KR101594421B1 - A method for selective gene expression in the retinal ON/OFF bipolar cell - Google Patents
A method for selective gene expression in the retinal ON/OFF bipolar cell Download PDFInfo
- Publication number
- KR101594421B1 KR101594421B1 KR1020130091597A KR20130091597A KR101594421B1 KR 101594421 B1 KR101594421 B1 KR 101594421B1 KR 1020130091597 A KR1020130091597 A KR 1020130091597A KR 20130091597 A KR20130091597 A KR 20130091597A KR 101594421 B1 KR101594421 B1 KR 101594421B1
- Authority
- KR
- South Korea
- Prior art keywords
- vector
- gene
- promoter
- cells
- seq
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0618—Cells of the nervous system
- C12N5/0621—Eye cells, e.g. cornea, iris pigmented cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/30—Nerves; Brain; Eyes; Corneal cells; Cerebrospinal fluid; Neuronal stem cells; Neuronal precursor cells; Glial cells; Oligodendrocytes; Schwann cells; Astroglia; Astrocytes; Choroid plexus; Spinal cord tissue
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/30—Vector systems comprising sequences for excision in presence of a recombinase, e.g. loxP or FRT
Landscapes
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Biomedical Technology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Neurology (AREA)
- Ophthalmology & Optometry (AREA)
- Neurosurgery (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Plant Pathology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
본 발병은 망막에 존재하는 ON 또는 OFF 이극세포에 선택적으로 광유전자를 발현시키기 위한 방법으로, 구체적으로는 ON 이극세포에 특이적으로 발현하는 프로모터, 제1 표적 유전자 및 Cre 유전자를 포함하는 제1 벡터 및 ON/OFF 이극세포에 발현하는 프로모터, 제2 표적 유전자 및 loxP 서열을 포함하는 제2 벡터를 포함하는 이극세포에서 선택적 유전자 발현용 키트 및 이를 이극세포에 도입하여 이극세포에서 유전자를 선택적으로 발현시키는 방법에 관한 것이다. 일 구체예에서 개시된 바업을 이용할 경우 광수용체가 없을 경우에도 이극세포에서 빛을 감지할 수 있으며, 이러한 경우 광수용체가 사멸하는 안질환을 갖는 환자에게 효과적인 치료법을 제공할 수 있다.The present invention relates to a method for selectively expressing a light gene in an ON or OFF bipolar cell present in the retina, and more particularly, to a method for expressing a light gene in a retina, And a second vector comprising a second target gene and a loxP sequence, and a kit for selectively expressing the gene in a ganglion cell, and introducing the gene into the ganglion cell to selectively express the gene in the ganglion cell Lt; / RTI > In the case of using the barge disclosed in one embodiment, light can be detected in the bipolar cells even in the absence of the photoreceptor, and in this case, an effective treatment can be provided to a patient having ocular disease in which the photoreceptor is killed.
Description
본 발명은 망막의 이극세포에서 유전자를 선택적으로 발현하는 기술에 대한 것이다.The present invention relates to a technique for selectively expressing genes in retinal cells of the retina.
광유전자를 망막보철에 이용하고자 하는 연구는 2005년 광유전학을 신경과학 분야에 적용하면서 자연스럽게 시작되었으나, 망막세포의 시각신호 네트워크를 고려하여 광유전자를 선택하고 세포 특이적으로 발현하고자 하는 연구는 비교적 최근에 시작되었다. 정상적인 망막에서의 광신호는 가장 먼저 광수용체가 활성화되고, 그 다음으로 ON/OFF 이극세포가 활성화되지만, 광수용체가 어떤 요인에 의해 사멸된 망막에서는 더 이상 광자극에 반응하는 세포가 없기 때문에 광신호가 아예 만들어질 수 없게 된다. The research on the use of optical genes in retinal prosthesis began naturally in 2005 when applying photogenetics to the neuroscience field. However, studies to select a photoreceptor and cell-specific expression in consideration of the visual signal network of retinal cells It started recently. In normal retinal optical signals, the photoreceptor is activated first, then the ON / OFF depolarization cell is activated, but since the photoreceptor is no longer responsive to the light stimulus in the retina where the photoreceptor is killed by some factor, The call can not be made at all.
현재까지 시신경으로 시각신호를 전달하는 마지막 세포인 신경절세포에 ON/OFF 선택성 없이 채널로돕신만을 발현시킨 경우, 장님생쥐의 광감응성이 매우 강한 빛으로 자극하였을 경우에 어느 정도 복구되었다는 것이 보고된 바 있다.It has been reported that when a channel rhodopsin alone is expressed in the ganglion cell, which is the last cell that transmits a visual signal to the optic nerve, ON / OFF selectivity is restored to some extent when the photosensitive sensitivity of the blind mouse is stimulated by a very strong light .
그러나, 망막질환과 관련된 특허분석을 통하여 확인한 결과, 망막세포에서 세포선택적 발현기술에 대한 특허는 ON 세포 특이적인 프로모터와 관련된 내용이 대부분이었다. 그러나, 보다 정확한 빛을 감지하기 위하여는 빛을 감지하는 ON 이극세포와 OFF 이극세포에 특이적으로 유전자를 조절할 필요가 있었다.However, as a result of the patent analysis related to the retinal disease, most of the patents related to the cell-selective expression technology in the retinal cells were related to the ON cell specific promoter. However, in order to detect the more accurate light, it was necessary to specifically regulate the gene on the ON-dipole cells and the OFF-dipole cells that sense light.
따라서, 이러한 문제점을 해결하기 위하여 두 종류의 프로모터를 이용하여 제작된 바이러스 벡터를 직접 생쥐의 망막에 투여하고 검증된 내용을 기반으로, 두 바이러스 벡터의 효용성과 유용성을 확인하고 본 발명을 완성하였다.Therefore, in order to solve these problems, the viral vectors prepared using two kinds of promoters were directly administered to the retina of the mice, and the utility and usefulness of the two viral vectors were confirmed based on the proved contents.
본 발명은 정상적인 망막의 시각신호전달 과정과 유사하도록 ON 이극세포와 OFF 이극세포를 동시에 선택적 발현이 가능하도록 하는 벡터를 제작하여 ON/OFF 이극세포에서 유전자를 선택적으로 발현하는 방법에 관한 것이다.The present invention relates to a method for selectively expressing a gene in an ON / OFF bipolar cell by preparing a vector capable of simultaneously expressing ON-tropic cells and OFF-bifurcated cells so as to be similar to normal visual signaling of the retina.
일 양상은 ON 이극세포에 특이적으로 발현하는 프로모터, 제1 표적 유전자 및 Cre 유전자를 포함하는 제1 벡터 및 ON/OFF 이극세포에 발현하는 프로모터, 제2 표적 유전자 및 loxP 서열을 포함하는 제2 벡터를 포함하는 이극세포에서 선택적 유전자 발현용 키트를 제공한다.One aspect includes a promoter that specifically expresses ON tropic cells, a first vector comprising a first target gene and a Cre gene, a promoter expressing on ON / OFF tropolecules, a second target gene comprising a second target gene and a loxP sequence Lt; RTI ID = 0.0 > a < / RTI > vector.
