CN110863001A

CN110863001A - YAP inhibitor and screening method and application thereof

Info

Publication number: CN110863001A
Application number: CN201910972857.2A
Authority: CN
Inventors: 张还添; 查振刚; 桂涛; 黎贞燕
Original assignee: Jinan University
Current assignee: Jinan University
Priority date: 2019-10-14
Filing date: 2019-10-14
Publication date: 2020-03-06

Abstract

The invention discloses a screening method of a YAP inhibitor, which utilizes TAZ and YAP recombinant plasmids with half of fluorescent groups to transfect cells, constructs heterodimers as a screening agent and screens the YAP inhibitor through fluorescence intensity. The screened YAP inhibitor is helpful to promote the preparation of related antitumor drugs, improve the curative effect of bone and chondrosarcoma related drugs, and provide clues for the research and development of new drugs.

Description

YAP inhibitor and screening method and application thereof

Technical Field

The invention relates to the technical field of medicines, in particular to a screening method and application of a YAP inhibitor.

Background

Osteosarcoma is a common primary malignant tumor for children and adolescents, has extremely poor clinical prognosis, seriously threatens the life of a patient, and brings heavy economic and mental burden to families and society.

At present, the molecular mechanism of osteosarcoma pathogenesis is still unclear, mainly comprising:

1) abnormalities in osteoblast development-related signaling pathways such as Hedghog, RUNX2, Hippo/YAP, BMP, Wnt/β -catenin, PKC, etc.;

2) abnormalities in metastasis associated signaling pathways such as Notch, Fas/FasL, Ezrin, CXCR4, VEGF, MMP-2, and MMP-9, and the like.

3) Mutation or inactivation of a key gene. Aiming at the current pathogenesis of osteosarcoma, comprehensive treatment such as early surgical excision combined with new adjuvant chemotherapy is mainly adopted at present.

However, according to the current treatment scheme, the 5-year survival rate of patients with recurrent osteosarcoma and metastatic osteosarcoma is not significantly improved, and the use of clinical high-dose chemotherapeutic drugs such as methotrexate, adriamycin and cisplatin has great side effects.

Chondrosarcoma (Chondrosarcoma) originates from cartilage connective tissue or cartilage, and the incidence rate of the Chondrosarcoma is second to that of osteosarcoma in malignant bone tumor, and accounts for about 10-20% of bone malignant tumor. Chondrosarcoma is extremely insensitive to traditional chemotherapy and radiation therapy, and surgical resection remains the primary treatment for current therapy. However, some patients still relapse after surgical resection due to the lack of effective adjuvant therapy. In addition, the clinical prognosis of chondrosarcoma is very poor, seriously threatens the life of patients and brings heavy economic and mental burden to families and society.

The Hippo-YAP pathway is a signal pathway which is discovered in recent years and has the functions of regulating organ volume and maintaining cell proliferation and apoptosis balance, and is closely related to uncontrolled proliferation of tumor cells. The major function of the Hippo-YAP pathway in mammals is to inhibit the activity of the transcriptional regulators YAP and TAZ to negatively regulate tumor progression, and thus the Hippo pathway is also considered to be a cancer suppressor pathway. Specifically, the core members of this pathway include the serine/threonine kinases MST1, MST2, LATS1 and LATS2, the scaffold proteins SAV1 (binding to MST1 and MST 2), MOB1 (binding to LATS1 and LATS 2), the transcriptional co-activator YAP, and the transcription factor TEAD, which comprises a TEA binding domain. Briefly, when the Hippo pathway is activated, MST1/2 kinase phosphorylation activates LATS1/2, activated LATS1/2 in turn phosphorylates YAP, phosphorylated YAP is inactivated and subsequently nucleated, and YAP within the cytoplasm is degraded by proteasomes.

