KR101634958B1

KR101634958B1 - probes, kits and methods for detecting mutation of filaggrin gene

Info

Publication number: KR101634958B1
Application number: KR1020140071922A
Authority: KR
Inventors: 황준성; 김보연; 김대환; 성낙균; 안종석
Original assignee: 한국생명공학연구원
Priority date: 2014-06-13
Filing date: 2014-06-13
Publication date: 2016-06-30
Also published as: KR20150143025A; WO2015190655A1

Abstract

The present invention relates to a probe complementarily binding to a filaggrin mutant nucleic acid sequence and a method for detecting a pilar green gene mutation using the same. More particularly, the present invention relates to a PNA probe complementary to a filaggrin gene, Using FMCA using the difference of mutation type binding force, it is possible to diagnose the etiology of atopic dermatitis by providing the convenience of simple, rapid and accurate discrimination of pilar green gene mutation. Especially, The possibility of developing atopic dermatitis can be promptly diagnosed and the incidence can be lowered

Description

{Probe, kits and methods for detecting mutation of filaggrin gene}

The present invention relates to probes, kits and methods for filaggrin gene mutation detection.

The skin is located at the outermost part of the body in anatomy, and it blocks the direct inflow of pathogenic microorganisms, viruses and chemicals in the air, thereby protecting the body from the external environment and an important 'barrier' function '. The filaggrin protein is expressed in the superficial epithelium including the stratum corneum in the skin, and is one of the main proteins indispensable for the formation of the skin-specific 'barrier function' described above.

Based on the results of several pathological and pathological studies including mutation studies of pilar green genes, atopic dermatitis is divided into extrinsic and intrinsic (Tokura Y (2010) Extrinsic and intrinsic types of atopic dermatitis, J. Dermatol. Sci. 58, 1-7). In the case of intrinsic atopy, the pathologic factors are mainly internal to the human body, resulting in abnormal immune and inflammatory responses due to impaired immune function. In the case of exogenous atopy, due to genetic or environmental factors, Which is caused by external influenza viruses, viruses, chemicals, and the like. Therefore, there is a need for different treatment methods depending on the pathological findings, that is, establishing customized treatment for individual patients.

In recent years, the correlation between atopic dermatitis and mutation of the filaggrin gene has been first elucidated by European researchers (Palmer CN et al. (2006).) Common loss-of-function variants of the epidermal barrier protein filaggrin a major predisposing Factor of atopic dermatitis, Nat. Genet. 38, 441-6.) In Europe, mutations in the pilana green gene were detected in more than half of all atopic patients. In Japan, at least 25% of atopic patients have a mutation in the pilar green gene (Osawa R et al. (2010) Japanese-specific filaggrin gene mutations in Japanese patients suffering from Atopic Eczema and Ashthma, J. Invest (Dermatol., 130, 2834-6.), Mutations in the fila green gene were detected in patients with atopic dermatitis also in many Asian countries including China and Korea (Osawa R et al. the risk of developing allergic disorders, Allergology International 60, 1-9.).

Among the findings of the mutation study of the pilar green gene, it is noteworthy that mutations found in each race or locality are significantly different from each other (Osawa R et al. (2011) Filaggrin gene defects and the risk of developing allergic disorders, Allergology International 60, 1-9.). According to the previous results, except for R501X and E2422X mutations commonly found in Europeans and Asians, and 3321delA, which is commonly found in both East Asian and Korean Japanese, the location of the mutation varies considerably depending on race and region .

On the other hand, PNA is an abbreviation of peptide nucleic acids. It is one of substances that recognize and bind DNA base sequences of genes such as LNA (Locked nucleic acid) and MNA (Mopholino nucleic acid), and it can be artificially synthesized. Consists of. The major reason for using PNA for gene mutation detection is that it has excellent affinity and selectivity with DNA. In other words, the binding force between PNA and DNA is much superior to that of DNA (DNA-DNA), and even if only one base is miss-match between the base sequence of DNA complementary to PNA probe, (Melting Temperature = Tm) value. Using these differences in Tm values (i.e., difference in binding force), it is possible to easily detect changes in SNPs and mutation bases (sequences), and development of a detection kit using the same is also easy. The other advantage is that the nucleic acid degrading enzyme is highly stable and can not be decomposed into an existing restriction enzyme, and it is advantageous in that it is very easy to store because of high thermal and chemical properties and stability.

In addition, PNA probes are very easy to design, unlike other well-known probes (TaqMan probes, Molecular beancon probes, Scorpion probes), and usually contain 11 to 18 mer bases Sequence. In particular, it is possible to design a probe having a specific melting temperature (Tm) value desired by 1) adjusting the melting temperature (Tm) value according to the length of the PNA probe, or 2) (Tm) value can be adjusted. Because PNA has better binding ability than DNA, it can be designed shorter than DNA because of its higher basic melting temperature (Tm), and it is very easy to detect SNPs and mutations that are close to each other.