본 명세서에서 사용된 용어, "이극세포"는 "bipolar cell"이라고도 하며, 망막(retian)의 일부이다. 이극세포는 광수용체(photoreceptor)와 신경절 세포(ganglion cell)의 사이에 존재한다. 이때, 광수용체는 간상 세포(rod cell)과 원추 세포(cone cell)을 의미한다. 이극 세포는 광수용체에서 받은 신호를 신경절 세포로 전달하는 역할을 한다. 이극세포는 기능에 따라 ON 이극세포와 OFF 이극세포로 구분된다. 본 명세서에서 사용된 용어, "ON 이극세포"는 빛이 존재할 때 탈분극(depolarization)을 일으키는 이극세포를 의미한다. 또한, 빛이 없을 경우에는 과분극(hyperpolarization)을 일으킨다. 또한, "OFF 이극세포"는 빛이 존재할 때는 과분극 상태로 존재하나, 빛이 없을 경우에는 탈분극을 일으키는 이극세포를 의미한다. The term "bipolar cell ", as used herein, is also referred to as a" bipolar cell ", and is part of the retina. Bipolar cells are located between photoreceptors and ganglion cells. At this time, the photoreceptors are rod cells and cone cells. Bipolar cells serve to transfer signals from photoreceptors to ganglion cells. Bipolar cells are classified into ON-tropic cells and OFF-tropic cells depending on function. As used herein, the term "ON bipolar cell" refers to a bipolar cell that causes depolarization when light is present. In the absence of light, hyperpolarization occurs. In addition, the term "OFF dipole cell" refers to a bipolar cell that exists in a hyperpolarized state when light exists, but causes depolarization in the absence of light.
본 명세서에서 사용된 용어, "Cre 유전자"는 "Cre 재조합효소" 또는 "Cre recombinase" 또는 "Cyclization recombinase"를 코딩하는 유전자를 의미한다. Cre 재조합효소는 Cre-Lox 재조합을 유발하는데 활용되는 효소이다. 상기 Cre 재조합효소는 P1 박테리아파지에서 유래한 티로신 재조합 효소일 수 있다. 상기 Cre 재조합효소를 코딩하는 유전자는 서열번호 4의 핵산 서열을 가질 수 있다. 본 명세서에서 사용된 용어, "loxP 서열"는 Cre-Lox 재조합에서 Cre 재조합효소에 의해 인식되어 재조합이 일어나는 부위를 의미한다. 두개의 loxP가 Cre 재조합효소에 의해 인식되어, 두개의 loxP 사이의 유전자가 결실되게 된다. 상기 loxP 서열은 서열번호 25 내지 28 중 어느 하나일 수 있다. 또한, 서열번호 25 및 서열번호 26의 loxP 서열이 하나의 세트로 사용될 수 있다. 또한, 서열번호 27 및 서열번호 28의 loxP 서열이 하나의 세트로 사용될 수 있다. 또한, 두 개의 loxP 서열의 사이에는 제2 표적 유전자가 위치하도록 하여야 한다.As used herein, the term "Cre gene" refers to a gene encoding "Cre recombinase" or "Cre recombinase" or "Cyclization recombinase. Cre recombinase is an enzyme that is used to induce Cre-Lox recombination. The Cre recombinase may be a tyrosine recombinase derived from P1 bacterial phage. The gene encoding the Cre recombinase may have the nucleotide sequence of SEQ ID NO: 4. As used herein, the term "loxP sequence" refers to the site recognized by Cre recombinase in Cre-Lox recombination, where recombination occurs. Two loxPs are recognized by the Cre recombinase, resulting in the deletion of the gene between the two loxPs. The loxP sequence may be any one of SEQ ID NOS: 25-28. In addition, the loxP sequences of SEQ ID NO: 25 and SEQ ID NO: 26 can be used in one set. Also, the loxP sequences of SEQ ID NO: 27 and SEQ ID NO: 28 can be used in one set. Also, the second target gene should be located between the two loxP sequences.
상기 ON 이극세포에 특이적으로 발현하는 프로모터는 이극 세포중 OFF 이극세포에서는 발현을 하지 않으며, ON 이극세포에서만 발현을 하는 유전자에서 유래하는 프로모터일 수 있다. 일 구체예로는 대사성 글루타민산염 수용체 6(mGluR6)를 코딩하는 유전자의 발현을 조절하는 프로모터일 수 있다.The promoter specifically expressed in the ON thymocyte may be a promoter derived from a gene that does not express in the OFF thymocyte of the thyroid gland but expresses only in the ON thyroid gland. In one embodiment, it may be a promoter that regulates the expression of a gene encoding metabotropic glutamate receptor 6 (mGluR6).
상기 ON/OFF 이극세포에 특이적으로 발현하는 프로모터는 이극 세포중 OFF 이극세포와 ON 이극세포에서 발현을 하는 유전자에서 유래하는 프로모터일 수 있다. 일 구체예로는 호메오박스를 포함하는 전사인자 10(homeobox-containing transcription factor 10, CHX10)를 코딩하는 유전자의 발현을 조절하는 프로모터일 수 있다. 또한, CaBP5 유전자의 발현을 조절하는 프로모터 일 수 있다.The promoter specifically expressed in the ON / OFF dipitorial cells may be a promoter derived from a gene which expresses in OFF dipole cells and ON dipole cells in the dipole cells. In one embodiment, the promoter may be a promoter that regulates the expression of a gene encoding a homeobox-containing transcription factor 10 (CHX10) comprising a homeobox. It may also be a promoter that regulates the expression of the CaBP5 gene.
또한 상기 제1 표적 유전자는 ON 이극세포에서 특이적으로 발현시키기 위한 유전자를 의미한다. 이때, 제1 표적 유전자는 채널로돕신일 수 있다. 상기 채널로돕신은 "channelrhodopsin"이라고 하며, 조류(algae)나 박테리아(bacteria) 등에 존재하는 빛에 민감하게 반응하는 이온 채널 단백질 일 수 있다. 이때, 상기 채널로돕신은 녹조류에서 발견되는 채널로돕신 2(이하, ChR2라고 한다)일 수 있다. 상기 ChR2는 Na+, Ca++ 등의 이온 채널을 조절하며, 푸른 빛이 들어와서 ChR2 이온 채널을 자극할 경우, 이온 채널이 개방되어 Na+, Ca++가 세포안으로 들어와 세포가 탈분극(depolarization)이 일어나게 된다. 또한, 상기 채널로돕신은 볼복스 미생물 유래의 볼복스 채널로돕신 1(Volvox channelrhodopsin-1, VChr1)일 수 있다.Also, the first target gene refers to a gene for specifically expressing in the ON tropic cells. At this time, the first target gene may be channelrodorphine. The channel rhodopsin is called "channelrhodopsin" and may be an ion channel protein that is sensitive to light existing in algae, bacteria, and the like. At this time, the channel rhodopsin may be channel rhodopsin 2 (hereinafter referred to as ChR2) found in green algae. The ChR2 modulates ion channels such as Na + and Ca ++. When blue light comes in and stimulates the ChR2 ion channel, the ion channel is opened, Na + and Ca ++ enter the cell, and depolarization of the cell occurs. In addition, the channel rhodopsin may be a Volvox channel rhodopsin-1, VChr1 derived from a Volvox microorganism.
또한, 상기 채널로돕신은 빛에 반응하여 이온을 조절할 수 있는 한 적절한 변형이 이루어 질 수 있다. 변형은 이온 채널을 구성하는 단백질의 아미노산의 치환, 결실 또는 부가에 의해 이루어 질 수 있다. 또한, 빛에 반응하여 이온을 조절할 수 있는 한 채널로돕신을 코딩하는 핵산의 부가, 치환 또는 결실에 의해 변형될 수 있다.In addition, the channel rhodopsin can be appropriately modified as long as it can control the ions in response to light. Deformation may be caused by substitution, deletion or addition of an amino acid of a protein constituting the ion channel. It can also be modified by addition, substitution or deletion of a nucleic acid encoding a channel rhodopsin capable of modulating the ion in response to light.