Research has shown that the Hippo pathway is involved in the progression of various tumors, such as lung, colon, ovarian, prostate, liver, and the like. However, in human tumors, mutations in genes of the Hippo pathway occur less frequently. Based on this, it was concluded that the deregulation of the Hippo pathway in human tumors is due to cross-talk between other aberrantly expressed proteins or signaling pathways within the tumor cell and the Hippo pathway, in addition to mutations derived from key proteins of the Hippo pathway itself. In addition, the role of the Hippo signaling pathway in tumors is closely related to the nuclear translocation of YAP/TAZ. Recently, YAP was found to be highly expressed in various tumors, which was associated with high pathological grade, late TNM stage, lymph node metastasis, etc., and there was a phenomenon of nuclear localization.

Disclosure of Invention

In order to overcome the defects of the prior art, the invention aims to provide a screening method of YAP inhibitor based on fluorescence detection. The method can rapidly and effectively screen out the YAP inhibitor through the change of the intensity of a fluorescence signal by utilizing the heterodimer induced and expressed by the YAP gene expression recombinant plasmid and the TAZ gene expression recombinant plasmid with half of fluorescent groups.

Another object of the present invention is to provide a YAP inhibitor obtained by the screening method.

The invention also aims to provide the application of the YAP inhibitor in preparing bone tumor medicaments.

One of the purposes of the invention is realized by adopting the following technical scheme:

a method of screening for a YAP inhibitor comprising:

designing a primer: designing a primer pair for amplifying the YAP gene and a primer pair for amplifying the TAZ gene;

preparing a recombinant plasmid: constructing a recombinant plasmid for expressing YAP genes and a recombinant plasmid for expressing TAZ genes; wherein, the recombinant plasmid for expressing YAP gene and the recombinant plasmid for expressing TAZ gene have half of fluorescent groups respectively;

fusing: transfecting a recombinant plasmid for expressing YAP genes and a recombinant plasmid for expressing TAZ genes into cells through 6 mu L lipo2000, and carrying out induced expression to obtain a heterodimer;

constructing a screening model: adding the inhibitor to be screened into the culture medium of the cells expressing fluorescence, treating for 24-48h, and if the fluorescence intensity is weakened, the inhibitor is an effective inhibitor of YAP.

Specifically, the heterodimer was obtained by transfecting 1. mu.g of a recombinant plasmid expressing YAP gene and 1. mu.g of a recombinant plasmid expressing TAZ gene into cells through 6. mu.L of lipo2000 and inducing expression.

Further, in the step of designing the primer, the upstream primer of the TAZ is shown as SEQ ID No.1, and the downstream primer of the TAZ is shown as SEQ ID No. 2.

Further, in the step of designing the primers, the upstream primer of the YAP is shown as SEQ ID No.3, and the downstream primer of the YAP is shown as SEQ ID No. 4.

Furthermore, in the step of preparing recombinant plasmids, the carrier plasmids for expressing YAP and TAZ genes are bimolecular fluorescence complementary carrier plasmids.

Furthermore, in the step of preparing the recombinant plasmid, the vector plasmid for expressing YAP gene is pCMV-Myc-VN 155-Linker-MCS.

Furthermore, in the step of preparing the recombinant plasmid, the carrier plasmid for expressing the TAZ gene is pCMV-HA-VC 155-Linker-MCS.

Furthermore, in the step of preparing recombinant plasmids, human TAZ and YAP genes are amplified by taking human 293T cell cDNA as a template.

The second purpose of the invention is realized by adopting the following technical scheme:

YAP inhibitors obtained by the screening method described above.

The third purpose of the invention is realized by adopting the following technical scheme:

the YAP inhibitor is applied to preparing bone tumor medicaments.

Compared with the prior art, the invention has the beneficial effects that:

the invention utilizes TAZ and YAP recombinant plasmids constructed by a fluorescence complementary vector to transfect cells, constructs to obtain heterodimer as a screening agent, and detects the inhibition degree of an inhibitor on the expression of YAP genes and induced cell cycle retardation through the change of fluorescence intensity; the screened YAP inhibitor has larger application potential in preparing bone tumor medicaments.