Accordingly, the present inventors have made efforts to develop a method and a kit for detecting a mutation in Pila green gene, and have developed a probe that binds to a Pilla green mutation using the characteristics of PNA and can use it for diagnosis of atopic dermatitis Thereby completing the present invention.

Palmer CN et al. (2006) Common loss-of-function variants of the epidermal barrier protein filaggrin a major predisposing factor of atopic dermatitis, Nat. Genet. 38, 441-6. Osawa R et al. (2010) Japanese-specific Filaggrin gene mutations in Japanese patients suffering from Atopic Eczema and Ashthma, J. Invest. Dermatol. 130, 2834-6. Osawa R et al. (2011) Filaggrin gene defects and the risk of developing allergic disorders, Allergology International 60, 1-9.

An object of the present invention is to provide a probe complementarily binding to a filaggrin mutant nucleic acid sequence and a method for detecting a filaggrin gene mutation using the probe.

In order to achieve the above object,

The present invention provides a probe that binds complementarily to a filaggrin gene mutant nucleic acid sequence.

In addition,

1) preparing a probe complementarily binding to a filamentous green gene;

2) treating the specimen with the probe of step 1);

3) analyzing the subject in comparison with the control group.

The present invention also provides a pilar green gene mutation detection kit comprising a probe complementarily binding to a filaggrin mutant nucleic acid sequence.

The probe complementarily binding to the filaggrin gene mutant nucleic acid sequence of the present invention and the method for detecting the pilar green gene mutation using the probe can provide a convenient and simple discrimination of the pilar green base mutation, The diagnosis of the etiologic factor of the patient becomes possible, and the possibility of the development of atopic dermatitis can be promptly diagnosed at the infant and childhood period immediately after birth, and the incidence can be lowered.

Brief Description of the Drawings Fig. 1 is a diagram showing PCR conditions for mutation detection of Pila green gene and FMCA analysis of PNA probes. Fig.
FIG. 2 is a diagram showing a mutation of the Pella green gene and a PNA melting curve of a normal individual. The blue solid line represents the normal type, the green solid line represents the Heterozygote mutation, and the red solid line represents the Homozygote mutation Respectively.

Hereinafter, the present invention will be described in detail.

The nucleic acid sequence may be an oligonucleotide, DNA, or RNA, and includes a mixture including the oligonucleotide, DNA, and RNA.

The probe may be oligonucleotide, DNA, RNA, Taqman, LNA, MNA, PNA, but is not limited thereto and includes all substances capable of complementarily binding to a nucleic acid sequence.

In one embodiment, the PNA was prepared by the process according to Korean Patent No. 464261.

The PNA probe may include any one of SEQ ID NO: 1 to SEQ ID NO: 5, but is not limited thereto and includes all sequences capable of complementarily binding to a pilar green gene mutation sequence.

The PNA probe may be used for the detection of pilar green gene mutation and the filaggrin gene mutation may be selected from the group consisting of K4022X, K4021X, K4671X, 3321delA, S2554X, S2889X, S3296X, R501X, 2282del4, 3673delC, 3702delG, R1474X, 5360delG, 6867delAG, E2422X , 7267 delCA, R2447X, S3247X, 11029delCA, 11033del4, Q3683X, 441delA, 1249insG, S1695X, Q1701X, E1795X, Q2417X, 7945delA, or R4307X, but is not limited thereto and genes encoding the homologues, All of which may be dermatitis, and all pilar green gene mutations that can cause dermatitis.

The pilagreen gene is a human profilagra green gene represented by the nucleotide sequence of RefSeq NM_002016, or a nucleotide sequence having the same activity as the above gene or having the same gene position on the chromosome, one or several bases added, deleted or substituted &Lt; / RTI >

The filaggrin gene has more than 80% homology, more specifically more than 90% homology, most specifically 95%, 96%, 97%, 98%, 99% or 99.5% homology to the nucleotide sequence of RefSeq NM_002016 But it is not limited thereto.

The filaggrin gene mutations K4022X, K4021X, K4671X, 3321delA, S2554X, S2889X, S3296X, R501X, 2282del4, 3673delC, 3702delG, R1474X, 5360delG, 6867delAG, E2422X, 7267delCA, R2447X, S3247X, 11029delCA, 11033del4, Q3683X, 441delA, 1249insG, S1695X, Q1701X, E1795X, Q2417X, 7945delA, or R4307X are described in Sandilands et al. (2007) Comprehensive analysis of the gene encoding filaggrin uncovers prevalent and rare mutations in ichthyosis vulgaris and atopic eczema, Nature Genetics 39, 650 Based on the supplementary data on page 3-38 of I-654, we have the following nucleotide sequence.

K4022X (K4021X, K4671X) is a nonsense mutation in which the amino acid sequence is changed from Lys (AAA) to TAA, which is the 12064th nucleotide sequence of the pilar green gene, .

3321delA is a mutation in which A, which is the 3321st base sequence of the fila green gene, is deleted.