또한 상기 제2 표적 유전자는 OFF 이극세포에서 특이적으로 발현시키기 위한 유전자를 의미한다. 이때, 제2 표적 유전자는 할로로돕신일 수 있다. 상기 채널로돕신은 "halorhodopsin"이라고 하며, 미생물인 "Natronomonas pharaonis"에서 유래한 이온 수송체이다. 상기 할로로돕신은 "Natronomonas pharaonis halorhodopsin" 또는 "NpHR"라고도 한다. 상기 할로로돕신은 노란 빛에 반응하여 Cl- 이온은 세포 안으로 들여오는 Cl- 수송체(transporter)를 의미한다. 상기 할로로돕신을 가지고 있는 세포가 노란 빛을 받으면, 할로로돕신이 Cl-를 세포 안으로 유입시켜, 세포는 과분극(hyperpolarize)이 일어나게 된다. 또한, 상기 할로로돕신은 빛에 반응하여 이온을 조절할 수 있는 한 적절한 변형이 이루어 질 수 있다. 변형은 이온 채널을 구성하는 단백질의 아미노산의 치환, 결실 또는 부가에 의해 이루어 질 수 있다. 또한, 빛에 반응하여 이온을 조절할 수 있는 한 할로로돕신을 코딩하는 핵산의 부가, 치환 또는 결실에 의해 변형될 수 있다. And the second target gene is a gene for specifically expressing in the OFF tropic cell. At this time, the second target gene may be halodipropine. The channel rhodopsin is called "halorhodopsin" and is an ion transporter derived from the microorganism "Natronomonas pharaonis ". The halothiocin is also referred to as "Natronomonas pharaonis halorhodopsin" or "NpHR ". The halodiprocine refers to a Cl-transporter that reacts with yellow light and Cl- ions into the cell. When the cell harboring halodiprosine receives a yellow light, halo-dopase inflows Cl- into the cell, causing hyperpolarization of the cell. In addition, the halodipsin can be suitably modified so long as it can control the ions in response to light. Deformation may be caused by substitution, deletion or addition of an amino acid of a protein constituting the ion channel. It can also be modified by addition, substitution or deletion of a nucleic acid encoding halorodoxine as long as it can control the ion in response to light.
본 명세서에서 사용된 용어, "벡터"는 유전자를 세포에 전달하는 매개체 DNA로서, 클로닝 운반체(cloning vehicle)라고도 한다. 또한, 상기 벡터는 플라스미드, 파지 유래의 DNA 또는 바이러스 유래의 DNA를 이용할 수 있다. 일 구체예로는 바이러스 유래의 DNA가 이용될 수 있으며, 아데노 바이러스 유래의 AAV(adeno-associated virus)가 이용될 수 있다. 또한, 상기 벡터는 멀티클로닝사이트(multicloning site, MCS)를 포함할 수 있다. 멀티클로닝사이트는 여러가지 제한효소(restriction enzyme)이 인식하여 절단할 수 있는 핵산서열을 가지고 있는 DNA이다. 이때, 제한 효소는 EcoRI, BamHI, BgIII 등일 수 있으나, 이에 제한되는 것은 아니다.As used herein, the term "vector" is a mediator DNA that transfers a gene to a cell, which is also referred to as a cloning vehicle. The vector may be a plasmid, a phage-derived DNA, or a virus-derived DNA. In one embodiment, virus-derived DNA may be used, and an adeno-associated virus (AAV) derived from adenovirus may be used. In addition, the vector may comprise a multicloning site (MCS). A multicloning site is a DNA having a nucleic acid sequence capable of recognizing and cleaving by various restriction enzymes. The restriction enzyme may be EcoRI, BamHI, BgIII or the like, but is not limited thereto.
또 다른 양상은 이극 세포에 제1 벡터를 도입하는 단계에 있어서, 상기 제1 벡터는 ON 이극세포에 특이적으로 발현하는 프로모터, 제1 표적 유전자 및 Cre 유전자를 포함하는 것인 단계; 및 이극 세포에 제2 벡터를 도입하는 단계에 있어서, 상기 제2 벡터는 ON/OFF 이극세포에 발현하는 프로모터, 제2 표적 유전자 및 loxP 서열을 포함하는 것인 단계를 포함하는 이극 세포에서 제1 표적 유전자 및 제2 표적 유전자를 선택적으로 발현시키는 방법을 제공한다.In another aspect, the present invention provides a method for producing a transgenic animal, comprising introducing a first vector into a thymocyte, wherein the first vector comprises a promoter, a first target gene and a Cre gene specifically expressed in an ON streak cell; And introducing a second vector into the bifunctional cell, wherein the second vector comprises a promoter that expresses on the ON / OFF dorsal cell, a second target gene, and a loxP sequence. Thereby selectively expressing the target gene and the second target gene.
상기 유전자를 선택적으로 발현시키는 방법을 상세히 설명하면 다음과 같다. 먼져, 상기 방법은 ON 이극세포에 특이적으로 발현하는 프로모터, 제1 표적 유전자 및 Cre 유전자를 포함하는 제1 벡터를 이극세포에 도입하는 단계를 포함한다. 이때, 상기 ON 이극세포에 특이적으로 발현하는 프로모터는 이극 세포중 OFF 이극세포에서는 발현을 하지 않으며, ON 이극세포에서만 발현을 하는 유전자에서 유래하는 프로모터일 수 있다. 일 구체예로는 대사성 글루타민산염 수용체 6(mGluR6)를 코딩하는 유전자의 발현을 조절하는 프로모터일 수 있다. 또한, 상기 제1 표적 유전자는 채널로돕신일 수 있다. 상기 채널로돕신은 녹조류에서 발견되는 채널로돕신 2 일 수 있다. 또는 상기 채널로돕신은 VChr1 일 수 있다. 상기에서 사용되는 벡터는 바이러스 유래의 벡터일 수 있으며, 일 구체예로는 아데노 바이러스에서 유래한 벡터일 수 있다.A method of selectively expressing the gene will be described in detail as follows. The method includes the step of introducing a first vector comprising a promoter, a first target gene and a Cre gene specifically expressed in ON thymocytes into the bipolar cells. At this time, the promoter specifically expressed in the ON thymocytes may not be expressed in the OFF thymocytes of the thymocytes but may be a promoter derived from a gene that expresses only in ON thymocytes. In one embodiment, it may be a promoter that regulates the expression of a gene encoding metabotropic glutamate receptor 6 (mGluR6). In addition, the first target gene may be channel rhodopsin. The channel rhodopsin may be
또한, 이후 ON/OFF 이극세포에 발현하는 프로모터, 제2 표적 유전자 및 loxP 서열을 포함하는 제2 벡터를 이극세포에 도입하는 단계를 포함한다. 상기 ON/OFF 이극세포에 특이적으로 발현하는 프로모터는 이극 세포중 OFF 이극세포와 ON 이극세포에서 발현을 하는 유전자에서 유래하는 프로모터일 수 있다. 일 구체예로는 호메오박스를 포함하는 전사인자 10(homeobox-containing transcription factor 10, CHX10)를 코딩하는 유전자의 발현을 조절하는 프로모터일 수 있다. 또한, 상기 제2 표적 유전자는 OFF 이극세포에서 특이적으로 발현시키기 위한 유전자를 의미한다. 상기 제2 표적 유전자는 할로로돕신일 수 있다. 상기에서 사용되는 벡터는 바이러스 유래의 벡터일 수 있으며, 일 구체예로는 아데노 바이러스에서 유래한 벡터일 수 있다.Further, the method further comprises the step of introducing into the bipolar cells a second vector comprising a promoter expressing ON / OFF bipolar cells, a second target gene and a loxP sequence. The promoter specifically expressed in the ON / OFF dipitorial cells may be a promoter derived from a gene which expresses in OFF dipole cells and ON dipole cells in the dipole cells. In one embodiment, the promoter may be a promoter that regulates the expression of a gene encoding a homeobox-containing transcription factor 10 (CHX10) comprising a homeobox. In addition, the second target gene means a gene for specifically expressing in the OFF tropic cell. The second target gene may be halodorcine. The vector used herein may be a virus-derived vector, and in one embodiment, it may be a vector derived from an adenovirus.