Drawings

FIG. 1 is a graph of the fluorescence localization of YAP in osteosarcoma tissues of varying degrees of differentiation;

FIG. 2 is a graph of the fluorescence localization of YAP in chondrosarcoma tissues of varying degrees of differentiation;

FIG. 3 is a graph of the fluorescence localization of YAP in chondrocyte lines and chondrosarcoma cells;

FIG. 4 is a graph of the effect of siRNA knockdown YAP on chondrosarcoma cells SW 1353;

FIG. 5 is a graph of the effect of shRNA knockdown of YAP on chondrosarcoma cells SW 1353;

FIG. 6 is a graph showing the effect of suppressing the growth of transplanted tumors in nude mice by knocking-down YAP;

FIG. 7 is a map of a recombinant plasmid expressing the TAZ gene;

FIG. 8 is a map of a recombinant plasmid expressing YAP gene;

FIG. 9 is a graph of the effect of JQ1 on YAP expression in SW 1353 and Hs819.T cells;

FIG. 10 is a graph of the effect of 17-AAG on YAP expression in U2 OS and Saos-2 cells;

FIG. 11 is a graph of 17-AGG induced cell cycle arrest with U2 OS and Saos-2;

FIG. 12 is a graph showing the effect of 5-AZA on YAP expression in U2 OS and Saos-2 cells;

FIG. 13 is a graph of 5-AZA versus U2 OS and Saos-2 induced cell cycle arrest.

FIG. 14 is a schematic diagram showing fluorescence emission of a recombinant plasmid expressing TAZ gene and a recombinant plasmid expressing YAP gene fused to each other in SW 1353 cells.

Detailed Description

The present invention is further described below with reference to specific embodiments, and it should be noted that, without conflict, any combination between the embodiments or technical features described below may form a new embodiment.

The following are specific examples of the present invention, and raw materials, equipments and the like used in the following examples can be obtained by purchasing them unless otherwise specified.

YAP gene was given by the central laboratory tumor group of the first hospital affiliated to the university of river-south, the CDS region sequence of human TAZ (NM-000116.5) was searched according to NCBI website, and the CDS region sequence was obtained by PCR amplification of human cDNA sequence; the pCMV-HA-VC155-Linker-MCS and the pCMV-Myc-VN155-Linker-MCS plasmids are presented by the professor Huchang lantern of the medical chemistry and molecular pharmacology department of the university of Puzhu, USA.

The chondrosarcoma tissue chip is commercially available.

The present invention provides a method for synthesizing a heterodimer of YAP and TAZ

Example 1: expression and localization of YAP in osteosarcoma tissue and chondrosarcoma

To further systematically investigate the biological significance of YAP in osteosarcoma, we used a tissue chip in combination with immunohistochemical method to detect YAP expression in osteosarcoma and chondrosarcoma tissues of different degrees of differentiation.

The purchased chondrosarcoma tissue chip (US Biomax, including osteosarcoma and chondrosarcoma tissues with different degrees of differentiation) was subjected to standard immunohistochemical experiments, and the chip was scanned and imaged by Aperio Scanscope XT (Leica, Germany) instrument for observation and analysis of YAP localization and expression in osteosarcoma and chondrosarcoma with different degrees of differentiation. Immunohistochemical results are shown in FIG. 1-A and FIG. 2-A; immunohistochemical results (including clinical follow-up data) were scored by two highly experienced pathologist's scoring and statistically analyzed for association of YAP expression with chondrosarcoma differentiation and patient survival prognosis, with semi-quantitative statistical analysis shown in FIGS. 1-B and 2-B and cell localization statistical analysis shown in FIGS. 1-C and 2-C.

Scoring criteria for immunohistochemistry: two parameters, staining intensity and staining percentage, were set. The staining intensity was classified into four grades (-, +, + +, + ++) of 0-3. The percentage of positive cells was defined as 0-10 (e.g., 1 represents 10% of the cells stained independent of staining intensity; 10 represents 100% of the cells stained). Total staining score (0-30) is the staining intensity x percentage of positive cells. The total score for cell staining was (0-60) by determining the scores for the nucleus (0-30) and the cytoplasm (0-30), respectively.

From the results of FIGS. 1-A and 1-B, it can be seen that: the expression level of YAP is inversely related to the degree of differentiation of osteosarcoma. The results in FIG. 1-C suggest that YAP expression in the cytoplasm as well as the nucleus is closely associated with the onset of osteosarcoma.