S2554X is a stop mutation in which the amino acid sequence is changed from Ser (TCA) to the termination codon TGA by substituting C, the 7661th base sequence of the pilar green gene, into G.

S2889X is a stop mutation in which the 1967th nucleotide sequence of the filament green gene and the 1968th nucleotide sequence C are changed to G and A, respectively, and the amino acid sequence is changed from Ser (TCC) to the termination codon TGA. However, the positions of the repeat genes 7, 8.1, 8.2, 9, 10.1, 10.2, and 11 are designated by designating the nucleotide sequences of the fragments in accordance with Sandilands et al. Supplementary Data page 28-38.

S3296X is a stop mutation in which amino acid sequence changed from Ser (TCA) to TAA, which is the 9887th nucleotide sequence of the filaggrin gene, with C changed to A.

R501X is a stop mutation in which amino acid sequence is changed from Arg (CGA) to TGA, which is a termination codon, with the C 1501 base sequence of the filaggrin gene changed to T.

2282del4 is a mutation in which CAGT, which is the nucleotide sequence 2282-5 of the fila green gene, is deleted.

The 3673 delC is a mutation in which C, the 3673rd base sequence of the pilar green gene, is deleted.

3702delG is a mutation in which G is the 3702-th base sequence of the pilar green gene.

The R1474X is a stop mutation in which the amino acid sequence is changed from Arg (CGA) to TGA, which is a termination codon, in which C, which is the 4420th base sequence of the pilar green gene, is changed to T.

5360delG is a mutation in which G, the 5360th base sequence of the fila green gene, is deleted.

6867 delAG is a mutant in which AG gene, the 6867-8th base sequence of the pilar green gene, is deleted.

E2422X is a stop mutation in which the amino acid sequence is changed from Glu (GAA) to TAA, which is the 7264th nucleotide sequence of the pilar green gene and G is changed to T.

The 7267 delCA is a mutant in which the CA 7267-8 base sequence of the pilar green gene is deleted.

R2447X is a stop mutation in which the amino acid sequence is changed from Arg (CGA) to TGA, which is a termination codon, with C being the 7339th base sequence of the Pilar green gene.

S3247X is a stop mutation in which amino acid sequence is changed from Ser (TCA) to TAA, which is the 9740th nucleotide sequence of the filaggrin gene and C is changed to A.

The 11029 del CA is a mutant in which CA is deleted, which is the 11029-30 th base sequence of the pilar green gene.

11033del4 is a mutant in which CAGT, which is the 11033-6 th base sequence of the pilar green gene, is deleted.

Q3683X is a stop mutation in which the amino acid sequence is changed from Gln (CAG) to TAG, which is a termination codon, in which C, which is the 11050th base sequence of the Pilar green gene, is changed to T.

441delA is a mutation in which A, which is the 441th base sequence of the pilar green gene, is deleted.

The 1249ins G is a mutation in which G, the nucleotide sequence at position 1249 of the pilar green gene, is inserted.

S1695X is a stop mutation in which the amino acid sequence is changed from Ser (TCA) to the termination codon TGA by substitution of C, which is the 5084th base sequence of the pilar green gene, with G.

Q1701X is a stop mutation in which the amino acid sequence is changed from Gln (CAA) to the termination codon TAA, with C being the 5101th base sequence of the Pilar green gene changed to T.

The E1795X is a stop mutation in which the amino acid sequence is changed from Glu (GAG) to TAG, which is a truncation codon, in which G, the 5383th base sequence of the pilar green gene, is changed to T.

The Q2417X is a stop mutation in which the amino acid sequence is changed from Gln (CAG) to TAG, which is the 6277th nucleotide sequence of the filaggrin gene and C is changed to T.

The 7945delA is a mutation in which the A, which is the 7945th base sequence of the pilar green gene, is deleted.

The R4307X is a stop mutation in which the amino acid sequence is changed from Arg (CGA) to TGA, which is the 4273th nucleotide sequence of the filaggrin gene, and C is changed to T and the termination codon is changed to Arg. However, the positions of the repeat genes 7, 8.1, 8.2, 9, 10.1, 10.2, and 11 are designated by designating the nucleotide sequences of the fragments in accordance with Sandilands et al. Supplementary Data page 28-38.

The filaggrin gene mutations K4022X, K4021X, K4671X, 3321delA, S2554X, S2889X, S3296X, R501X, 2282del4, 3673delC, 3702delG, R1474X, 5360delG, 6867delAG, E2422X, 7267delCA, R2447X, S3247X, 11029delCA, 11033del4, Q3683X, 441delA, 1249insG, S1695X, Q1701X, E1795X, Q2417X, 7945delA, or R4307X may be composed of base sequences having the same activity or addition or deletion or substitution of one or several bases over the same gene position on the chromosome.