상기에서 도입은 제1 벡터 및 제2 벡터를 직접 이극세포에 접촉시킴으로써 세포내로 도입시킬 수 있다. 이때, 이극세포는 망막내에 존재할 경우 제1 벡터 및 제2 벡터를 망막으로 주입하여 이극세포로 상기 벡터를 도입할 수 있다. 망막으로 주입하는 방법은 망막 내외부에서 주사를 이용하여 주입될 수 있으며, 망막하에서 주입될 수 있다. 그러나, 이극세포에 상기 벡터가 도달할 수 있다면 통상의 모든 방법이 적용가능하다.The introduction in the above can be introduced into cells by directly contacting the first vector and the second vector to the recipient cells. In this case, when the bipolar cells are present in the retina, the first vector and the second vector can be introduced into the retina and introduced into the bipolar cells. The method of injecting into the retina can be injected using the injection from the inside or the outside of the retina and injected under the retina. However, if the vector can reach the bipolar cells, all usual methods are applicable.
일 구체예에 따르면, 아데노 바이러스 유래의 벡터를 사용하고, 제1 벡터는 ON 이극세포에서 발현하는 프로모터, 채널로돕신 2 및 Cre 유전자를 포함하고, 제2 벡터에는 ON/OFF 이극세포에서 발현하는 프로모터, 할로로돕신 및 두개의 loxP 서열을 포함할 수 있다. 이때, 제1 벡터가 이극세포로 도입되면, 이극세포의 크로모좀 내부로 제1 벡터에 있는 ON 이극세포에서 발현하는 프로모터, 채널로돕신 2 및 Cre 유전자가 도입되게 된다. 이때, 제2 벡터가 이극세포로 도입되면, ON/OFF 이극세포에서 발현하는 프로모터, 할로로돕신 및 두개의 loxP 서열이 도입되게 된다.According to one embodiment, a vector derived from adenovirus is used, and the first vector includes a promoter expressed in ON tropic cells, a
이때, 제2 벡터의 프로모터가 ON/OFF 이극세포에서 모두 발현하기 때문에, ON 이극세포와 OFF 이극세포에서는 할로로돕신이 발현되게 된다. 그러나, 제1 벡터는 ON 이극세포에서만 발현하게 되므로, ON 이극세포에서는 채널로돕신 2만이 발현하게 된다. 그러나, ON 이극세포에서는 제1 벡터에 의해 도입된 Cre 재조합효소가 함께 발현되고, 제2 벡터에 도입된 loxP 사이트를 인지하여 두개의 loxP 서열 사이에 있는 할로로돕신 유전자를 제거하게 된다. 따라서, ON 이극세포에서는 채널로돕신 2만이 발현되고, 할로로돕신은 발현되지 못하게 된다. 반면, OFF 이극세포에서는 제1 벡터가 발현되지 못하므로, 제2 벡터에 의해 할로로돕신만이 발현되게 된다.At this time, because the promoter of the second vector is expressed in ON / OFF bipolar cells, halodipodine is expressed in ON bipolar cells and OFF bipolar cells. However, since the first vector is expressed only in ON thymocytes, only channel
본 발명은 기존의 방법과 달리 ON 이극세포와 OFF 이극세포에 동시에 선택적인 광유전자를 발현하도록 하여 시각신호 네트워크를 복원하게 함으로써 난치성 질환의 시각 장애인들에게 시각기능이 회복되도록 하는데 기여할 수 있다.Unlike the conventional method, the present invention can simultaneously restore a visual signal network by simultaneously expressing a selective light gene in the ON-tropic cells and the OFF-tropic cells, thereby contributing to restoration of the visual function in the visually impaired of the refractory disease.
도 1은 채널로돕신의 빛에 대한 반응을 나타내는 것이다.
도 2는 바이러스에 의한 망막세포 감염 및 바이러스에 의해 감염된 망막세포의 시신경 신호를 측정하는 방법을 개략적으로 나타낸 것이다.
도 3은 ON 이극세포에 도입하기 위한 ON AAV 벡터의 개열도 및 OFF 이극세포에 도입하기 위한 OFF AAV 벡터의 개열도를 나타낸 것이다.
도 4는 ON AAV에 ChR2와 YFP를 포함시켜 망막으로 유전자를 도입한 후 YFP의 발현을 확인한 것으로, 생쥐망막에서 마커 단백질인 Goa 와의 중첩 정도를 통해 ON 이극세포에서의 발현 선택성을 검증한 것을 나타낸다.
도 5는 광수용체 손상 생쥐모델인 FVB 생쥐에 채널로돕신 AAV를 발현시키고, 광감응성이 회복되었는지 여부를 MEA (Microelectrode Arrays) 실험을 통해 검증한 것을 나타낸다.Figure 1 shows the response of the channel rhodopsin to light.
2 schematically shows a method for measuring optic nerve signals of retinal cells infected by viruses and viruses.
Fig. 3 shows the degree of cleavage of the ON AAV vector for introduction into ON thymocytes and the open degree of the OFF AAV vector for introduction into the OFF thymocytes.
FIG. 4 shows the expression of YFP after incorporating ChR2 and YFP into ONAAV and introducing the gene into the retina. The expression level of YFP in ON retina was verified by the degree of superimposition with Goa in the mouse retina .
FIG. 5 shows the results of a microelectrode array (MEA) test to confirm whether or not channeled rhodopsin AAV is expressed in a photoreceptor-impaired mouse model FVB mouse and whether the photosensitivity is restored.
이하 본 발명을 실시예를 통하여 보다 상세하게 설명한다. 그러나, 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
Hereinafter, the present invention will be described in more detail with reference to examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.