From the results of FIGS. 2-A and 2-B, it can be seen that: the expression level of YAP is inversely related to the degree of chondrosarcoma differentiation. These results suggest that high expression of YAP is associated with the onset of chondrosarcoma, and that YAP in the nucleus may play a major role.

Example 2: subcellular localization of YAP

The chondrocyte line CHON-001 and the chondrosarcoma cell line SW 1353 were purchased from ATCC. Chondrosarcoma cell line hs819.t was purchased at north nakai institute of biotechnology.

A24-well plate is placed on a polylysine-embedded slide, and the cell density is set to be high or low according to the cell doubling time. After the cells adhere to the surface, taking out the cover glass, rinsing with PBS, fixing with 4% paraformaldehyde, perforating with 0.2% Triton X-100 for 30min, sealing with 5% non-fat dry mil for 1h at room temperature, adding (dilution 1: 1000) primary antibody working solution (YAP), standing overnight at 4 ℃, washing with PBS for 2-3 times, adding fluorescent secondary antibody/DAPI/pharloid-AlexaFlourr 573 compound labeled with Alexa Flourr 488, incubating for 1h at room temperature, rinsing with PBS, and sealing with neutral gum. The negative control replaced the primary antibody with PBS, and the experimental control was stained with uninduced cell slides. Subcellular localization of YAP was observed under a laser confocal microscope.

Also, as shown in FIG. 3-A, in chondrocytes CHON-001, YAP is localized mainly in the cytoplasm. Interestingly, as shown in fig. 3-B, YAP was localized mainly to the nucleus in chondrosarcoma SW 1353 cells. These results suggest that: cytoplasmic YAP does contribute to the maintenance of the cartilage phenotype, whereas nuclear translocation of YAP is likely involved in the development of chondrosarcoma.

Example 3: YAP-knocking-down siRNA kit

A YAP-knocking siRNA kit contains one or more than two of siY #1, siY #2, siY #3 and siY #4, and the sequence of the kit is shown as follows:

siY#1，SEQ ID No.1：GACGACCAAUAGCUCAGAUTT；

siY#2，SEQ ID No.2：GCAUCUUCGACAGUCUUCUTT；

siY#3，SEQ ID No.3：GGUCAGAGAUACUUCUUAATT；

siY#4，SEQ ID No.4：GGUGAUACUAUCAACCAAATT。

western Blot (WB) detected YAP expression: the chondrosarcoma cell line in logarithmic growth phase is inoculated into a culture dish of 6cm, total cell protein is extracted after treatment, 5 xSDS buffer solution (diluted to 1 x) is added, and the cell is boiled for 5min at 95 ℃. Taking 20-30 mu g of protein, carrying out SDS-PAGE gel electrophoresis separation, concentrating gel for 5 percent, separating gel for 8-15 percent, and carrying out electrophoresis for 2 hours at 100V. The film was rotated at 230mA for 1 h. The PVDF membrane was removed, blocked with blocking solution (containing 5% non-fat dry mil) at room temperature for 1h, and added with 1: primary antibody (YAP) diluted at 1000 ℃, buffered at 4 ℃, washed the next day, added 1: 1000 secondary antibodies (rabbit antibodies) and reacting for 1h at room temperature. After washing, 1ml of ECL luminescence solution is added, the solution is shaken for 1min at room temperature, scanned by a gel imaging system, and the result is stored. As shown in fig. 4A-C, transient knockdown of YAP significantly inhibited chondrosarcoma cell growth.

SW 1353 cells were transfected by siY #1-siY #4, total protein was extracted after 4 days, and expression of YAP and internal reference by WB detection is shown in FIG. 4-A; observing the morphology and amount of the cells under a phase contrast microscope as shown in FIG. 4-B; trypan blue staining and counting are shown in FIG. 4-C. P <0.0001, n.s., p > 0.05.

As can be seen from this example, siRNA has a significant inhibitory effect against osteosarcoma.