The filaggrin gene mutations K4022X, K4021X, K4671X, 3321delA, S2554X, S2889X, S3296X, R501X, 2282del4, 3673delC, 3702delG, R1474X, 5360delG, 6867delAG, E2422X, 7267delCA, R2447X, S3247X, 11029delCA, 11033del4, Q3683X, More preferably 90% or more homology, most specifically 95%, 96%, 97%, 95%, 96%, 97% or more homology to each of the above base sequences. 98%, 99% or 99.5% or more homology with the nucleotide sequence shown in SEQ ID NO.

In one embodiment, the PNA probe is labeled with a reporter and a quencher, and such quencher may be dabcyl. Preferably, the PNA is labeled with a quencher and most preferably, the PNA is C-terminally labeled with dabsyl. Is also commonly linked to the N-epsilon-amino group of the C-terminal lysine amino acid through methods known in the art.

In one embodiment, the PNA probe may be associated with a reporter (detector). The reporter (detector) may be a conjugate labeled with a coloring enzyme, a fluorescent substance, a radioactive isotope or colloid, and preferably a secondary antibody capable of binding complementarily to the PNA probe. For example, the chromogenic enzyme may be a peroxidase, an alkaline phosphatase or an acid phosphatase (e.g., horseradish peroxidase); (FITC), Rhodamine-B-isothiocyanate (RITC), fluorescein thiourea (FTH), 7 (fluorescein isothiocyanate) -Acetoxycoumarin-3-yl, fluorescein-5-yl, fluorescein-6-yl, 2'7'-dichlorofluorescein-5-yl, 2 ', 7'-dichlorofluorescein Yl, tetramethylrhodamine-6-yl, 4,4-difluoro-5,7-dimethyl-4- 4-diaza-s-indacene-3-ethyl or 4,4-difluoro-5,7-diphenyl-4-bora-3a, 4a-diaza- -Ethyl and the like can be used, but the present invention is not limited thereto.

The PNA probe may be formed on a support such as glass slide, silica, semiconductor, plastic, gold, silver, magnetic molecule, nylon, polymer compound of poly (dimethylsiloxane), PDMS, cellulose or nitrocellulose, Immobilization is possible. There is no particular limitation on the form of the support, and it is not limited to the form of a thin plate which can be held by hand such as, for example, a glass slide, but also a tube shape or a bead shape of 0.1 mm or less Lt; / RTI > The surface of the support may be functionalized with functional groups such as an aldehyde group, a carboxyl group, an epoxy group, an isothiocyanate group, an N-hydroxysuccinimidyl group, and an activated ester group, particularly an epoxy group. After the probe is immobilized on the support, the functional groups such as residual amine and epoxy group can be stabilized through the blocking step.

The PNA probe may be immobilized on a plurality of, e.g., four or eight, separate regions on the support to detect multiple, e.g., four or eight, samples simultaneously.

In addition, the present invention provides a kit for detecting pilar green gene mutation comprising a probe complementarily binding to a filaggrin mutant nucleic acid sequence.

The PNA probe may be a PNA probe comprising any one of SEQ ID NO: 1 to SEQ ID NO: 5, but is not limited thereto and includes all sequences capable of complementarily binding to a pilar green gene mutation sequence.

The kit may be for the diagnosis of atopic dermatitis, preferably for the diagnosis of exogenous atopic dermatitis.

The kit includes a means for PCR amplifying a filament green gene in an analyte containing a primer, a DNA polymerase, or an RNA polymerase, dNTPs, and a PCR buffer solution for amplifying a filament green gene mutation gene sequence, And means for detecting hybridization of the amplified HPV and the probe using a probe specific for the filla green gene mutation sequence.

The kit may include a method of measuring the antigen-antibody reaction of the antigen (or the base sequence) -antibody complex, or a method of measuring the amount of the detection agent after treating the antigen-antibody complex with the detection antibody, Genetic mutations can be diagnosed. Examples of the antigen-antibody reaction include enzyme immunoassay (ELISA), immunoprecipitation, fluorescence immunoassay, enzyme substrate staining, antigen-antibody aggregation and the like. Chemiluminescence, absorbance, reflection or transmission.

A high throughput screening (HTS) system can be used as a method of searching for the amount of the detecting substance. In this method, a substrate for inducing color development of a chromogenic enzyme bound to a detecting substance is treated to measure a color reaction A fluorescence method in which a fluorescent substance is attached to a detector to detect fluorescence or a radiation method in which a radioactive isotope is attached to a detector to detect radiation and a SPR surface plasmon resonance (SPRI) method or SPRI (surface plasmon resonance imaging) method for imaging and verifying an SPR system, FMCA.