실시예Example 1. 형질전환용 벡터의 제작 1. Preparation of vector for transformation
1.1. 1.1. ONON -- AAVAAV 벡터 제작 Vector production
이극 세포중 ON 이극세포에서 발현하는 벡터를 제작하였다. 발현벡터는 pAAV-MCS 벡터(adeno-associated virus multicloning site vector)(Stratagene, 서열 번호 1)를 기반으로 하였다. 먼져, pAAV-MCS 벡터의 CMV 프로모터 부위를 위치지정 돌연변이(site-directed mutagenesis) 방법으로 제거하였다. 이는 EzChangeTM mutagenesis kit(Enzynomics, Korea)를 통하여 수행하였다. 반응 조건은 10X 반응 버퍼(Reaction buffer) 5 ㎕, DNA 폴리머라아제로 nPfu-Forte(Cat. # P410, P425)(2.5 units/㎕) 1 ㎕, dNTP 혼합물 (dATP, dTTP, dCTP, 및 dGTP 각각 2 mM) 4 ㎕, pAAV-MCS 벡터 1 ㎕, 프라이머 1(서열 번호 11 : TCGCGTGCGGCCGCAGGAAC) (10 pmol/㎕) 1 ㎕, 프라이머 2 ( 서열 번호 12: GAATTCCCCGGGGATCCTCT)(10 pmol/㎕) 1 ㎕, 전체가 50 ㎕ 증류수를 혼합하였다. 그 후, 95℃에서 2분 동안 가열시킨 후, 95℃에서 30초, 55℃에서 45초, 72℃에서 2분으로 25사이클 반복한 후, 2℃에서 5분 동안 반응시켰다.A vector expressing in the bipolar cells was prepared. The expression vector was based on the pAAV-MCS vector (Stratagene, SEQ ID NO: 1). The CMV promoter region of the pAAV-MCS vector was removed by site-directed mutagenesis. Which it was carried through the EzChange TM mutagenesis kit (Enzynomics, Korea ). The reaction conditions were as follows: 5 μl of 10 × reaction buffer, 1 μl of DNA polymerase nPfu-Forte (Cat. # P410, P425) (2.5 units / μl), dNTP mixture (dATP, dTTP, dCTP, and
상기에서 수득한 CMV가 제거된 pAAV-MCS 벡터에 mGluR6 프로모터(서열번호 2)를 도입하였다. 이때, mGluR6를 포함하는 벡터(addgene #18817)를 서열번호 13(GAATTCGATCTCCAGA TGGCTAAACT) 및 서열번호 14(GAATTCCAACCAGTCTTGTTTGAGCC)를 갖는 프라이머를 이용하여 PCR로 증폭하였다. 그 후, 증폭 산물을 EcoRI으로 절단한 후 증폭 산물을 수득하였다. 또한, CMV가 제거된 pAAV-MCS 벡터를 EcoRI으로 절단하여 수득하였다. 그 후, mGluR6 프로모터와 CMV가 제거된 pAAV-MCS 벡터를 혼합한 후 리가아제로 결합하였다.The mGluR6 promoter (SEQ ID NO: 2) was introduced into the pAAV-MCS vector from which CMV was removed. At this time, a vector containing mGluR6 (addgene # 18817) was amplified by PCR using a primer having SEQ ID NO: 13 (GAATTCGATCTCCAGA TGGCTAAACT) and SEQ ID NO: 14 (GAATTCCAACCAGTCTTGTTTGAGCC). The amplification product was then digested with EcoRI and the amplified product was obtained. Further, the pAAV-MCS vector from which CMV was removed was obtained by digesting with EcoRI. Then, the mGluR6 promoter and the pAAV-MCS vector from which CMV was removed were mixed and ligated with ligase.
또한, 상기에서 mGluR6 프로모터가 결합된 pAAV-MCS 벡터에 Chr2-YFP 서열(서열번호 3)을 도입하였다. 이때, YFP는 황색 형광 단백질을 의미한다. 이때, Chr2-YFP 서열을 포함하는 벡터(addgene #20298)를 서열번호 15(GGATCCCCACCATGGGACTATGGCGGC) 및 서열번호 16(GGATCCCTTGTACAGCTCGTCCATGC)를 갖는 프라이머를 이용하여 PCR로 증폭하였다. 그 후, 증폭 산물을 BamHI로 절단한 후 증폭 산물을 수득하였다. 또한, mGluR6 프로모터가 결합된 pAAV-MCS 벡터를 BamHI로 절단하여 수득하였다. 그 후, Chr2-YFP 서열과 mGluR6 프로모터가 결합된 pAAV-MCS 벡터를 혼합한 후 리가아제로 결합하였다.In addition, the Chr2-YFP sequence (SEQ ID NO: 3) was introduced into the pAAV-MCS vector to which the mGluR6 promoter was linked. Here, YFP means a yellow fluorescent protein. At this time, a vector containing the Chr2-YFP sequence (addgene # 20298) was amplified by PCR using primers having SEQ ID NO: 15 (GGATCCCCACCATGGGACTATGGCGGC) and SEQ ID NO: 16 (GGATCCCTTGTACAGCTCGTCCATGC). Thereafter, the amplification product was digested with BamHI and an amplification product was obtained. Further, the pAAV-MCS vector to which the mGluR6 promoter was bound was cleaved with BamHI. Then, the pAAV-MCS vector to which the Chr2-YFP sequence and the mGluR6 promoter were bound was mixed and ligated with ligase.
또한, 상기에서 mGluR6 프로모터 및 Chr2-YFP 서열이 결합된 pAAV-MCS 벡터에 Cre recombinase 서열(서열번호 4)을 도입하였다. 이때, Cre 유전자를 포함하는 벡터(pxCan-Cre)를 서열번호 17(AGATCTATGAGCGGCCCTCCAAAAAA) 및 서열번호 18(AGATCTCTAATCGCCATCTTCCAGCAGGC)를 갖는 프라이머를 이용하여 PCR로 증폭하였다. 그 후, 증폭 산물을 BglII로 절단한 후 증폭 산물을 수득하였다. 또한, mGluR6 프로모터 및 Chr2-YFP 서열이 결합된 pAAV-MCS 벡터를 BglII로 절단하여 수득하였다. 그 후, Cre recombinase 서열과 mGluR6 프로모터 및 Chr2-YFP 서열이 결합된 pAAV-MCS 벡터를 혼합한 후 리가아제로 결합하였다.In addition, the Cre recombinase sequence (SEQ ID NO: 4) was introduced into the pAAV-MCS vector to which the mGluR6 promoter and the Chr2-YFP sequence were ligated. At this time, a vector (pxCan-Cre) containing Cre gene was amplified by PCR using primers having SEQ ID NO: 17 (AGATCTATGAGCGGCCCTCCAAAAAA) and SEQ ID NO: 18 (AGATCTCTAATCGCCATCTTCCAGCAGGC). Thereafter, the amplification product was digested with BglII and an amplification product was obtained. Further, the pAAV-MCS vector to which the mGluR6 promoter and the Chr2-YFP sequence were bound was obtained by digesting with BglII. Thereafter, the Cre recombinase sequence was ligated with the pAAV-MCS vector conjugated with the mGluR6 promoter and the Chr2-YFP sequence, followed by ligase binding.
또한, 상기에서 얻은 Cre recombinase 서열, mGluR6 프로모터 및 Chr2-YFP 서열이 결합된 pAAV-MCS 벡터에 2A 서열(서열 5)을 위치지정 돌연변이 방법을 통하여 삽입하였다. 상기에서 CMV 프로모터를 제거하는 방법과 동일한 방법을 수행하였다. 다만, 이때, 프라이머는 서열번호 19(caggctggagacgtggaggagaaccctggacct atgagcggccctccaaaaaa) 및 서열번호 20(cttcagcaggctgaagttagtagctccgcttcc cttgtacagctcgtccatgc)을 갖는 프라이머를 사용하였다. 다만, 주형은 Cre recombinase 서열, mGluR6 프로모터 및 Chr2-YFP 서열이 결합된 pAAV-MCS 벡터를 사용하였다. 이러한 방법으로 Cre recombinase 서열, mGluR6 프로모터, 2A 서열 및 Chr2-YFP 서열이 결합된 pAAV-MCS 벡터의 서열(서열번호 6)을 확인하였고, 이를 ON-AAV라 명명하였다.
