KR101606885B1 - Pharmaceutical composition for preventing and treating allergic disease comprising adenine or pharmaceutically acceptable salt thereof as an active ingredient - Google Patents

Pharmaceutical composition for preventing and treating allergic disease comprising adenine or pharmaceutically acceptable salt thereof as an active ingredient Download PDF

Info

Publication number
KR101606885B1
KR101606885B1 KR1020130078574A KR20130078574A KR101606885B1 KR 101606885 B1 KR101606885 B1 KR 101606885B1 KR 1020130078574 A KR1020130078574 A KR 1020130078574A KR 20130078574 A KR20130078574 A KR 20130078574A KR 101606885 B1 KR101606885 B1 KR 101606885B1
Authority
KR
South Korea
Prior art keywords
adenine
pharmaceutically acceptable
pharmaceutical composition
acceptable salt
active ingredient
Prior art date
Application number
KR1020130078574A
Other languages
Korean (ko)
Other versions
KR20150005160A (en
Inventor
박승길
Original Assignee
충남대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 충남대학교산학협력단 filed Critical 충남대학교산학협력단
Priority to KR1020130078574A priority Critical patent/KR101606885B1/en
Publication of KR20150005160A publication Critical patent/KR20150005160A/en
Application granted granted Critical
Publication of KR101606885B1 publication Critical patent/KR101606885B1/en

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/519Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
    • A61K31/52Purines, e.g. adenine
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10TECHNICAL SUBJECTS COVERED BY FORMER USPC
    • Y10STECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10S424/00Drug, bio-affecting and body treating compositions
    • Y10S424/81Drug, bio-affecting and body treating compositions involving autoimmunity, allergy, immediate hypersensitivity, delayed hypersensitivity, immunosuppression, immunotolerance, or anergy

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

본 발명은 아데닌(adenine)의 약학적 용도에 관한 것으로, 보다 상세하게는 화학식 1로 표시되는 아데닌 또는 이의 염을 포함하는 알레르기 질환의 예방 및 치료용 약학적 조성물 및 화학식 1로 표시되는 아데닌 또는 이의 염을 포함하는 비만세포 탈과립 억제, 사이토카인 발현 억제 및 아이코사노이드 생성 억제용 조성물에 관한 것이다. 본 발명의 조성물은 알레르기 원인이 되는 비만세포의 탈과립, 사이토카인의 전사 억제 및 아이코사노이드 생성을 억제함으로써 알레르기 질환에 효과적이므로 이들의 예방 및 치료의 목적으로 사용할 수 있다.More particularly, the present invention relates to a pharmaceutical composition for the prevention and treatment of allergic diseases comprising adenine or a salt thereof represented by the general formula (1) and a pharmaceutical composition for preventing and treating adenine or its A composition for inhibiting mast cell degranulation, inhibiting cytokine expression, and inhibiting icosanoid formation. The composition of the present invention can be used for prevention and treatment of allergic diseases by inhibiting degranulation, inhibition of transcription of the cytokine and production of icosanoids, which are allergenic mast cells.

Description

아데닌 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 알레르기 질환 예방 및 치료용 약학적 조성물{Pharmaceutical composition for preventing and treating allergic disease comprising adenine or pharmaceutically acceptable salt thereof as an active ingredient}[0001] The present invention relates to a pharmaceutical composition for preventing and treating an allergic disease comprising adenine or a pharmaceutically acceptable salt thereof as an active ingredient,

본 발명은 아데닌(adenine)의 약학적 용도에 관한 것으로, 보다 상세하게는 화학식 1로 표시되는 아데닌 또는 이의 염을 포함하는 알레르기 질환의 예방 및 치료용 약학적 조성물 및 화학식 1로 표시되는 아데닌 또는 이의 염을 포함하는 비만세포 탈과립 억제, 사이토카인 발현 억제 및 아이코사노이드 생성 억제용 조성물에 관한 것이다.
More particularly, the present invention relates to a pharmaceutical composition for the prevention and treatment of allergic diseases comprising adenine or a salt thereof represented by the general formula (1) and a pharmaceutical composition for preventing and treating adenine or its A composition for inhibiting mast cell degranulation, inhibiting cytokine expression, and inhibiting icosanoid formation.

비만 세포는 여러 종류의 조직의 거주세포(resident cell)이며, 다양한 자극에 의해 활성화되면 히스타민, 류코트리엔, 프로스타글란딘, 사이토카인, 케모카인, 단백질 분해효소 등을 분비한다. 비만세포는 신체가 병원체와 기생충에 대항하는 일을 수행한다. 그러나 한편으로는 알러지 염증반응을 일으켜 아토피피부염, 아토피성 아스마, 알러지성 비염, 두드러기, 습진, 건선, 과민증을 일으킨다.Mast cells are resident cells of various tissues. When activated by various stimuli, they secrete histamine, leukotriene, prostaglandin, cytokine, chemokine, proteolytic enzyme and the like. Mast cells carry out work by the body against pathogens and parasites. However, on the other hand, it causes allergic inflammation reaction and causes atopic dermatitis, atopic asthma, allergic rhinitis, urticaria, eczema, psoriasis and hypersensitivity.

비만세포는 IgE에 대한 수용체인 FcεRI를 발현하고 있다. 이 수용체는 하나의 α 체인과 2 가지 종류의 서브유닛 (한 개의 β 체인과 이황화(disulfide) 결합된 homo-dimer γ 체인) 으로 이루어져 있다. 항원 특이성 IgE와 결합 하고 있던 FcεRI가 다가성 항원에 의해 수용체 간의 결합이 일어나면 신호전달 반응이 일어면 비만세포는 탈과립을 일으키고, 염증성 에이코사노이드, 사이토카인(cytokine)의 방출을 일으킨다 (Abraham, S.N. et al ., Mast cell-orchestrated immunity to pathogens. Nat Rev Immunol. 10(6): p.440-52).
Mast cells express FcεRI, a receptor for IgE. This receptor consists of one α chain and two kinds of subunits (one β chain and a disulfide-linked homo-dimer γ chain). When FcεRI binding to antigen-specific IgE binds to receptors by multivalent antigens, signal transduction leads to degranulation and release of inflammatory eicosanoids and cytokines (Abraham, SN meat al . , Mast cell-orchestrated immunity to pathogens. Nat Rev Immunol. 10 (6): 440-52).

이에 본 발명자들은 아데닌이 항원자극에 의한 비만 세포의 활성을 억제한다는 점을 발견하여 아데닌을 포함하는 알레르기 질환의 예방 및 치료용 약학적 조성물을 개발함으로써 본 발명을 완성하였다.Accordingly, the inventors of the present invention discovered that adenine inhibits the activity of mast cells induced by antigen stimulation, and completed the present invention by developing a pharmaceutical composition for the prevention and treatment of allergic diseases including adenine.