For example, it is preferable to select a substrate that induces color development according to a chromogenic enzyme. TMB (3,3 ', 5,5'-tetramethyl bezidine), ABTS [2,2'-azino-bis (3- ethylbenzothiazoline-6-sulfonic acid], OPD (o-phenylenediamine), and the like. At this time, it is more preferable that the coloring agent substrate is provided in a dissolved state in a buffer solution (0.1 M NaAc, pH 5.5). The chromogenic substrate such as TMB is decomposed by the chromogenic enzyme bound to the detector to generate a chromophore, and the presence or absence of the filaggrin gene mutation is detected by visually observing the degree of deposition of the chromophore. In addition, the fluorescence method is a method of spotting a detection body labeled with the fluorescent substance using a fluorescent scanner program to confirm the signal, and the degree of coupling can be confirmed by applying this method. Unlike the fluorescence method, the SPR system does not require that the sample be labeled with a fluorescent material, but it is possible to analyze the binding degree of the antibody in real time, but it has a disadvantage that it is impossible to simultaneously analyze samples. In the case of SPRI, it is possible to perform simultaneous multiple sample analysis by using the fine alignment method, but the detection strength is low.

The kit may further include a washing solution for removing the remaining substances after the antigen-antibody binding reaction and the binding reaction of the detecting substance. Preferably, the wash liquor comprises a phosphate buffer solution, NaCl and Tween 20, and a buffer solution (PBST) composed of 0.02 M phosphate buffer solution, 0.13 M NaCl, and 0.05% Tween 20 But is not limited thereto. After the antigen-antibody binding reaction, the antibody-antibody conjugate is reacted with the detection antibody, and an appropriate amount of the antibody is added to the solid body and washed 3 to 6 times. The reaction stop solution is preferably, but not limited to, a sulfuric acid solution (H2SO4).

The kit may further comprise a negative control comprising a filaggrin gene mutation or a negative control comprising a filaggrin wild type gene.

The filaggrin gene mutation diagnostic kit comprises a reverse transcription polymerase chain reaction kit (RT-PCR), a DNA chip kit, an enzyme-linked immunosorbent assay (ELISA) kit, a sandwich ELISA kit, a protein chip kit, Or a multiple reaction monitoring (MRM) kit. However, the present invention is not limited to this, and can be accomplished through any known method known to those skilled in the art using a method of complementary binding to a base sequence or protein.

In addition,

Amplifying the filamentous green DNA from the specimen sample;

Hybridizing the amplified pilar green DNA with a probe coupled with a reporter; And

And analyzing the hybridization product. The present invention also provides a method for detecting a pilar green gene mutation.

The sample of the sample may be an epithelial cell in the oral cavity, blood, saliva, plasma or a solution containing it, or a compound, and may be any bio-derived substance known to be capable of gene sequence amplification in the art.

The filaggrin gene mutation may be selected from the group consisting of K4022X, K4021X, K4671X, 3321delA, S2554X, S2889X, S3296X, R501X, 2282del4, 3673delC, 3702delG, R1474X, 5360delG, 6867delAG, E2422X, 7267delCA, R2447X, S3247X, 11029delCA, 11033del4, Q3683X , 441delA, 1249insG, S1695X, Q1701X, E1795X, Q2417X, 7945delA, or R4307X, but is not limited thereto and includes all genes encoding homologues, variants and derivatives thereof, Green gene mutation.

The probe may be oligonucleotide, DNA, RNA, Taqman, LNA, MNA, or PNA, but is not limited thereto, and may include any substance capable of complementarily binding to a nucleic acid sequence.

Preferably, the probe is a PNA probe. More preferably, the probe may include any one of SEQ ID NO: 1 to SEQ ID NO: 5, but is not limited thereto and may be complementary to a pilar green gene mutant sequence Includes all sequences that are present.

The reporter (detector) may be a conjugate labeled with a coloring enzyme, a fluorescent substance, a radioactive isotope or colloid, and preferably a secondary antibody capable of binding complementarily to the PNA probe. For example, the chromogenic enzyme may be a peroxidase, an alkaline phosphatase or an acid phosphatase (e.g., horseradish peroxidase); (FITC), Rhodamine-B-isothiocyanate (RITC), fluorescein thiourea (FTH), 7 (fluorescein isothiocyanate) -Acetoxycoumarin-3-yl, fluorescein-5-yl, fluorescein-6-yl, 2'7'-dichlorofluorescein-5-yl, 2 ', 7'-dichlorofluorescein Yl, tetramethylrhodamine-6-yl, 4,4-difluoro-5,7-dimethyl-4- 4-diaza-s-indacene-3-ethyl or 4,4-difluoro-5,7-diphenyl-4-bora-3a, 4a-diaza- -Ethyl and the like can be used, but the present invention is not limited thereto.

The PNA probe may be labeled with a reporter and a quencher, and the quencher may be dabcyl. Preferably, the PNA is labeled with a quencher and most preferably, the PNA is C-terminally labeled with dabsyl. Is also commonly linked to the N-epsilon-amino group of the C-terminal lysine amino acid through methods known in the art.

