala Gly Met Gly 690 695 700 Tyr Gln Val Ser Gln Gln Gln Arg Gln Asp Gln His Ser Val Val Gly 705 710 715 720 Gln Asn Thr Gly Pro Ser Ser Pro Ser Pro Asn Pro Cys Ser Asn Pro Asn 725 730 735 Thr Gly Ser Gly Tyr Met Asn Ser Gln Gln Ser Leu Leu Asn Gln Gln 740 745 750 Leu Met Gly Lys Lys Gln Thr Leu Gln Arg Gln Ile Met Glu Gln Lys 755 760 765 Gln Gln Leu Leu Leu Gln Gln Gln Met Leu Ala Asp Ala Glu Lys Ile 770 775 780 Ala Pro Gln Asp Gln Ile Asn Arg His Leu Ser Arg Pro Pro Pro Asp 785 790 795 800 Tyr Lys Asp Gln Arg Arg Asn Val Gly Asn Met Gln Pro Thr Ala Gln 805 810 815 Tyr Ser Gly Gly Ser Ser Thr Ile Ser Leu Asn Ser Asn Gln Ala Leu 820 825 830 Ala Asn Pro Val Ser Thr His Thr Ile Leu Thr Pro Asn Ser Ser Leu 835 840 845 Leu Ser Thr Ser His Gly Thr Arg Met Pro Ser Leu Ser Thr Ala Val 850 855 860 Gln Asn Met Gly Met Tyr Gly Asn Leu Pro Cys Asn Gln Pro Asn Thr 865 870 875 880 Tyr Ser Val Thr Ser Gly Met Asn Gln Leu Thr Gln Gln Arg Asn Pro 885 890 895 Lys Gln Leu Leu Ala Asn Gln Asn Asn Pro Met Met Pro Arg Pro Pro 900 905 910 Thr Leu Gly Pro Ser Asn Asn Asn Asn Val Ala Thr Phe Gly Ala Gly 915 920 925 Ser Val Gly Asn Ser Gln Gln Leu Arg Pro Asn Leu Thr His Ser Met 930 935 940 Ala Ser Met Pro Pro Gln Arg Thr Ser Asn Val Met Ile Thr Ser Asn 945 950 955 960 Thr Ala Pro Asn Trp Ala Ser Gln Glu Gly Thr Ser Lys Gln Gln 965 970 975 Glu Ala Leu Thr Ser Ala Gly Val Arg Phe Pro Thr Gly Thr Pro Ala 980 985 990 Ala Tyr Thr Pro Asn Gln Ser Leu Gln Gln Ala Val Gly Ser Gln Gln 995 1000 1005 Phe Ser Gln Arg Ala Val Ala Pro Pro Asn Gln Leu Thr Pro Ala Val 1010 1015 1020 Gln Met Arg Pro Met Asn Gln Met Ser Gln Thr Leu Asn Gly Gln Thr 1025 1030 1035 1040 Met Gly Pro Leu Arg Gly Leu Asn Leu Arg Pro Asn Gln Leu Ser Thr 1045 1050 1055 Gln Ile Leu Pro Asn Leu Asn Gln Ser Gly Thr Gly Leu Asn Gln Ser 1060 1065 1070 Arg Thr Gly Ile Asn Gln Pro Pro Ser Leu Thr Pro Ser Asn Phe Pro 1075 1080 1085 Ser Pro Asn Gln Ser Ser Arg Ala Phe Gln Gly Thr Asp His Ser Ser 1090 1095 1100 Asp Leu Ala Phe Asp Phe Leu Ser Gln Gln Asn Asp Asn Met Gly Pro 1105 1110 1115 1120 Ala Leu Asn Ser Asp Ala Asp Phe Ile Asp Ser Leu Leu Lys Thr Glu 1125 1130 1135 Pro Gly Asn Asp Asp Trp Met Lys Asp Ile Asn Leu Asp Glu Ile Leu 1140 1145 1150 Gly Asn Asn Ser 1155 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 tgacaaggat cccgggcagc a 21 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 gcggccgcct ataaccatgt aaga 24 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 aaatgaatcc ggcctcggcg 20 <210> 8 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 ttacagccag gttagaaagg gct 23 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 gaggaatctt gacagcgcc 19 <210> 10 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 gtaatcaacc taacacata 19 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 aggagtgggt gtgtgacga 19 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 ccaggcagtt ggctctaatc 20 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 agtagaggaa ctggtcactg g 21 <210> 14 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 tgggctagaa gtgtcttcag at 22 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 caggactgtg aagatgcggt 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 gcctgtagaa gggaaacgct 20 <210> 17 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 ggctggagag gcggctaa 18 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 gagaggtggg ttggggagtt 20 <210> 19 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 19 tgcaccagtc ggtcatcg 18 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 20 ttgaccagca gcttcacgag 20 <210> 21 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 21 agccacatcg ctcagacac 19 <210> 22 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 22 gcccaatacg accaaatcc 19

Claims

1) treating the test substance with cells expressing any one or more proteins selected from the group consisting of YAP and TAZ and MAML1 and MAML2; And
2) reducing the binding between the YAP or TAZ protein and the MAML1 or MAML2 protein in the cells of step 1), or identifying a test substance inhibiting the nuclear translocation of YAP or TAZ mediated by MAML1 or MAML2 Screening method for candidates for cancer treatment.

The method according to claim 1, wherein the YAP protein has the amino acid sequence of SEQ ID NO: 1, the TAZ protein has the amino acid sequence of SEQ ID NO: 2, the MAML1 has the amino acid sequence of SEQ ID NO: 3, and the MAML2 has the amino acid sequence of SEQ ID NO:

2. The method according to claim 1, wherein the binding between the YAP or TAZ protein and the MAML1 or MAML2 protein of step 2) is mediated by the WW domain of YAP or TAZ (W is tryptophan).

2. The method according to claim 1, wherein the binding between the YAP or TAZ protein and the MAML1 or MAML2 protein of step 2) is mediated by a PPxY motif of MAML 1 or MAML2 (P is proline, x is any amino acid, Y is tyrosine) Wherein the cancer candidate candidate substance screening method is characterized by:

The method according to claim 1, wherein the discrimination of step 2) is performed using a western blot, an immunoprecipitation assay, a proximity ligation assay, a dual luciferase reporter assay, Characterized in that the method is carried out by fluorescence (immino-fluorescence).

The cancer therapeutic candidate screening method according to claim 1, wherein the cancer is selected from the group consisting of colon cancer, stomach cancer, prostate cancer, breast cancer, kidney cancer, liver cancer, brain tumor, lung cancer, uterine cancer, colon cancer, bladder cancer and pancreatic cancer Way.

1) treating the test substance to any one or more proteins selected from the group consisting of MAML1 or MAML2 and at least one protein selected from the group consisting of YAP or TAZ; And
2) identifying a test substance that reduces binding between YAP or TAZ protein and MAML1 or MAML2 protein in step 1).

1) measuring the level of binding between the YAP or TAZ protein and the MAML1 or MAML2 protein from the test sample;
2) comparing the level of binding of step 1) with a normal control sample to determine the level of binding between the proteins to provide diagnostic information of the subject having the cancer.