따라서 본 발명의 목적은 하기 화학식 1로 표시되는 아데닌(adenine) 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 알레르기 질환 예방 및 치료용 약학적 조성물을 제공하는 것이다.Accordingly, an object of the present invention is to provide a pharmaceutical composition for preventing and treating allergic diseases comprising adenine represented by the following general formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient.

<화학식 1>&Lt; Formula 1 >

Figure 112013060431091-pat00001

Figure 112013060431091-pat00001

본 발명의 또 다른 목적은 상기 화학식 1로 표시되는 아데닌(adenine) 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 비만세포 탈과립 억제용 조성물을 제공하는 것이다.
Another object of the present invention is to provide a composition for inhibiting mast cell degranulation comprising adenine represented by the general formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient.

본 발명의 또 다른 목적은 상기 화학식 1로 표시되는 아데닌(adenine) 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 사이토카인 발현 억제용 조성물을 제공하는 것이다.
Another object of the present invention is to provide a composition for inhibiting cytokine expression comprising adenine represented by the above-mentioned formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient.

본 발명의 또 다른 목적은 상기 화학식 1로 표시되는 아데닌(adenine) 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 아이코사노이드 생성 억제용 조성물을 제공하는 것이다.
Another object of the present invention is to provide a composition for inhibiting icosanoid formation comprising adenine represented by the general formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient.

상기와 같은 목적을 달성하기 위하여 본 발명은 하기 화학식 1로 표시되는 아데닌(adenine) 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 알레르기 질환 예방 및 치료용 약학적 조성물을 제공한다.In order to achieve the above object, the present invention provides a pharmaceutical composition for preventing and treating allergic diseases comprising adenine represented by the following general formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient.

<화학식 1>&Lt; Formula 1 >

Figure 112013060431091-pat00002
Figure 112013060431091-pat00002

본 발명의 또 다른 목적을 달성하기 위해 상기 화학식 1로 표시되는 아데닌(adenine) 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 비만세포 탈과립 억제용 조성물을 제공한다.
In order to accomplish still another object of the present invention, there is provided a composition for inhibiting mast cell degranulation comprising adenine represented by the above-mentioned formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient.

본 발명의 또 다른 목적을 달성하기 위해 상기 화학식 1로 표시되는 아데닌(adenine) 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 사이토카인 발현 억제용 조성물을 제공한다.
In order to accomplish still another object of the present invention, there is provided a composition for inhibiting cytokine expression comprising adenine represented by the above-mentioned formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient.

본 발명의 또 다른 목적을 달성하기 위해 상기 화학식 1로 표시되는 아데닌(adenine) 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 아이코사노이드 생성 억제용 조성물을 제공한다.
In order to accomplish still another object of the present invention, there is provided a composition for inhibiting icosanoid formation comprising adenine represented by the above-mentioned formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient.

이하 본 발명의 내용을 보다 상세히 설명하기로 한다.
Hereinafter, the present invention will be described in more detail.

본 발명은 하기 화학식 1로 표시되는 아데닌(adenine) 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 알레르기 질환 예방 및 치료용 약학적 조성물을 제공한다.The present invention provides a pharmaceutical composition for the prevention and treatment of allergic diseases comprising adenine represented by the following general formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient.

<화학식 1>&Lt; Formula 1 >

Figure 112013060431091-pat00003

Figure 112013060431091-pat00003

본 발명의 아데닌 및 이의 약학적으로 허용 가능한 염은 알레르기 질환을 예방 또는 치료하는 효과를 가지고 있다.
The adenine of the present invention and its pharmaceutically acceptable salts have the effect of preventing or treating allergic diseases.

이와 같은 본 발명의 효과는 본 발명의 일실시예에 잘 나타나 있다.
The effects of the present invention are well illustrated in an embodiment of the present invention.

본 발명의 일실시예에서는 염증유발과 관련이 있는 비만세포의 아이코사노이드 일종인 염증유발 물질 leukotriene B4 (LTB4)의 합성 억제, 탈과립 억제 및 사이토카인 mRNA 생성 억제에 대한 아데닌의 영향을 살펴보았다. 그 결과, 아데닌은 비만세포내의 leukotriene B4 (LTB4)의 합성 억제, 탈과립 및 사이토카인 mRNA 생성을 억제하여 알레르기 질환을 예방 및 치료하는 효과를 가지는 것을 알 수 있다. 또한 국소피부과민반응인 PCA로 실험동물 모델의 국소피부조직에서 과민반응을 측정한 결과, 아데닌은 국소피부 과민반응을 억제하는 것으로 나타났다.
In one embodiment of the present invention, the effect of adenine on the inhibition of the synthesis of leukotriene B4 (LTB4), inhibition of degranulation and inhibition of cytokine mRNA production was examined, which is one of the isochosenoids of mast cell associated inflammation induction. As a result, it can be seen that adenine inhibits synthesis of leukotriene B4 (LTB4) in mast cells, inhibits degranulation and cytokine mRNA production, and has an effect of preventing and treating allergic diseases. In addition, adenosine has been shown to inhibit local skin hypersensitivity by measuring the hypersensitivity of localized skin hypersensitivity (PCA) in the local skin tissue of experimental animal models.

따라서 본 발명은 아데닌 또는 이들의 약학적으로 허용 가능한 염을 포함하는 알레르기 질환의 예방 및 치료용 약학적 조성물을 제공한다.
Accordingly, the present invention provides a pharmaceutical composition for the prevention and treatment of allergic diseases comprising adenine or a pharmaceutically acceptable salt thereof.

상기 “알레르기 질환”이란 인체의 어떤 물질에 대한 과민증, 즉 외부로부터 들어온 물질에 대해 신체 면역계가 과도한 반응을 일으켜서 유발되는 질환을 말한다. 상기 알레르기 질환의 예로는 이에 한정되지는 않으나 기관지천식, 화분증, 알레르기비염, 담마진 (두드러기), 아나필락시스, 소화관 알레르기, 약물 알레르기, 알레르기성 결막염 및 아토피성 피부염등이 포함될 수 있다.
The above-mentioned &quot; allergic disease &quot; refers to a disease caused by hypersensitivity to a substance in the human body, that is, an excessive reaction of the body's immune system against a substance introduced from the outside. Examples of the allergic diseases include, but are not limited to, bronchial asthma, hay fever, allergic rhinitis, urticaria, anaphylaxis, digestive tract allergy, drug allergy, allergic conjunctivitis and atopic dermatitis.