The analyzing step

Eluting the hybridization product by changing the temperature to obtain a melting curve; And

Melting curve peak values were compared to wild-type controls, and homozygous pilar green gene mutations when the peaks were observed only at low temperatures, heterozygous mutations when the peaks were observed at low temperatures and the same temperature, peaks observed only at the same temperature And may be a wild type, preferably FMCA, but is not limited thereto, and includes all methods for determining whether nucleic acid sequences are known in the art.

In a specific example of the present invention, in order to detect a pilar green gene mutation, a sample amplifying a pilar green gene region including a mutation portion using PCR was prepared.

In a specific example of the present invention, a PNA probe having a length of about 10 to 20 m was prepared, and a probe having a desired melting temperature value could be produced through a change in length or sequence.

Further, in a specific embodiment of the present invention, a fluorescence-based melting curve analysis (FMCA) in which a PNA probe with a fluorescent label attached thereto and a specimen sample are hybridized (hybridized) , And it was confirmed that the melting temperature difference occurred between the normal gene and the mutant type gene (Fig. 2).

The term "complementary" used in the present invention means not only that the complementary relationship is completely complementary to the subject nucleotide sequence but also includes a complementary relationship with the subject nucleotide sequence so as to be hybridizable do.

The term "oligonucleotide" used in the present invention is a nucleic acid or a base sequence including both RNA and DNA, and includes cDNA, genomic DNA, and synthetic DNA. The RNA also includes both mRNA, rRNA, and synthetic RNA. Also, oligonucleotides, nucleic acids, and bases are used interchangeably herein.

Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples are illustrative of the present invention, and the contents of the present invention are not limited by the following examples.

Example 1 Preparation of Specimen for Detection of Pilar Green Gene Base Mutation

To use the PNA probe for gene SNP or mutation detection, the gene region including the SNP or the mutation was amplified by PCR to obtain the PCR product (sample). At this time, the size of the PCR product should be less than about 1000 bp, so that it can be easily detected by the PNA probe. If the primers and PCR conditions for PCR amplification are available, they can be used as they are.

Specifically, the chromosomal DNA was extracted from the human body of the general public and the patient, and then PCR was carried out to identify five kinds of pillar green mutants 3321delA, K4022X (other nomenclature: K4021X, K4671X), S2554X, S2889X and S3296X Were prepared. The PCR reaction for each mutation is described in reference to the literature (Osawa R et al. (2010) Japanese-specific filaggrin gene mutations in Japanese patients suffering from Atopic Eczema and Ashthma, J. Invest. Dermatol. Rag et al. (2011) Filaggrin gene defects and the risk of developing allergic disorders, Allergology International 60, 1-9) and amplified using the primers shown in Table 1 below. Subsequently, a specimen containing each mutation site was sequenced to identify previously known mutation sites.

PCR primer Mutant direction Sequence (5 → 3) 3321delA
F GCTGATAATGTGATTCTGTCTG (SEQ ID NO: 1) R GACCCCGATGATTGTTCCTGT (SEQ ID NO: 2) K4022X
F CTAGTACCGCTAAGGAACATGG (SEQ ID NO: 3) R TGGCTCCTTCGATATTTCTGA (SEQ ID NO: 4) S2554X
F CCACACGTGGCCGGTCAGCA (SEQ ID NO: 5) R CTGGCTAAAACTGGATCCCCA (SEQ ID NO: 6) S2889X
F GATGGACGGGGCCCAGCACTA (SEQ ID NO: 7) R CTTGGTGGCTCTGCTGATGGGA (SEQ ID NO: 8) S3296X
F TCTGTTCAGGAGCAGTCAAGG (SEQ ID NO: 9) R GCTTCATGGTGATGCGACCA (SEQ ID NO: 10)

references

1) Nomura T et al. (2007) Unique mutations in the filaggrin gene in Japanese patients with ichthyosis vulgaris and atopic dermatitis, J. Allergy Clin. Immun. 119, 434-440.

2) Kim EJ et al. (2011) Genetic Polymorphism of FLG in Korean Ichthyosis Vulgaris Patients, Ann. Dermatol. 23, 170-176.

&Lt; Example 2 > Preparation of PNA probe for detection of pilar green gene base mutation

The present inventors have made a PNA probe for use in the detection of pilar green gene mutation.

Specifically, PNA probes were designed using a PNA probe designer (Applied Biosystems, USA). In order to easily detect the mutation presence or absence of the sample, the melting temperature (Tm) of the PNA probe was designed to be 5 ° C or more higher than that in the case of the mutation. Also, all the PNA probes (FAM, HEX, Texas Red-labeled, Dabcyl) used in the present invention were designed by HPLC (Panagene, Korea) The purity of all synthesized probes was confirmed by mass spectrometry. The sequence of the PNA probe synthesized by the above method is shown in Table 2 below.