Example 4: shRNA kit for knocking down YAP

An shRNA kit for knocking down YAP, which comprises one or more of siY #1, siY #2, siY #3 and siY #4 and a lentivirus interference vector, wherein the sequences of siY #1, siY #2, siY #3 and siY #4 are shown as follows in sequence:

shY#1，SEQ ID No.5：CTTCTTAAATCACATCGATCA；

shY#2，SEQ ID No.6：CATAAGAACAAGACCACCTCT；

shY#3，SEQ ID No.7：CACAGGCAATGCGGAATATCA；

shY#4，SEQ ID No.8：CCTTAACAGTGGCACCTATCA。

the lentiviral interference Vector was pGLV3/H1/GFP + Puro Vector, purchased from GenePharma Co, Ltd.

The shRNA of the lentiviral vector was transfected into HEK 293T cells using Lipofectamine2000, and the cells were changed after 6 h. After 48h, the viral supernatant was collected, extracted and concentrated. SW 1353 cells were then infected in 10mL of complete medium at a concentration of 20 for 24h with an infection index (MOI) and then screened with puromycin at 2mg/mL for 2 passages for 3d to establish stable cell lines. The CCK-8 method detects the influence of knocking-down YAP on the cell activity: taking SC or shYAP stable transfer cell line in logarithmic growth phase, trypsinizing and counting, and counting at 2 × 10³The density per well was inoculated into a 96-well plate (3 replicates), 10. mu.L of CCK-8 was added after incubation at 37 ℃ for various time points in an incubator, the plate was incubated for 1-4h in the incubator, absorbance at 450nm was measured, and the proliferation status of the cells was evaluated.

Wherein, A (treatment): absorbance of wells with cells, CCK-8 solution and drug solution;

a (blank): absorbance of wells with medium and CCK8 solution without cells;

a (no treatment): absorbance of wells with cells, CCK8 solution, but no drug solution.

Clone formation experiments with knockdown YAP: SC or shYAP stable transfer cell lines in the logarithmic growth phase are taken, trypsinized and counted, and inoculated into 6-well plates according to the density of 1000 cells per well. After induction for 9d, the medium was removed and washed 3 times with PBS. And dyeing for 5min by adopting a crystal violet solution. The number of clones (greater than 50 cells) was counted under light microscopy and statistically analyzed.

Similarly, the same results of inhibiting chondrosarcoma growth were obtained in stably knockdown YAP cell lines (shY #3, shY #4), as shown in fig. 5A and 5-B. In addition, the knockdown of YAP significantly inhibited chondrosarcoma cell clonogenic, as shown in FIGS. 5-C and 5-D. The results indicate that YAP expression is critical for the proliferation of chondrosarcoma cells.

Example 5: suppression of growth of nude mouse transplanted tumor by knocking-down YAP

This example uses shY #3 and shY #4 as knockdown reagents and studies the effect of knockdown YAP on graft growth using a nude mouse graft model.

The stable transfected cell lines (control, shY #3, shY #4) were inoculated subcutaneously into nude mice, and tumor volume (volume ═ length × width) was measured 9 days later²) /2), measured every 3 days, and nude mice were sacrificed on day 30.

The results are shown in FIG. 6. As shown in fig. 6-a, over time, knockdown YAP significantly inhibited the growth of nude mouse transplantable tumors (n-5). As shown in fig. 6-B and 6-C, in vivo and ex vivo morphometrically, knockdown YAP significantly inhibited the increase in volume of the transplanted tumors. These in vivo results suggest that knockdown of YAP significantly inhibits chondrosarcoma cell proliferation.

Example 6: establishment of YAP/TAZ heterodimer screening system

1) Designing a primer:

designing an amplification primer pair TAZ-SalI-F and TAZ-KpnI-R of the TAZ gene; the sequences of TAZ-SalI-F and TAZ-KpnI-R are shown as SEQ ID No.9 and SEQ ID No. 10; the designed amplification primers YAP-BglII-F and YAP-NotI-R of YAP gene are shown in SEQ ID No.11 and SEQ ID No. 12.