본 발명은 상기 화학식 1로 표시되는 아데닌(adenine) 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 비만세포 탈과립 억제용 조성물을 제공한다.
The present invention provides a composition for inhibiting mast cell degranulation comprising adenine represented by the above-mentioned formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient.

본 발명의 아데닌 및 이의 약학적으로 허용 가능한 염은 비만세포의 탈과립 억제 효과를 가지고 있다.
The adenine of the present invention and its pharmaceutically acceptable salts have an effect of inhibiting degranulation of mast cells.

본 발명의 일실시예에서는 활성화된 RBL-2H3 세포에서, 세포내 과립 안에 있던 β-hexosaminidase 효소가 탈과립 현상에 의해 세포 밖 버퍼 액으로 방출되는 정도를 측정했다. 아데닌은 투여량 의존적으로 RBL-2H3 세포에서 β-hexosaminidase의 방출을 저해했다. 최대 억제 투여량은 5 mM이었다.
In one embodiment of the present invention, the amount of β-hexosaminidase enzyme in the intracellular granules released into the extracellular buffer solution by degranulation was measured in activated RBL-2H3 cells. Adenine dose-dependently inhibited the release of β-hexosaminidase in RBL-2H3 cells. The maximal inhibitory dose was 5 mM.

본 발명은 상기 화학식 1로 표시되는 아데닌(adenine) 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 사이토카인 발현 억제용 조성물을 제공한다.
The present invention provides a composition for inhibiting cytokine expression comprising adenine represented by the above-mentioned formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient.

본 발명의 아데닌 및 이의 약학적으로 허용 가능한 염은 사이토카인 억제 효과를 가지고 있다.
The adenine of the present invention and its pharmaceutically acceptable salts have a cytokine inhibitory effect.

본 발명의 일실시예에서는 활성화된 비만세포에 의해 방출되는 IL-3, MCP-1의 전사물 생산에서 아데닌의 영향을 Real-Time PCR로 측정했다. 아데닌은 IL-3과 MCP-1 등의 사이토카인 전사를 완벽하게 차단하였다.
In one embodiment of the present invention, the effect of adenine in the transcript production of IL-3 and MCP-1 released by activated mast cells was measured by Real-Time PCR. Adenine completely blocked the transcription of cytokines such as IL-3 and MCP-1.

본 발명은 상기 화학식 1로 표시되는 아데닌(adenine) 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 아이코사노이드 생성 억제용 조성물을 제공한다.
The present invention provides a composition for inhibiting icosanoid formation comprising adenine represented by the above-mentioned formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient.

본 발명의 아데닌 및 이의 약학적으로 허용 가능한 염은 비만세포의 아이코사노이드 생성 억제 효과를 가지고 있다.
The adenine of the present invention and its pharmaceutically acceptable salt have an effect of inhibiting icosanoid formation of mast cells.

본 발명의 일실시예에서는 활성화된 RBL-2H3 세포가 아이코사노이드의 일종인 leukotriene B4를 합성하여 세포 밖으로 방출시키는 정도를 측정하였다. 세포를 30분 자극한 다음 세포 밖으로 방출된 leukotriene B4 양을 LTB4 ELISA kit를 사용하여 측정하였다. 아데닌은 투여량 1 mM에서 leukotriene B4 방출을 효과적으로 저해했다.
In one embodiment of the present invention, the extent of activation of RBL-2H3 cells by leukotriene B4, which is a kind of icosanoid, is released from the cells. The amount of leukotriene B4 released from the cells after stimulation of the cells for 30 minutes was measured using an LTB4 ELISA kit. Adenine effectively inhibited leukotriene B4 release at a dose of 1 mM.

아이코사노이드(eicosanoid)는 아라키돈산 및 리놀렌산(linolenic acid) 등과 같은 고도불포화 지방산(polyunsaturated fatty acid)에서 유래하며, 세포 활성과 연관된 화합물의 어떤 종류를 지칭한다. 에이코사트리엔산(eicosatrienoic acid), 에이코사테트라엔산(eicosatetraenoic acid), 에이코사펜타엔(eicosapentaenoic acid)산 등의 탄소수 20의 불포화지방산 대사물을 총칭한다. 히드록시에이코사테트라엔산(hydroxyeicosatetraenoic acid) 또는 히드로퍼옥시에이코사테트라엔산(hydroperoxyeicosatetraenoic acid), 프로스타글란딘(prostaglandin), 트롬복산(thromboxane), 루코트리엔(leukotriene), 리폭신(lipoxin) 등의 아라키돈산 대사물이나 그의 유사물 및 그들이 화학적 수식된유도체 전부를 포함한다.
Eicosanoids are derived from polyunsaturated fatty acids such as arachidonic acid and linolenic acid, and refer to any type of compound associated with cellular activity. Refers to an unsaturated fatty acid metabolite having 20 carbon atoms such as eicosatrienoic acid, eicosatetraenoic acid, and eicosapentaenoic acid. Hydroxyeicosatetraenoic acid or hydroperoxyeicosatetraenoic acid, prostaglandin, thromboxane, leukotriene, lipoxin, and the like. Of the arachidonic acid metabolites or analogs thereof and all of the chemically modified derivatives thereof.

상기와 같은 본 발명의 조성물은 약학적 조성물일 수 있다.
The composition of the present invention as described above may be a pharmaceutical composition.

본 발명의 조성물 또는 약학적 조성물은 아데닌 또는 이들의 약학적으로 허용 가능한 염을 포함하는 것을 특징으로 한다.
The composition or pharmaceutical composition of the present invention is characterized by comprising adenine or a pharmaceutically acceptable salt thereof.

본 발명의 아데닌은 각각 하기 화학식 1의 구조를 가지며, 천연으로부터 분리 정제하거나, 상업적으로 구입하여 사용하거나 또는 당업계에 공지된 화학적 합성법으로 제조할 수 있다.
The adenine of the present invention has a structure represented by the following general formula (1), and can be isolated and purified from nature, commercially purchased, or can be produced by a chemical synthesis method known in the art.

<화학식 1>&Lt; Formula 1 >

Figure 112013060431091-pat00004

Figure 112013060431091-pat00004

바람직하게, 아데닌은 세포의 핵산으로부터 분리/정제될 수 있다. 본 발명에 따른 아데닌은 유기용매 추출 등의 당업계에서 통상적으로 사용되는 공지의 방법에 의해 추출될 수 있다.
Preferably, the adenine can be isolated / purified from the nucleic acid of the cell. The adenine according to the present invention can be extracted by a known method commonly used in the art such as organic solvent extraction.