PNA probe oligomer sequence for discrimination of pilar green gene mutation Probe The sequence (5 '- > 3') K4022Xm (SEQ ID NO: 11) Dabcyl-GATCTTTACCAAAC-O-K (FAM) 3321delA (SEQ ID NO: 12) Dabcyl-GACCTTCCCCCTGACC-O-K (HEX) S2554X (SEQ ID NO: 13) Dabcyl-CCCCTCTGATTGTCC-O-K (FAM) S2889Xnew (SEQ ID NO: 14) Dabcyl-ACTGGATCCCTGG-O-K (HEX) S2889Xmut (SEQ ID NO: 15) Dabcyl-ACACTTCAACCCTG-O-K (FAM) S3296X (SEQ ID NO: 16) Dabcyl-GCAAGATCAAGTCCA-O-K (Texas Red)

In the sequence, O means linker and K means lysine. Fluorescent material in parentheses.

Example 3 Analysis of FMCA Solubility Curve According to Pilar Green Gene Base Variation

The present inventors attached a fluorescent marker to the PNA probe to facilitate the analysis of the results. The difference in the binding force between the PCR product (sample) and the inserted PNA probe was determined by the fusion temperature (Tm) using a hybridization method. FMCA (Fluorescence Melting Curve Analysis) method was used. The conventional quantitative PCR apparatus (real-time PCR) is equipped with the function of performing the above-described result analysis. When only the PNA probe prepared for the purpose is prepared, the HRM (high resolution melting) Mutation detection is possible without the purchase of the same additional program or equipment.

Specifically, the PCR reaction for the melting curve analysis using the PNA probe was performed using a CFX96 ™ Real-Time system (BIO-RAD, USA). All the experimental conditions were used to generate a single strand sample Asymmetric PCR was performed. 1X eye BioReal Time FMCA ™ Buffer (SeaSunBio Real-Time FMCA ™ buffer, Seosan Bio, Korea), 0.05 μM forward primer for sample preparation and 0.5 μM reverse primer for sample preparation, 0.5 μl PNA probe or S2889X Two samples (S2889Xnew and S2889Xmut were used simultaneously) and 1 μl human chromosomal DNA (or diluted sample PCR products) were added to give a total volume of 20 μl, followed by real-time PCR. In other words, one detection PNA probe was used for four kinds of mutations 3321delA, K4022X (other nomenclature: K4021X, K4671X), S2554X and S3296X, and for S2889X, two PNA probes S2889Xnew and S2889Xmut) were used at the same time. Real-time PCR was performed by denaturing the specimen at 95 ° C for 10 minutes, repeating the cycle of incubating at 95 ° C for 45 seconds, 60 ° C for 30 seconds, and 74 ° C for 45 seconds, and fluorescence was measured in real time . Melting curve analysis was carried out by denaturation at 95 ° C for 3 minutes, followed by hybridization at 72 ° C for 1 minute, 60 ° C for 1 minute, and 50 ° C for 1 minute, followed by increasing the temperature from 40 ° C to 80 ° C by 0.5 ° C, The fluorescence intensity of the PNA probe was measured to obtain the melting temperature (Tm) value. Each step was kept stationary for 5 seconds (Fig. 1).

As a result, it was confirmed that in the melting curve analysis after the asymmetric PCR, a precise melting temperature (Tm) difference occurred between the normal type exhibiting complete hybridization with the PNA probe and the mismatch mutant type (FIG. 2).

Therefore, in the case of Heterozygote mutation, one of the homologous chromosomes is mutated and the other is normal. Therefore, as shown in the green melting curve of K4022X and 3321delA and S2889X mutants, two peak curves are shown And the left peak coming from the lower Tm value is mutated, and the right peak (the higher Tm value) overlaps with the blue normal peak corresponds to the normal form.

In addition, Homozygote (homozygous mutant) mutation is mutated in all pairs of homologous chromosomes. As can be seen from the red melting curve (peak) of S2554X, S2889X, S3296X ) Show only red mutant peaks with low Tm values.

In addition, when homozygote (homozygous mutation) mutation occurs even with K4022X and 3321delA mutations, only the left peak coming from the lower Tm value will be detected as in S2554X and S3296X in the above picture, and even the S2554X and S3296X mutants will be detected by Heterozygote If the mutation is shown, the left peak (mutated), which comes from the lower Tm value, such as K4022X and 3321delA, and the right peak (the higher Tm value), which overlaps with the blue normal peak, It becomes possible to detect a peak. A good example of S2889X in which both the Heterozygote mutation and the Homozygote mutation were performed is shown in FIG. 2. The analysis chart on the left side of FIG. 2 shows that the Heterozygote (heterozygous mutant) , And the analysis chart shown in the middle of the lower part of FIG. 2 is an experiment example in which Homozygote (homozygous type) mutation was detected.

Table 3 below shows the melting temperature (Tm) and the number of miss match bases obtained from the PNA probe and the FMCA analysis.