TAZ-SalI-F，SEQ ID No.9：CTGTCGACCATGCCTCTGCACGTGAAGTG；

TAZ-KpnI-R，SEQ ID No.10：CTGGTACCCTATCTCCCAGGCTGGAGGTG；

YAP-BglII-F，SEQ ID No.11:GAAGATCTCTATGGATCCCGGGCAGCAG；

YAP-NotI-R，SEQ ID No.12:

TAAAGCGGCCGCCTATAACCATGTAAGAAAGCTTTC；

2) Constructing a recombinant plasmid;

human 293T cell cDNA and YAP gene are used as template, PCR technology is used to amplify human TAZ and YAP gene separately. The TAZ gene and the pCMV-HA-VC155-Linker-MCS are recovered after double enzyme digestion by restriction enzymes SalI and KpnI, the T4 ligase inserts the human TAZ gene into a linearized pCMV-HA-VC155-Linker vector to construct a pCMV-HA-VC155-Linker-TAZ recombinant plasmid, and the plasmid map is shown in figure 7.

YAP gene and pCMV-Myc-VN155-Linker-MCS are recovered after double enzyme digestion by restriction enzyme BglII and NotI, human YAP gene is inserted into linearized pCMV-Myc-VN155-Linker vector by T4 ligase, and pCMV-Myc-VN155-Linker-YAP recombinant plasmid is constructed, and plasmid map is shown in figure 8.

Example 7: screening for YAP-targeted inhibitors

1) Inhibition of YAP expression in SW 1353 and Hs819.T cells by JQ1

Treating chondrosarcoma cell lines SW 1353 and Hs819.T cells with JQ1 of different concentrations for 24 hours, wherein the concentration of JQ1-2 is 2 muM, and the concentration of JQ1-20 is 20 muM; JQ1#1 at a concentration of 2. mu.M; JQ1#2 at a concentration of 20 μ M; using DMSO as a control, collect cell total proteins, add heterodimer obtained in example 6 for PCR amplification, and detect expression of YAP and internal controls using WB.

The expression level of YAP inhibited by JQ1 is shown in FIG. 9, and JQ1 significantly down-regulates the expression of YAP.

2)17-AAG inhibition of YAP expression in U-2OS and Saos-2 cells

Respectively treating human osteosarcoma cells (U-2OS) and human osteosarcoma cells (Saos-2) with 17-AAG and JQ1 for 24h, collecting cell total protein, adding the heterodimer obtained in example 6 for PCR amplification, and detecting the expression of YAP and internal reference by WB; controls for treatments 24h and 48h were set and the induction of cell cycle arrest was detected periodically by flow cytometry.

As a result of suppressing the expression amount of YAP by 17-AAG and JQ1, as shown in FIG. 10, JQ1 suppressed the expression of YAP almost completely, and 17-AAG also suppressed the expression of YAP effectively. The induction of cell cycle arrest by 17-AAG is shown in FIG. 11, which indicates that 17-AAG not only inhibits cell proliferation by reducing YAP expression, but also promotes apoptosis by inducing G2/M phase arrest.

3) Inhibition of YAP expression in U-2OS and Saos-2 by gradient concentrations of 5-AZA

Human osteosarcoma cells (U-2OS) and human osteosarcoma cells (Saos-2) were treated for 24 hours using 5-50 μm of 5-AZA as an inhibitor, and whole cell proteins were collected, and then PCR amplification was performed by adding the heterodimer obtained in example 6 using DMSO as a control, and expression of YAP and internal control was detected using WB. Controls for treatments 24h and 48h were set and the induction of cell cycle arrest was detected periodically by flow cytometry.

The expression level of YAP inhibited by 5-AZA is shown in FIG. 12, which indicates that 5 μm of 5-AZA can not significantly inhibit the expression of YAP in U-2OS, but 10 μm of 5-AZA can significantly inhibit the expression of YAP, and 50 μm of 5-AZA can effectively inhibit the expression of YAP; however, 5 μm of 5-AZA was effective in inhibiting the expression of YAP in U-2OS, and 50 μm of 5-AZA showed no substantial expression of YAP;

induced cell cycle arrest as shown in FIG. 13, it is suggested that 5-AZA may cause cell cycle arrest in G1 phase of U-2OS cells by reducing YAP expression, inhibiting cell proliferation.