본 발명에 따른 아데닌은 그 자체 또는 약학적으로 허용 가능한 염의 형태로 사용될 수 있다. 상기에서 ‘약학적으로 허용되는’이란 생리학적으로 허용되고 인간에게 부여될 때, 통상적으로 알레르기 반응 또는 이와 유사한 반응을 일으키기 않는 것을 말하여, 상기 염으로는 약학적으로 허용 가능한 유리산 (free acid)에 의하여 형성된 산 부가염이 바람직하다. 상기 유리산은 유기산과 무기산을 사용할 수 있다. 상기 유기산은 이에 제한되는 것은 아니나, 구연산, 초산, 젖산, 주석산, 말레인산, 푸마르산, 포름산, 프로피온산, 옥살산, 트리플로오로아세트산, 벤조산, 글루콘산, 메타술폰산, 글리콜산, 숙신산, 4-톨루엔술폰산, 글루탐산 및 아스파르트산을 포함한다. 또한, 상기 무기산은 이에 제한되는 것은 아니나 염산, 브롬산, 황산 및 인산을 포함한다. The adenine according to the present invention may be used as such or in the form of a pharmaceutically acceptable salt thereof. As used herein, the term &quot; pharmaceutically acceptable &quot; means physiologically acceptable and does not normally cause an allergic reaction or similar reaction when administered to humans, and the salt includes a pharmaceutically acceptable free acid ) Are preferred. The free acid may be an organic acid or an inorganic acid. The organic acids include, but are not limited to, citric, acetic, lactic, tartaric, maleic, fumaric, formic, propionic, oxalic, trifluroacetic, benzoic, gluconic, methosulfonic, glycolic, succinic, Glutamic acid and aspartic acid. In addition, the inorganic acid includes, but is not limited to, hydrochloric acid, bromic acid, sulfuric acid, and phosphoric acid.

본 발명에 따른 약학적 조성물은 아데닌 또는 이들의 약학적으로 허용 가능한 염을 단독으로 함유하거나 또는 하나 이상의 약학적으로 허용되는 담체, 부형제 또는 희석제를 추가로 함유할 수 있다.
The pharmaceutical composition according to the present invention may contain adenine or a pharmaceutically acceptable salt thereof singly or may further contain one or more pharmaceutically acceptable carriers, excipients or diluents.

약학적으로 허용되는 담체로는 예컨대, 경구 투여용 담체 또는 비경구 투여용 담체를 추가로 포함할 수 있다. 경구 투여용 담체는 락토스, 전분, 셀룰로스 유도체, 마그네슘 스테아레이트, 스테아르산 등을 포함할 수 있다. 또한, 비경구 투여용 담체는 물, 적합한 오일, 식염수, 수성 글루코스 및 글리콜 등을 포함할 수 있으며, 안정화제 및 보존제를 추가로 포함할 수 있다. 적합한 안정화제로는 아황산수소나트륨, 아황산나트륨 또는 아스코르브산과 같은 항산화제가 있다. 적합한 보존제로는 벤즈알코늄 클로라이드, 메틸- 또는 프로필-파라벤 및 클로로부탄올이 있다. 그 밖의 약학적으로 허용되는 담체로는 다음의 문헌에 기재되어 있는 것을 참고로 할 수 있다 (Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, PA, 1995).
The pharmaceutically acceptable carrier may further include, for example, a carrier for oral administration or a carrier for parenteral administration. Carriers for oral administration may include lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, and the like. In addition, the carrier for parenteral administration may contain water, a suitable oil, a saline solution, an aqueous glucose and a glycol, and may further contain a stabilizer and a preservative. Suitable stabilizers include antioxidants such as sodium hydrogen sulfite, sodium sulfite or ascorbic acid. Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben and chlorobutanol. Other pharmaceutically acceptable carriers can be found in Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, Pa., 1995).

본 발명의 알레르기 질환 예방 또는 치료용 약학적 조성물은 인간을 비롯한 포유동물에 어떠한 방법으로도 투여할 수 있다. 예를 들면, 경구 또는 비경구적으로 투여할 수 있다. 비경구적인 투여방법으로는 이에 한정되지는 않으나, 정맥내, 근육내, 동맥내, 골수내, 경막내, 심장내, 경피, 피하, 복강내, 비강내, 장관, 국소, 설하 또는 직장내 투여일 수 있다. 바람직하게는 본 발명의 약학적 조성물은 경피 투여될 수 있다. 상기에서 ‘경피 투여’란 본 발명의 약학적 조성물을 세포 또는 피부에 투여하여 알레르기 질환의 예방 또는 치료용 약학적 조성물에 함유된 활성성분이 피부 내로 전달되도록 하는 것을 말한다. 예컨대, 본 발명의 약학적 조성물을 주사형 제형으로 제조하여 이를 30 게이지의 가는 주사 바늘로 피부를 가볍게 단자(prick)하는 방법, 또는 피부에 직접적으로 도포하는 방법으로 투여될 수 있다.
The pharmaceutical composition for preventing or treating allergic diseases of the present invention can be administered to mammals including humans by any method. For example, it can be administered orally or parenterally. Parenteral administration methods include, but are not limited to, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual or rectal administration Lt; / RTI &gt; Preferably, the pharmaceutical composition of the present invention can be transdermally administered. The term 'transdermal administration' as used herein refers to the administration of the pharmaceutical composition of the present invention to cells or skin to allow the active ingredient contained in the pharmaceutical composition for prevention or treatment of allergic diseases to be delivered into the skin. For example, the pharmaceutical composition of the present invention can be administered in a scanning type formulation, pricking the skin lightly with a 30 gauge needle, or directly applying it to the skin.

또한, 상기 약학적 조성물은 상술한 바와 같은 투여 경로에 따라 경구 투여용 또는 비경구 투여용 제제로 제형화 할 수 있다.
In addition, the pharmaceutical composition may be formulated into oral or parenteral formulations according to the route of administration as described above.