2A sequence (SEQ ID NO: 5) was inserted into the pAAV-MCS vector to which the Cre recombinase sequence, mGluR6 promoter and Chr2-YFP sequence thus obtained were ligated through a site-directed mutagenesis method. The same method as described above for removing the CMV promoter was performed. At this time, the primer used was SEQ ID NO: 19 (caggctggagacgtggaggagaaccctggacct atgagcggccctccaaaaaa) and SEQ ID NO: 20 (cttcagcaggctgaagttagtagctccgcttcc cttgtacagctcgtccatgc). However, the template used was the Cre recombinase sequence, the mGluR6 promoter and the pAAV-MCS vector to which the Chr2-YFP sequence was linked. In this way, the sequence of the Cre recombinase sequence, the mGluR6 promoter, the 2A sequence, and the pAAV-MCS vector to which the Chr2-YFP sequence was linked (SEQ ID NO: 6) was identified and named ON-AAV.
1.2. 1.2. OFFOFF -- AAVAAV 벡터 제작 Vector production
이극 세포중 OFF 이극세포에서 발현하는 벡터를 제작하였다. 발현벡터는 pAAV-MCS 벡터(Stratagene, 서열 번호 1)를 기반으로 하였다. 먼져, pAAV-MCS 벡터의 CMV 프로모터 부위를 위치지정 돌연변이(site-directed mutagenesis) 방법으로 제거하였다. 이는 EzChangeTM mutagenesis kit(Enzynomics, Korea)를 통하여 수행하였다. 반응 조건은 10X 반응 버퍼(Reaction buffer) 5 ㎕, DNA 폴리머라아제로 nPfu-Forte(Cat. # P410, P425)(2.5 units/㎕) 1 ㎕, dNTP 혼합물 (dATP, dTTP, dCTP, 및 dGTP 각각 2 mM) 4 ㎕, pAAV-MCS 벡터 5 ㎕(적절한지 확인하여 주시기 바랍니다), 프라이머 1(서열 번호 11 : TCGCGTGCGGCCGCAGGAAC) (10 pmol/㎕) 1 ㎕, 프라이머 2 ( 서열 번호 12: GAATTCCCCGGGGATCCTCT)(10 pmol/㎕) 1 ㎕, 전체가 50 ㎕ 증류수를 혼합하였다. 그 후, 95℃에서 2분 동안 가열시킨 후, 95℃에서 30초, 55℃에서 45초, 72℃에서 2분으로 25사이클 반복한 후, 2℃에서 5분 동안 반응시켰다.A vector expressing in the depolarization cell of the bipolar cells was prepared. The expression vector was based on the pAAV-MCS vector (Stratagene, SEQ ID NO: 1). The CMV promoter region of the pAAV-MCS vector was removed by site-directed mutagenesis. Which it was carried through the EzChange TM mutagenesis kit (Enzynomics, Korea ). The reaction conditions were as follows: 5 μl of 10 × reaction buffer, 1 μl of DNA polymerase nPfu-Forte (Cat. # P410, P425) (2.5 units / μl), dNTP mixture (dATP, dTTP, dCTP, and dGTP (SEQ ID NO. 12: GAATTCCCCGGGGATCCTCT) (10 μg / ml), 1 μl of the primer 1 (SEQ ID NO: 11: TCGCGTGCGGCCGCAGGAAC) pmol / 占 퐇) and 50 占 퐇 of distilled water as a whole were mixed. Thereafter, the mixture was heated at 95 DEG C for 2 minutes, and then repeated 25 cycles of 95 DEG C for 30 seconds, 55 DEG C for 45 seconds, and 72 DEG C for 2 minutes, followed by reaction at 2 DEG C for 5 minutes.
상기에서 수득한 CMV가 제거된 pAAV-MCS 벡터에 CHX10 프로모터(서열번호 7)를 도입하였다. 이때, CHX10 프로모터를 포함하는 벡터(addgene #18811)를 서열번호 21(GAATTCGAGAAGAGCACTGG) 및 서열번호 22(GAATTCAAGCTTTTTGCAAAAGCCTA)를 갖는 프라이머를 이용하여 PCR로 증폭하였다. 그 후, 증폭 산물을 EcoRI으로 절단한 후 증폭 산물을 수득하였다. 또한, CMV가 제거된 pAAV-MCS 벡터를 EcoRI으로 절단하여 수득하였다. 그 후, CHX10 프로모터와 CMV가 제거된 pAAV-MCS 벡터를 혼합한 후 리가아제로 결합하였다.The CHX10 promoter (SEQ ID NO: 7) was introduced into the CMV-deleted pAAV-MCS vector obtained above. At this time, a vector containing the CHX10 promoter (addgene # 18811) was amplified by PCR using primers having SEQ ID NO: 21 (GAATTCGAGAAGAGCACTGG) and SEQ ID NO: 22 (GAATTCAAGCTTTTTGCAAAAGCCTA). The amplification product was then digested with EcoRI and the amplified product was obtained. Further, the pAAV-MCS vector from which CMV was removed was obtained by digesting with EcoRI. Thereafter, the CHX10 promoter and the pAAV-MCS vector from which CMV was removed were mixed and ligated with ligase.
또한, 상기에서 CHX10 프로모터가 결합된 pAAV-MCS 벡터에 NpHR-mCherry 서열(서열번호 3)을 도입하였다. 이때, mCherry는 적색 형광 단백질을 의미한다. 이때, NpHR-mCherry 서열을 포함하는 벡터(Addgene, #26966에서 YFP를 mCherry로 치환)를 서열번호 23(GGATCCCCACCATGGACAGAGACCCTG) 및 서열번호 24(GGATCCTCACTTGTACAGCTCGTCCA)를 갖는 프라이머를 이용하여 PCR로 증폭하였다. 그 후, 증폭 산물을 BamHI로 절단한 후 증폭 산물을 수득하였다. 또한, CHX10 프로모터가 결합된 pAAV-MCS 벡터를 BamHI로 절단하여 수득하였다. 그 후, NpHR-mCherry 서열과 CHX10 프로모터가 결합된 pAAV-MCS 벡터를 혼합한 후 리가아제로 결합하였다.In addition, the NpHR-mCherry sequence (SEQ ID NO: 3) was introduced into the pAAV-MCS vector to which the CHX10 promoter was bound. Here, mCherry refers to a red fluorescent protein. At this time, a vector containing an NpHR-mCherry sequence (Addgene, YFP replaced with mCherry in # 26966) was amplified by PCR using a primer having SEQ ID NO: 23 (GGATCCCCACCATGGACAGAGACCCTG) and SEQ ID NO: 24 (GGATCCTCACTTGTACAGCTCGTCCA). Thereafter, the amplification product was digested with BamHI and an amplification product was obtained. Further, the pAAV-MCS vector to which the CHX10 promoter was bound was obtained by digesting with BamHI. Then, the pAAV-MCS vector to which the NpHR-mCherry sequence and the CHX10 promoter were bound was mixed and ligated with ligase.