Example 8: fluorescence detection

4000 SW 1353 cells were seeded in a 3.5cm dish, 24h after adherence, 1. mu.g of recombinant plasmid expressing YAP gene and 1. mu.g of recombinant plasmid expressing TAZ gene were transfected into the cells by 6. mu.L of lipo2000, transfected for 4h, induced to express to obtain heterodimer, and observed under a confocal microscope. The schematic diagram of fluorescence emitted by fusion of the recombinant plasmid expressing the TAZ gene and the recombinant plasmid expressing the YAP gene is shown in FIG. 14, and fluorescence is observed under a confocal microscope, which indicates that the recombinant plasmid expressing the YAP gene and the recombinant plasmid expressing the TAZ gene are fused.

The above embodiments are only preferred embodiments of the present invention, and the protection scope of the present invention is not limited thereby, and any insubstantial changes and substitutions made by those skilled in the art based on the present invention are within the protection scope of the present invention.

SEQUENCE LISTING

<110> river-south university

<120> YAP inhibitor and screening method and application thereof

<130>1

<160>12

<170>PatentIn version 3.3

<210>1

<211>21

<212>DNA

<213> Artificial sequence

<400>1

gacgaccaau agcucagaut t 21

<210>2

<211>21

<212>DNA

<213> Artificial sequence

<400>2

gcaucuucga cagucuucut t 21

<210>3

<211>21

<212>DNA

<213> Artificial sequence

<400>3

ggucagagau acuucuuaat t 21

<210>4

<211>21

<212>DNA

<213> Artificial sequence

<400>4

ggugauacua ucaaccaaat t 21

<210>5

<211>21

<212>DNA

<213> Artificial sequence

<400>5

cttcttaaat cacatcgatc a 21

<210>6

<211>21

<212>DNA

<213> Artificial sequence

<400>6

cataagaaca agaccacctc t 21

<210>7

<211>21

<212>DNA

<213> Artificial sequence

<400>7

cacaggcaat gcggaatatc a 21

<210>8

<211>21

<212>DNA

<213> Artificial sequence

<400>8

ccttaacagt ggcacctatc a 21

<210>9

<211>29

<212>DNA

<213> Artificial sequence

<400>9

ctgtcgacca tgcctctgca cgtgaagtg 29

<210>10

<211>29

<212>DNA

<213> Artificial sequence

<400>10

ctggtaccct atctcccagg ctggaggtg 29

<210>11

<211>28

<212>DNA

<213> Artificial sequence

<400>11

gaagatctct atggatcccg ggcagcag 28

<210>12

<211>36

<212>DNA

<213> Artificial sequence

<400>12

taaagcggcc gcctataacc atgtaagaaa gctttc 36

Claims

1. A method for screening YAP inhibitors, comprising:

fusing: transfecting a recombinant plasmid for expressing YAP genes and a recombinant plasmid for expressing TAZ genes into cells through lipo2000, and carrying out induced expression to obtain a heterodimer;

2. The screening method of claim 1, wherein in the step of designing primers, the upstream primer of the TAZ is shown as SEQ ID No.1 and the downstream primer of the TAZ is shown as SEQ ID No. 2.

3. The screening method of claim 1, wherein in the step of designing primers, the YAP upstream primer is shown as SEQ ID No.3 and the YAP downstream primer is shown as SEQ ID No. 4.

4. The screening method according to claim 1, wherein in the step of preparing recombinant plasmids, the vector plasmids for expressing the YAP and TAZ genes are each a bimolecular fluorescent complementary vector plasmid.

5. The screening method of claim 1, wherein in the step of preparing a recombinant plasmid, the vector plasmid expressing YAP gene is pCMV-Myc-VN 155-Linker-MCS.

6. The screening method according to claim 1, wherein in the step of preparing a recombinant plasmid, the vector plasmid for expressing the TAZ gene is pCMV-HA-VC 155-Linker-MCS.

7. The screening method according to claim 1, wherein in the step of preparing the recombinant plasmid, human TAZ and YAP genes are amplified using human 293T cell cDNA as a template.

8. An inhibitor of YAP obtained by the screening method of any one of claims 1 to 7.

9. The use of a YAP inhibitor as defined in claim 8 in the preparation of a bone tumor medicament.