경구 투여용 제제의 경우에 본 발명의 조성물은 분말, 과립, 정제, 환제, 당의정제, 캡슐제, 액제, 겔제, 시럽제, 슬러리제, 현탁액 등으로 당업계에 공지된 방법을 이용하여 제형화될 수 있다. 예를 들어, 경구용 제제는 활성 성분을 고체 부형제와 배합한 다음 이를 분쇄하고 적합한 보조제를 첨가한 후 과립 혼합물로 가공함으로써 정제 또는 당의정제를 수득할 수 있다. 적합한 부형제의 예로는 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨 및 말티톨 등을 포함하는 당류와 옥수수 전분, 밀 전분, 쌀 전분 및 감자 전분 등을 포함하는 전분류, 셀룰로즈, 메틸 셀룰로즈, 나트륨 카르복시메틸셀룰로오즈 및 하이드록시프로필메틸-셀룰로즈 등을 포함하는 셀룰로즈류, 젤라틴, 폴리비닐피롤리돈 등과 같은 충전제가 포함될 수 있다. 또한, 경우에 따라 가교결합 폴리비닐피롤리돈, 한천, 알긴산 또는 나트륨 알기네이트 등을 붕해제로 첨가할 수 있다. 나아가, 본 발명의 약학적 조성물은 항응집제, 윤활제, 습윤제, 향료, 유화제 및 방부제 등을 추가로 포함할 수 있다.
In the case of a preparation for oral administration, the composition of the present invention may be formulated into a powder, a granule, a tablet, a pill, a sugar, a tablet, a liquid, a gel, a syrup, a slurry, . For example, an oral preparation can be obtained by combining the active ingredient with a solid excipient, then milling it, adding suitable auxiliaries, and then processing the mixture into a granular mixture. Examples of suitable excipients include, but are not limited to, sugars including lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol and maltitol, and starches including corn starch, wheat starch, rice starch and potato starch, Cellulose such as methylcellulose, sodium carboxymethylcellulose and hydroxypropylmethyl-cellulose and the like, fillers such as gelatin, polyvinylpyrrolidone and the like. In addition, crosslinked polyvinylpyrrolidone, agar, alginic acid, or sodium alginate may optionally be added as a disintegrant. Further, the pharmaceutical composition of the present invention may further comprise an anti-coagulant, a lubricant, a wetting agent, a flavoring agent, an emulsifying agent and an antiseptic agent.

비경구 투여용 제제의 경우에는 주사제, 크림제, 로션제, 외용연고제, 오일제, 보습제, 겔제, 에어로졸 및 비강흡입제의 형태로 당업계에 공지된 방법으로 제형화할 수 있다. 이들 제형은 모든 제약 화학에 일반적으로 공지된 처방서인 문헌(Remington's Pharmaceutical Science, 15th Edition, 1975. Mack Publishing Company, Easton, Pennsylvania 18042, Chapter 87: Blaug, Seymour)에 기재되어 있다.
In the case of a preparation for parenteral administration, it can be formulated by a method known in the art in the form of injection, cream, lotion, external ointment, oil, moisturizer, gel, aerosol and nasal aspirate. These formulations are described in Remington's Pharmaceutical Science, 15th edition, 1975. Mack Publishing Company, Easton, Pennsylvania 18042, Chapter 87: Blaug, Seymour, a commonly known formulary for all pharmaceutical chemistries.

본 발명의 아데닌의 총 유효량은 단일 투여량(single dose)으로 환자에게 투여될 수 있으며, 다중 투여량(multiple dose)으로 장기간 투여되는 분할 치료 방법(fractionated treatment protocol)에 의해 투여될 수 있다. 본 발명의 약학적 조성물은 질환의 정도에 따라 유효성분의 함량을 달리할 수 있다. 바람직하게 본 발명의 아데닌의 바람직한 전체 용량은 1일당 환자 체중 1kg 당 약 0.01 내지 1,000 mg, 가장 바람직하게는 0.1 내지 100 mg일 수 있다. 그러나 상기 아데닌의 용량은 약학적 조성물의 투여 경로 및 치료 횟수뿐만 아니라 환자의 연령, 체중, 건강 상태, 성별, 질환의 중증도, 식이 및 배설율등 다양한 요인들을 고려하여 환자에 대한 유효투여량이 결정되는 것이므로, 이러한 점을 고려할 때 당 분야의 통상적인 지식을 가진 자라면 상기 아데닌을 알레르기 질환의 예방 또는 치료제로서의 특정한 용도에 따른 적절한 유효투여량을 결정할 수 있을 것이다. 본 발명에 따른 약학적 조성물은 본 발명의 효과를 보이는 한 그 제형, 투여경로 및 투여 방법에 특별히 제한되지 아니한다.
The total effective amount of the adenine of the present invention may be administered to a patient in a single dose and may be administered by a fractionated treatment protocol administered over a prolonged period of time in multiple doses. In the pharmaceutical composition of the present invention, the content of the active ingredient may be varied depending on the degree of the disease. Preferably, the preferred total dose of the adenine of the present invention may be from about 0.01 to 1,000 mg, and most preferably from 0.1 to 100 mg, per kg body weight of the patient per day. However, the dose of adenine is determined based on various factors such as the patient's age, body weight, health condition, sex, severity of disease, diet and excretion rate as well as administration route and frequency of treatment of the pharmaceutical composition, The person skilled in the art will be able to determine the appropriate effective dose according to the specific use of the adenine as a preventive or therapeutic agent for allergic diseases. The pharmaceutical composition according to the present invention is not particularly limited to its formulation, administration route and administration method as long as the effect of the present invention is exhibited.

따라서 본 발명은 아데닌 또는 이들의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 알레르기 질환의 예방 및 치료용 약학적 조성물을 제공한다. 본 발명의 조성물은 염증 유발과 관련이 있는 비만세포내의 LTB4의 합성 억제, 탈과립 및 사이토카인 mRNA 생성을 억제함으로써 알레르기 질환에 효과적이므로 이들의 예방 및 치료의 목적으로 사용할 수 있다.
Accordingly, the present invention provides a pharmaceutical composition for the prevention and treatment of allergic diseases comprising adenine or a pharmaceutically acceptable salt thereof as an active ingredient. The composition of the present invention can be used for the prevention and treatment of allergic diseases by inhibiting the synthesis of LTB4, inhibiting degranulation and cytokine mRNA production in mast cells which are involved in inflammation induction.

도 1은 아데닌에 의한 탈과립 억제 효과를 나타낸 것이다(Ag-: DNP-HSA를 처리 하지 않은 상태, Ag+: DNP-HSA를 처리한 상태).
도 2는 아데닌의 염형태인 아데닌 헤미설페이트(Adenine hemisulfate)에 의한 탈과립 억제 효과를 나타낸 것이다(Ag-: DNP-HSA를 처리 하지 않은 상태, Ag+: DNP-HSA를 처리한 상태).
도 3은 아데닌에 의해 염증 유발 분자인 leukotriene B4(LTB4) 생성 억제효과를 나타낸 것이다.
도 4는 RBL-2H3 세포내 사이토카인(IL-3) mRNA 전사 수준에서 아데닌의 영향을 나타낸 것이다(CN: control (PBS 사용)).
도 5는 RBL-2H3 세포내 사이토카인(MCP-1) mRNA 전사 수준에서 아데닌의 영향을 나타낸 것이다(CN: control (PBS 사용)).
도 6는 생쥐에 아데닌을 복강투여했을 시, 국소피부과민반응 억제 효과를 나타낸다. (Ad: 아데닌 처리, Control: 생리식염수 처리)
1 shows the effect of inhibiting degranulation by adenine (Ag-: DNP-HSA untreated, Ag +: DNP-HSA treated).
FIG. 2 shows the effect of adenine hemisulfate (Ag-: DNP-HSA untreated, Ag +: DNP-HSA treated) against adenine hemisulfate.
FIG. 3 shows the inhibitory effect of adenine on the production of inflammatory molecule, leukotriene B4 (LTB4).
Figure 4 shows the effect of adenine at the transcription level of cytokine (IL-3) mRNA in RBL-2H3 cells (CN: control (using PBS)).
Figure 5 shows the effect of adenine at the transcription level of RBL-2H3 cytokine (MCP-1) mRNA (CN: control (using PBS)).
FIG. 6 shows the effect of suppressing the local skin hypersensitivity when mice are administered with adenine peritoneal cavity. (Ad: adenine treatment, Control: physiological saline treatment)