또한, 상기에서 얻은 NpHR-mCherry 서열과 CHX10 프로모터가 결합된 pAAV-MCS 벡터에 loxP 서열(서열 9)을 위치지정 돌연변이 방법을 통하여 삽입하였다. 상기에서 CMV 프로모터를 제거하는 방법과 동일한 방법을 수행하였다. 다만, 이때, N 말단과 C 말단 두 부분에 위치지정 돌연변이를 통하여 loxP 서열을 도입하였다. 이를 위하여 프라이머는 서열번호 25(ACATTATACGAAGTTATAGATCTACGGGTGGCATCCC) 및 서열번호 26(ATGCTATACGAAGTTATTCACTTGTACAGCTCGTCCA)을 갖는 프라이머를 사용하였다. 또한, 서열번호 27(ACATTATACGAAGTTATCCACCATGACAGAGACCCTG) 및 서열번호 28(ATGCTATACGAAGTTAAAGCTTTTTGCAAAAGCCTA)을 갖는 프라이머를 사용하였다. 다만, 주형은 NpHR-mCherry 서열과 CHX10 프로모터가 결합된 pAAV-MCS 벡터를 사용하였다. 이러한 방법으로 NpHR-mCherry 서열과 CHX10 프로모터 및 loxP 서열이 결합된 pAAV-MCS 벡터의 서열(서열번호 10)을 확인하였고, 이를 OFF-AAV라 명명하였다.
In addition, the loxP sequence (SEQ ID NO: 9) was inserted into the pAAV-MCS vector in which the NpHR-mCherry sequence and the CHX10 promoter thus obtained were ligated via the site-directed mutagenesis method. The same method as described above for removing the CMV promoter was performed. However, at this time, the loxP sequence was introduced through the site-directed mutagenesis at both the N-terminus and the C-terminus. For this purpose, primers having SEQ ID NO: 25 (ACATTATACGAAGTTATAGATCTACGGGTGGCATCCC) and SEQ ID NO: 26 (ATGCTATACGAAGTTATTCACTTGTACAGCTCGTCCA) were used. In addition, a primer having SEQ ID NO: 27 (ACATTATACGAAGTTATCCACCATGACAGAGACCCTG) and SEQ ID NO: 28 (ATGCTATACGAAGTTAAAGCTTTTTGCAAAAGCCTA) was used. However, the template used was pAAV-MCS vector in which NpHR-mCherry sequence and CHX10 promoter were combined. In this way, the sequence of the pAAV-MCS vector (SEQ ID NO: 10) in which the NpHR-mCherry sequence and the CHX10 promoter and loxP sequence were combined was identified and named as OFF-AAV.
실시예Example 2. 형질전환용 벡터의 도입 2. Introduction of vectors for transformation
실시예 1에서 제작한 ON-AAV 벡터 및 ON-AAV 벡터를 혼합한 후 마우스 안구에 직접 주입하여, 마우스의 안구를 ON-AAV 및 ON-AAV로 감염시켰다. 상기 바이러스 벡터로 감염된 마우스는 격리시켜 2주 동안 격리시켜 키웠다. 이때, 마우스는 BALB/c 마우스를 이용하였다. 이때, 마우스는 대한바이오링크에서 구입하였다. 또한, Balb/c 마우스는 안구가 투명하여 바이러스 주입시 내부가 잘 보이기 때문에 사용하였습니다. 그리고, 바이러스가 PBS(phosphate bufferd saline) 용액에 넣어 사용하였다.
The ON-AAV vector and the ON-AAV vector prepared in Example 1 were mixed and injected directly into the mouse eye, and the mouse eye was infected with ON-AAV and ON-AAV. Mice infected with the viral vectors were isolated and allowed to stand for 2 weeks. At this time, BALB / c mouse was used as a mouse. At this time, the mouse was purchased from Korean BioLink. In addition, Balb / c mice are used because the eyeball is transparent and the inside of the virus is clearly visible during injection. The virus was then used in PBS (phosphate buffered saline) solution.
실시예Example 3. 3. 이극세포에서In a bipolar cell 도입된 벡터의 발현 확인 Identification of expression of introduced vector
3.1. 마우스 안구에서 3.1. From the mouse eye 이극A pole 세포 추출 및 단백질 발현 여부 확인 Cell Extraction and Confirmation of Protein Expression
상기 마우스에서 YFP 및 Goα 단백질의 발현을 확인하기 위하여 ON-AAV 벡터를 주입한 후 2주 후에 공초점 현미경을 이용하여 면역조직화학법으로 컨포컬 이지밍(confocal imaging)을 수행하였다. In order to confirm the expression of YFP and Go alpha protein in the mouse, confocal imaging was performed by immunohistochemistry using a
먼저, 마우스에 마취제를 주사하여 마취를 시켰다. 마취제는 zoletil 및 ruompun을 3:1로 혼합한 것을 사용하였다. 그 후, 스트레이트 포셉(forceps)으로 안구를 적출하였다. 아이볼(eye ball)에 구멍을 내고 미세가위로 주위를 돌려 절제하여 아이컵을 획득하였다. 아이컵(eyecup)을 해부한 후, pH 7.4의 0.1 mol/L 포스페이트 버퍼에 4% 파라포름알데히드가 들어있는 용액에 담갔다. 그후, 렌즈를 제거하고, 공막(sclera)과 망막색소상피(retinal pigment epithelium, RPE)와 망막을 분리하였다. 망막을 Nylon mesh(mettler toledo, USA) 위에 올려놓았다. 그 후, 버퍼 용액을 필터 페이퍼를 이용하여 제거하였다. 그 후, 망막을 Nylon mesh를 바르게 펴서 위치시켰다. 그후, 포셉 및 필터 페이퍼를 이용하여 유리체(vitreous body)를 제거하였다. 그후, 버퍼 용액을 필터 페이퍼를 이용하여 제거하였다. First, mice were anesthetized by injecting anesthetics. Anesthetics were prepared by mixing zoletil and ruompun in a ratio of 3: 1. The eyeballs were then removed with straight forceps (forceps). A hole was made in the eye ball and the microcircle was turned around and cut out to obtain an eye cup. The eyecup was dissected and immersed in a solution containing 4% paraformaldehyde in 0.1 mol / L phosphate buffer, pH 7.4. The lens was then removed and the sclera and retinal pigment epithelium (RPE) and retina were separated. The retina was placed on a nylon mesh (mettler toledo, USA). Thereafter, the buffer solution was removed using a filter paper. After that, the retina was placed in a straightened Nylon mesh. The vitreous body was then removed using forceps and filter paper. The buffer solution was then removed using a filter paper.
조직에 밤새도록 수크로오즈가 스며들었으며, 이것들은 다음날 드라이 아이스에서 적당한 절단 온도 컴파운드(optimal cutting temperature compound )에서 동결하였다. 조직을 Microm HM 525 cryostat (Thermo Scientific, Walthman, MA, USA)을 이용하여 10 마이크론으로 연속하여 절단하였다. 절단된 조직을 래빗 항-그린 플루오레슨스 단백질(GFP 및 이의 변이체), IgG (dilution 1:200; Abcam, Cambridge, MA, USA) 및 mouse anti-Goα IgG (dilution 1:200; Abcam, Cambridge, MA, USA)에 대한 1차 항체로 면역표지 되었다. 이때, 상기 항체는 3% 우태아혈청 알부민과 5% 정상 염소 혈청(normal goat serum)을 포함한 블럭킹 용액(blocking solution)으로 희석되었다.The tissues were impregnated with sucrose overnight and they were frozen on the next day in the optimal cutting temperature compound in dry ice. Tissues were sequentially cut at 10 microns using Microm HM 525 cryostat (Thermo Scientific, Walthman, Mass., USA). The cut tissues were incubated with rabbit anti-Green Fluorescence protein (GFP and its variants), IgG (dilution 1: 200; Abcam, Cambridge, MA, USA) and mouse anti- Goal IgG (dilution 1: 200; Abcam, Cambridge, MA, USA) as a primary antibody. At this time, the antibody was diluted with a blocking solution containing 3% fetal bovine serum albumin and 5% normal goat serum.