SNP number and melting temperature distribution of mutant individuals and normal individuals for Pila green gene K4022X 3321delA S2554X S2889X S3296X Normal type
(WT) Mismatched basic water 0 0 0 0 0 Tm
54 71 62 63 69 Mutant type
(mutant) unconformity
Basic water One 1 del One 2 One Tm
46.5 60 52.5 46.5 55

* 0 indicates perfect match with no mismatched base numbers, numbers 1 through 2 indicate the number of mismatched bases, and 1 del indicates the deletion of one base.

* The Tm value in the above table may be slightly different depending on the type of PCR equipment used and the degree of temperature correction, but the difference between the Tm values of the normal type and the mutant type can be distinguished as shown in FIG.

<110> Korea Research Institute of Bioscience and Biotechnology <120> probes, kits and methods for detecting mutation of filaggrin gene <130> 2014p-03-052 <160> 16 <170> Kopatentin 2.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 3321delA forward primer <400> 1 gctgataatg tgattctgtc tg 22 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 3321delA reverse primer <400> 2 gaccccgatg attgttcctg t 21 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> K4022X forward primer <400> 3 ctagtaccgc taaggaacat gg 22 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> K4022X reverse primer <400> 4 tggctccttc gatatttctg a 21 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> S2554X forward primer <400> 5 ccacacgtgg ccggtcagca 20 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> S2554X reverse primer <400> 6 ctggctaaaa ctggatcccc a 21 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> S2889X forward primer <400> 7 gatggacggg gcccagcact a 21 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> S2889X reverse primer <400> 8 cttggtggct ctgctgatgg ga 22 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> S3296X forward primer <400> 9 tctgttcagg agcagtcaag g 21 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> S3296X reverse primer <400> 10 gcttcatggt gatgcgacca 20 <210> 11 <211> 14 <212> DNA <213> Artificial Sequence <220> <223> K4022Xm PNA probe <400> 11 gatctttacc aaac 14 <210> 12 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> 3321delA PNA probe <400> 12 gaccttcccc ctgacc 16 <210> 13 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> S2554X PNA probe <400> 13 cccctctgat tgtcc 15 <210> 14 <211> 13 <212> DNA <213> Artificial Sequence <220> <223> S2889Xnew PNA probe <400> 14 actggatccc tgg 13 <210> 15 <211> 14 <212> DNA <213> Artificial Sequence <220> <223> S2889Xmut PNA probe <400> 15 acacttcaac cctg 14 <210> 16 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> S3296X PNA probe <400> 16 gcaagatcaa gtcca 15

Claims

Wherein the PNA probe is composed of the nucleotide sequence of SEQ ID NO: 11, 12, 13, 14, 15, or 16.

delete

[Claim 14] The method according to claim 1, wherein the Pillagreen gene mutation K4022X, the Pillagreen gene mutation 3321delA, the Pillagreen gene mutation S2554X, the Pillagreen mutation S2889X (new) SEQ ID NO: 15 is a pilar green gene mutation S2889X (mut), and SEQ ID NO: 16 is a pilar green gene mutation S3296X.

[Claim 4] The PNA probe for detecting pilar green gene mutation according to claim 3, wherein the Pilar green gene mutation induces atopic dermatitis.

A kit for detecting pilar green gene mutation, which comprises a primer for amplifying a base sequence including a part or all of a pillar green gene from a specimen and the PNA probe of claim 1.

6. The kit for detecting pilar green gene mutation according to claim 5, wherein the pilar green gene mutation is K4022X, 3321delA, S2554X, S2889X, or S3296X.

[Claim 7] The kit according to claim 6, wherein the kit is for diagnosis of atopic dermatitis.

1) amplifying filamentous green DNA using a primer from a specimen to obtain a polymerase chain reaction (PCR) product of filamentous green gene;
2) obtaining a DNA-PNA hybridization product by hybridizing the PNA probe of claim 1 bound to the reporter with the PCR product of the pilana green gene obtained in step 1);
3) obtaining a melting curve of the DNA-PNA hybridization product in real time by changing the temperature of the hybridization product obtained in the step 2); And
4) analyzing the melting curve of step 3).

9. The method according to claim 8, wherein the pilar green gene mutation is K4022X, 3321delA, S2554X, S2889X, or S3296X.

9. The method according to claim 8, wherein the specimen is an oral epithelial cell, blood, saliva, or plasma.

9. The method according to claim 8, wherein the PCR product is an oligonucleotide, DNA (deoxyribonucleic acid), or RNA (ribonucleic acid).

delete

9. The method according to claim 8, wherein the reporter of step 2) is a fluorescent substance and a quencher.

9. The method of claim 8, wherein the step of analyzing in step 3) comprises: eluting the hybridization product at a temperature to obtain a melting curve; And
Melting curve peak values were compared to wild-type controls, and homozygous pilar green gene mutations when the peaks were observed only at low temperatures, heterozygous mutations when the peaks were observed at low temperatures and the same temperature, peaks observed only at the same temperature Wherein the method comprises the step of determining a wild type.

9. The method according to claim 8, wherein the step of analyzing in step 3) is FMCA (Fluorescence Melting Curve Analysis).