이하, 본 발명을 실시예에 의해 상세히 설명한다.Hereinafter, the present invention will be described in detail by way of examples.

단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.
However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

<실시예 1>&Lt; Example 1 >

세포 배양Cell culture

RBL-2H3 세포(American Type Culture Collection, Rockville, MD, USA)는 15% FBS(v/v)(PAA Lab. Canada), 페니실린 100 U/ml, 스트랩토마이신 100 μg/ml 이 포함된 EMEM(Lonza)에서 배양되었다. 배양은 5% CO2배양기에서 37℃로 유지했다. 세포는 트립신 EDTA용액으로 분리했다. 세척 후, 세포들은 새 배지에서 재현탁되고 다음 실험에 사용되었다.
RBL-2H3 cells (American Type Culture Collection, Rockville, Md., USA) were inoculated with EMEM containing 15% FBS (v / v) (PAA Lab. Canada), 100 U / ml penicillin, 100 μg / ml streptomycin Lonza). The culture was maintained at 37 ° C in a 5% CO 2 incubator. The cells were separated by trypsin EDTA solution. After washing, the cells were resuspended in fresh medium and used in the next experiment.

<실시예 2>&Lt; Example 2 >

탈과립Degranulation 어세이Assay (β-(β- hexosaminidasehexosaminidase 방출  Release 어세이Assay ) 및 ) And leukotrieneleukotriene B4 ( B4 ( LTB4LTB4 ) 측정 ) Measure

RBL-2H3 세포(1×105/ml)를 100 ng/ml의 DNP 특이 IgE(Sigma, St. Louis, MO, USA)에 하룻밤 동안 감작시켰다. Tyroide 버퍼에 3번 세척 후, 아데닌(Sigma-Aldrich) 및 아데닌 헤미설페이트(Sigma-Aldrich)의 투여량을 변화시켜 세포들을 30분 동안 37℃에서 노출시켰다. 배양 후 세포들은 100 ng/ml의 DNP-HSA(Sigma, St. Louis, MO, USA)에 20분간 37℃에 두었다. 그 후에 상층액을 모아 방출된 β-hexosaminidase 및 LTB4를 측정하였다. 세포 안에 남아 있는 β-hexosaminidase 측정을 위해서 세포들을 5분간 0.5% triton X-100에 용해했다. 상층액 10 μl와 용해물을 50 μl의 기질용액(p-nitrophenyl-N-acetyl-β-D-glucosaminide, 4 mM in citrate 0.1 M, pH 4.5)과 섞어 96 well plate에 각각 분주하고 37℃에서 1시간 배양했다. 0.2 M 글리신 (pH 10.7) 150 μl를 첨가해서 반응을 끝내고 microplate reader로 405 nM에서 흡광도를 측정했다. LTB4 측정을 위해서 상층액 100 μl를, LTB4 ELISA kit (Enzo Life Science, USA)를 사용하여 측정하였다. 시료 내에 있는 LTB4와 alkaline phosphatase와 결합된 LTB4를 경쟁적으로 anti-LTB4 antibody에 결합시킨 다음, alkaline phosphatase 기질을 넣어 발색시키고, 404 nm에서 흡광도를 측정하였다.
RBL-2H3 cells (1 × 10 5 / ml) were sensitized with 100 ng / ml of DNP specific IgE (Sigma, St. Louis, Mo., USA) overnight. After washing three times in Tyroide buffer, cells were exposed for 30 minutes at 37 ° C by changing the dose of adenine (Sigma-Aldrich) and adenine hemisulfate (Sigma-Aldrich). After incubation, cells were placed in DNP-HSA (Sigma, St. Louis, MO, USA) at 100 ng / ml for 20 min at 37 ° C. The supernatant was collected and the released β-hexosaminidase and LTB4 were measured. Cells were resuspended in 0.5% triton X-100 for 5 min for the remaining β-hexosaminidase in the cells. 10 μl of supernatant and lysate were mixed with 50 μl of a substrate solution ( p- nitrophenyl- N- acetyl-β-D-glucosaminide, 4 mM in citrate 0.1 M, pH 4.5) And cultured for 1 hour. 150 μl of 0.2 M glycine (pH 10.7) was added to complete the reaction and the absorbance was measured at 405 nM using a microplate reader. For LTB4 measurement, 100 μl of the supernatant was measured using an LTB4 ELISA kit (Enzo Life Science, USA). LTB4 in the sample and LTB4 bound to alkaline phosphatase were competitively bound to the anti-LTB4 antibody, then developed with alkaline phosphatase substrate and absorbance was measured at 404 nm.

RBL-2H3 세포의 탈과립 지표로써, 세포내에 있던 β-hexosaminidase가 버퍼 액으로 방출되는 정도를 측정했다. [도 1] 및 [도 2]에서 보는 바와 같이 아데닌 및 아데닌 헤미설페이트는 최대 억제 투여량 5 mM로, 투여량 의존적으로 RBL-2H3 세포에서 β-hexosaminidase의 방출을 저해했다.
As the degranulation index of RBL-2H3 cells, the degree of release of β-hexosaminidase in the cells into the buffer solution was measured. As shown in FIG. 1 and FIG. 2, adenine and adenine hemisulfate inhibited the release of β-hexosaminidase in RBL-2H3 cells in a dose-dependent manner at a maximal inhibitory dose of 5 mM.

또한 [도 3]에서 보는 바와 같이, 아데닌은 LTB4 생성을 억제 하였다. 따라서 아데닌은 비만세포의 탈과립과 아이코사노이드 LTB4 생성을 억제한다.
Also, as shown in Fig. 3, adenine inhibited LTB4 production. Thus, adenine inhibits the degranulation of mast cells and the production of icosanoid LTB4.

<실시예 3>&Lt; Example 3 >

사이토카인(IL-3 및 MCP-1) mRNA 측정Measurement of cytokines (IL-3 and MCP-1) mRNA

RBL-2H3세포는 아데닌으로 <실시예 2>의 탈과립 어세이에 명시된 방법으로 감작되고 처리되었다. 그리고 DNP-HSA(100 ng/ml)으로 3 시간 동안 자극되었다. PBS로 세포들을 세척 후 easy BLUE RNA extraction kit으로 RNA를 추출했다. 전체 RNA 중 1 ㎍은 Reverse Transcriptase Master premix (5X)로 지시된 방법에 따라 cDNA를 합성하는데 쓰였다. 사이토카인 IL-3 및 MCP-1에 대한 사이토카인 mRNA를 측정하기 위해 합성된 cDNA는 프라이머와 SYBR Green reagent(Applied Biosystem)와 함께 Real-Time PCR에 사용되었다. RBL-2H3 cells were sensitized and treated with adenine as described in the degranulation assay of Example 2. And stimulated with DNP-HSA (100 ng / ml) for 3 hours. After washing the cells with PBS, RNA was extracted with the easy BLUE RNA extraction kit. One μg of total RNA was used to synthesize cDNA according to the method indicated by Reverse Transcriptase Master premix (5X). The cDNA synthesized to measure cytokine mRNA for cytokine IL-3 and MCP-1 was used for real-time PCR with primers and SYBR Green reagent (Applied Biosystem).

서열 이름Sequence name 서열order 서열 번호SEQ ID NO: IL-3 (forward)IL-3 (forward) 5’- TCCTGATGCTCTTCCACC - 3’5'-TCCTGATGCTCTTCCACC-3 ' 1One IL-3 (reverse)IL-3 (reverse) 5’- TCGCAGCTGCAGGAATACAACACT - 3’5'-TCGCAGCTGCAGGAATACAACACT-3 ' 22 MCP-1 (forward)MCP-1 (forward) 5’- TGGCAAGATGATCCCAAT - 3’5'-TGGCAAGATGATCCCAAT-3 ' 33 MCP-1 (reverse)MCP-1 (reverse) 5’- AGGTGGTTGTGGAAAAG - 3’5'-AGGTGGTTGTGGAAAAG-3 ' 44

IL-3, MCP-1의 전사물 생산에서 아데닌의 영향을 Real-Time PCR로 측정했다. [도 4] 및 [도 5]에서 보는 바와 같이, IL-3과 MCP-1 의 사이토카인 전사 수준에서 아데닌의 처리는 완벽한 차단을 나타냈다.
The effect of adenine on the production of IL-3, MCP-1 transcripts was measured by Real-Time PCR. As shown in [Figure 4] and [Figure 5], the treatment of adenine at the cytokine transcription level of IL-3 and MCP-1 showed complete blocking.

<< 실시예Example 4> 4>

국소피부과민반응(Local skin sensitization ( passivepassive cutaneouscutaneous anaphylaxisanaphylaxis :: PCAPCA ))

IgE 항체중에서 dinitrophenyl (DNP)에 특이하게 결합하는 항체인 anti-DNP IgE를 생쥐(mouse strain DBA/1J)의 각 귀에 250 ng 씩 피하 주사하고, 24시간이 지난 다음 생쥐 몸무게 kg당 아데닌을 3.4 그리고 6.8 mg을 복강 주사하였다. 대조실험으로는 아데닌 대신 PBS를 복강 주사하였다. 1 시간 후에 10 mg/ml 농도의 DNP-HSA (dinitrophenyl-human serum albumin. human serum albumin에 DNP를 결합시킨 분자임)와 4% Evans blue 용액을 1:1 비율로 섞은 용액 200 μl를 생쥐의 꼬리 정맥에 주사 한다. 알러지 반응에 의해 혈관투과성이 증가한 부위로 Evans blue 용액이 혈관으로부터 유출된다. 30분 뒤에 생쥐의 귀를 여러 조각으로 잘라서 formamide 용액 500 μl에 넣고 섭씨 63도에서 밤새 방치하면 귀 혈관을 통해 유출된 Evans blue가 용액으로 나온다. Evans blue 620 nm 흡광도로 측정한다.
Anti-DNP IgE, an antibody specifically binding to dinitrophenyl (DNP), was subcutaneously injected 250 ng into each ear of mice (mouse strain DBA / 1J), and after 24 hours, adenine was weighed 3.4 kg per kg of body weight 6.8 mg were intraperitoneally injected. As a control experiment, PBS was intraperitoneally injected instead of adenine. After 1 hour, 200 μl of a 10: 1 mixture of DNP-HSA (DNP-conjugated to dinitrophenyl-human serum albumin, DNP conjugated to human serum albumin) and 4% Evans blue solution was added to the tail Intravenously. Evans blue solution is released from the blood vessels to the site where the vascular permeability is increased by the allergic reaction. After 30 minutes, the mouse's ears are cut into several pieces and placed in 500 μl of formamide solution. When left overnight at 63 ° C, evans blue that has flowed out through the ear vein comes out as a solution. Measure with Evans blue absorbance at 620 nm.

[도 6]에서 보는 바와 같이, 국소피부면역반응인 PCA로 실험 동물 모델의 국소피부조직에서 과민반응을 측정한 결과, 아데닌을 주사한 경우에 농도 의존적으로 Evans blue의 유출양이 적어졌다. 따라서 아데닌은 국소피부과민반응을 억제하는 것으로 나타났다.
As shown in FIG. 6, when hypersensitivity was measured in the local skin tissue of the experimental animal model with PCA as a local skin immune response, Evans blue leakage amount was decreased in a dose dependent manner when adenine was injected. Thus, adenine was shown to inhibit local skin sensitization.

이상 살펴본 바와 같이, 본 발명은 아데닌 또는 이들의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 알레르기 질환의 예방 및 치료용 약학적 조성물을 제공한다. 본 발명의 조성물은 알레르기의 원인 되는 비만세포의 leukotriene B4 (LTB4)의 합성 억제, 탈과립 및 사이토카인 mRNA 생성을 억제를 억제함으로써 알레르기 질환에 효과적이므로 이들의 예방 및 치료의 목적으로 사용할 수 있다.
As described above, the present invention provides a pharmaceutical composition for the prevention and treatment of allergic diseases comprising adenine or a pharmaceutically acceptable salt thereof as an active ingredient. The composition of the present invention can be used for the prevention and treatment of allergic diseases because it inhibits the inhibition of the synthesis of leukotriene B4 (LTB4) and the inhibition of degranulation and cytokine mRNA production of mast cells that cause allergies.

Claims (5)

화학식 1로 표시되는 아데닌(adenine) 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 알레르기 질환 예방 및 치료용 약학적 조성물.
<화학식 1>
Figure 112013060431091-pat00005

A pharmaceutical composition for the prevention and treatment of allergic diseases comprising adenine represented by the general formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient.
&Lt; Formula 1 >
Figure 112013060431091-pat00005

제1항에 있어서, 상기 알레르기 질환은 기관지천식, 화분증, 알레르기비염, 담마진 (두드러기), 아나필락시스, 소화관 알레르기, 약물 알레르기, 알레르기성 결막염 및 아토피성 피부염으로 이루어진 군에서 선택된 것임을 특징으로 하는 조성물.
The composition according to claim 1, wherein the allergic disease is selected from the group consisting of bronchial asthma, hay fever, allergic rhinitis, urticaria, anaphylaxis, digestive tract allergy, drug allergy, allergic conjunctivitis and atopic dermatitis.
화학식 1로 표시되는 아데닌(adenine) 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 비만세포 활성화 억제에 의한 알레르기 질환 예방 및 치료용 약학적 조성물.
<화학식 1>
Figure 112016022216093-pat00012

A pharmaceutical composition for preventing and treating allergic diseases caused by inhibition of mast cell activation comprising adenine represented by the formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient.
&Lt; Formula 1 >
Figure 112016022216093-pat00012

화학식 1로 표시되는 아데닌(adenine) 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 사이토카인 발현 억제에 의한 알레르기 질환 예방 및 치료용 약학적 조성물.
<화학식 1>
Figure 112016022216093-pat00013

A pharmaceutical composition for preventing and treating allergic diseases by inhibiting cytokine expression comprising adenine represented by the formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient.
&Lt; Formula 1 >
Figure 112016022216093-pat00013

화학식 1로 표시되는 아데닌(adenine) 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 아이코사노이드 생성 억제에 의한 알레르기 질환 예방 및 치료용 약학적 조성물.
<화학식 1>
Figure 112016022216093-pat00014
A pharmaceutical composition for preventing and treating allergic diseases caused by inhibition of icosanoid formation comprising adenine represented by the general formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient.
&Lt; Formula 1 >
Figure 112016022216093-pat00014
KR1020130078574A 2013-07-04 2013-07-04 Pharmaceutical composition for preventing and treating allergic disease comprising adenine or pharmaceutically acceptable salt thereof as an active ingredient KR101606885B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020130078574A KR101606885B1 (en) 2013-07-04 2013-07-04 Pharmaceutical composition for preventing and treating allergic disease comprising adenine or pharmaceutically acceptable salt thereof as an active ingredient

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020130078574A KR101606885B1 (en) 2013-07-04 2013-07-04 Pharmaceutical composition for preventing and treating allergic disease comprising adenine or pharmaceutically acceptable salt thereof as an active ingredient

Publications (2)

Publication Number Publication Date
KR20150005160A KR20150005160A (en) 2015-01-14
KR101606885B1 true KR101606885B1 (en) 2016-03-28

Family

ID=52477069

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020130078574A KR101606885B1 (en) 2013-07-04 2013-07-04 Pharmaceutical composition for preventing and treating allergic disease comprising adenine or pharmaceutically acceptable salt thereof as an active ingredient

Country Status (1)

Country Link
KR (1) KR101606885B1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101968299B1 (en) * 2017-11-28 2019-04-12 한국한의학연구원 Anti-allergic Composition Comprising Lappaol A as an Active Ingredient

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
J.IMMUNOL 2004; 173; 7539-7547

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101968299B1 (en) * 2017-11-28 2019-04-12 한국한의학연구원 Anti-allergic Composition Comprising Lappaol A as an Active Ingredient

Also Published As

Publication number Publication date
KR20150005160A (en) 2015-01-14

Similar Documents

Publication Publication Date Title
JP2002145777A (en) Therapeutic agent for arachidonic acid-induced dermatosis
JP6262225B2 (en) Oxabicycloheptanes and oxabicycloheptanes for the treatment of reperfusion injury
TW201225970A (en) A pharmaceutical composition for preventing or treating gout
CN104080451B (en) Indoles hydroxamic acid and indoline hydroxamic acid are in treatment heart failure or the purposes of neurotrosis
TWI740051B (en) Method for treating stroke or reducing nerve injury
KR101606885B1 (en) Pharmaceutical composition for preventing and treating allergic disease comprising adenine or pharmaceutically acceptable salt thereof as an active ingredient
JP2018516986A (en) A composition for preventing or treating arthritis comprising an extract of Usubanokiri Moku as an active ingredient
KR101510936B1 (en) Composition comprising extract of Martensia bibarii for prevention and treatment of autoimmune disease or inflammatory disease
TW201211041A (en) Agent for preventing or treating nonalcoholic steatohepatitis
KR20180115916A (en) Composition for preventing, alleviating and treating neurodegenerative diseases comprising hesperetin
KR20120128644A (en) Compounds for use in the treatment of diseases
JP2018516275A (en) A composition comprising naphthoquinone compounds for treating or preventing pancreatitis
KR101478304B1 (en) Pharmaceutical composition for treating or preventing neuroinflammatory disease
KR101247802B1 (en) Composition for preventing and treating inflammatory disease comprising piperine or pharmaceutically acceptable salt thereof as an active ingredient
JP4381495B2 (en) MCP-1 receptor antagonist comprising organic germanium compound as active ingredient, and preventive or therapeutic agent for inflammatory disease and organ disorder involving MCP-1
WO2022027239A1 (en) Use of primidone as pro-inflammatory cytokine inhibitor
KR102394110B1 (en) Novel compound and uses of the same
CN108904481B (en) Application of o-hydroxy chalcone analogue in preparation of antioxidant drugs
KR101184343B1 (en) Composition for preventing and treating inflammatory disease comprising piperine or pharmaceutically acceptable salt thereof as an active ingredient
JPWO2020004404A1 (en) IL-1β inhibitor
KR20150139326A (en) Pharmaceutical composition for preventing and treating allergic disease comprising capsiate or salt thereof as an active ingredient
KR102427769B1 (en) Composition for prevention or treatment of multiple sclerosis
KR102423725B1 (en) Composition for preventing, treating, or improving multiple sclerosis comprising capsidiol
CN109303776B (en) Application of seselin in preparing medicine for treating inflammatory diseases
JP4477504B2 (en) Antipruritic

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E90F Notification of reason for final refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20190226

Year of fee payment: 4

FPAY Annual fee payment

Payment date: 20200224

Year of fee payment: 5