그 후, 상기 안구 절편은 chick IgY (Jackson ImmunoResearch Laboratory, West Grove, PA, USA; Alexa Fluor 488, dilution, 1:500) 및 마우스 IgG (Jackson ImmunoResearch Laboratory, West Grove, PA, USA; Alexa Fluor 555, dilution, 1:500)에 대한 2차 항체로 인큐베이션되었다.The eye slices were then incubated with chick IgY (Jackson ImmunoResearch Laboratory, West Grove, PA, USA; Alexa Fluor 488, dilution, 1: 500) and mouse IgG (Jackson ImmunoResearch Laboratory, West Grove, dilution, 1: 500).
그후, 최종적으로 상기 절편은 세척한 후 DAPI를 포함한 안티페이딩 마운트 배지(antifading mounting medium)로 슬라이드 글라스에 올려진 후, Nikon A1 confocal microscope로 관찰하였다. 그 결과, 도면 4에서 보는 바와 같이 삽입된 단백질이 발현함을 확인하였다.Thereafter, the slice was finally washed and placed on a slide glass with an antifading mounting medium containing DAPI, followed by observation with a Nikon A1 confocal microscope. As a result, it was confirmed that the inserted protein was expressed as shown in FIG.
3.2. 3.2. 이극A pole 세포에서 In a cell 광자극에On optical stimulation 따른 신호 검출 Signal detection
Laser Photo-stimulation system에서 광자극에 따른 시신경 신호를 측정하였다. 상기에서 기술한 마우스 안구에서 안구를 적출하고, 분리한 망막을, 망막 절세포(retinal ganglion cell, RGC) 쪽을 아래로 가게 하여 MEA 전극에 위치시켰다. 그 후, Nyloon string Anchor를 위에 덮고, aerated ames medium을 MEA 전극에 순환시켰다. 그후, multi-electrode array에다가 적출한 망막 조직을 올린 후, 광자극을 주었다. 그 후, 256 channel MEA amplifier 위에 MEA 전극을 위치시키고, 광자극을 주며 신호를 측정하였다. 광자극은 13 mW/mm2 의 세기, 473 nm 파장의 빛으로 가했으며 자극의 주기는 5초로 2초간의 자극(ON 구간)과 3초간의 자극 정지(OFF 구간)가 반복되도록 하였다. 신호의 측정은 10 kHz의 Sampling Rate로 수행하였고 200Hz 고대역 통과 필터와 와 60Hz 의 노치필터로 신호를 처리한 후 분석하였다. 결과, 빛을 준 2초의 ON 구간 동안 신경 신호가 생성되었다가 빛을 껐을 경우에는 신경 신호가 없어짐을 확인하였다.The optic nerve signal according to the light stimulus was measured in the laser photo-stimulation system. The eyeballs were removed from the eyeballs described above, and the separated retinas were placed on the MEA electrode with the retinal ganglion cells (RGC) side down. The Nylon string anchor was then covered and the aerated ames medium was circulated to the MEA electrode. Then, the extracted retinal tissue was raised on a multi-electrode array and then subjected to optical stimulation. The MEA electrode was then placed on a 256 channel MEA amplifier, and the signal was measured with a light stimulus. The light stimulus was applied at a power of 13 mW / mm 2 and a wavelength of 473 nm. The period of the stimulation was 5 seconds, and the stimulation (ON period) for 2 seconds and the stimulation stop period (OFF period) for 3 seconds were repeated. The signal was measured at a sampling rate of 10 kHz and analyzed with a 200 Hz high pass filter and a 60 Hz notch filter. As a result, it was confirmed that a neuron signal was generated during ON period of 2 seconds which gave light, but no neuronal signal was lost when light was turned off.
본 발병은 망막에 존재하는 ON 또는 OFF 이극세포에 선택적으로 광유전자를 발현시키기 위한 방법으로, 구체적으로는 ON 이극세포만에 빛에 반응하는 채널로돕신을 발현시킬 경우 광수용체가 없이도 빛을 감지할 수 있다. 즉, 광자극에 의해 탈분극되는 채널로돕신을 동일한 시각신호를 생성하는 ON 이극세포에서 발현시키고, 광자극에 의해 과분극되는 할로로돕신을 OFF 이극세포에 선택적으로 발현시킨다면, 기존의 시각신호 네트워크를 복원하는 효과를 가질 것으로 기대되며, 이러한 방법을 이용할 경우 광수용체가 사멸하는 질환에 효과적인 치료방법으로 활용될 수 있을 것이다.This pathogenesis is a method for selectively expressing a light gene in an ON or OFF bipolar cell present in the retina. Specifically, when a channel-induced rhodopsin is expressed only in a ON-dipole cell, light is detected without a photoreceptor . That is, when channel dorsal decidual depolarization is induced in the ON-tropic cells that generate the same visual signal and halo-doped cells that are hyperpolarized by the light stimulus are selectively expressed on the OFF dendritic cells, the existing visual signal network is restored This method can be used as an effective treatment method for a disease in which a photoreceptor is killed.
<110> Korea Institute of science and technology <120> A method for selective gene expression in the retinal ON/OFF bipolar cell <130> PN102204 <160> 28 <170> KopatentIn 2.0 <210> 1 <211> 4650 <212> DNA <213> Artificial Sequence <220> <223> pAAV-MCS <400> 1 cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcaaag cccgggcgtc 60 gggcgacctt tggtcgcccg gcctcagtga gcgagcgagc gcgcagagag ggagtggcca 120 actccatcac taggggttcc tgcggccgca cgcgtggagc tagttattaa tagtaatcaa 180 ttacggggtc attagttcat agcccatata tggagttccg cgttacataa cttacggtaa 240 atggcccgcc tggctgaccg cccaacgacc cccgcccatt gacgtcaata atgacgtatg 300 ttcccatagt aacgtcaata gggactttcc attgacgtca atgggtggag tatttacggt 360 aaactgccca cttggcagta catcaagtgt atcatatgcc aagtacgccc cctattgacg 420 tcaatgacgg taaatggccc gcctggcatt atgcccagta catgacctta tgggactttc 480 ctacttggca gtacatctac gtattagtca tcgctattac catggtgatg cggttttggc 540 agtacatcaa tgggcgtgga tagcggtttg actcacgggg atttccaagt ctccacccca 600 ttgacgtcaa tgggagtttg ttttgcacca aaatcaacgg gactttccaa aatgtcgtaa 660 caactccgcc ccattgacgc aaatgggcgg taggcgtgta cggtgggagg tctatataag 720 cagagctcgt ttagtgaacc gtcagatcgc ctggagacgc catccacgct gttttgacct 780 ccatagaaga caccgggacc gatccagcct ccgcggattc gaatcccggc cgggaacggt 840 gcattggaac gcggattccc cgtgccaaga gtgacgtaag taccgcctat agagtctata 900 ggcccacaaa aaatgctttc ttcttttaat atactttttt gtttatctta tttctaatac 960 tttccctaat ctctttcttt cagggcaata atgatacaat gtatcatgcc tctttgcacc 1020 attctaaaga ataacagtga taatttctgg gttaaggcaa tagcaatatt tctgcatata 1080 aatatttctg catataaatt gtaactgatg taagaggttt catattgcta atagcagcta 1140 caatccagct accattctgc ttttatttta tggttgggat aaggctggat tattctgagt 1200 ccaagctagg cccttttgct aatcatgttc atacctctta tcttcctccc acagctcctg 1260 ggcaacgtgc tggtctgtgt gctggcccat cactttggca aagaattggg attcgaacat 1320 cgattgaatt ccccggggat cctctagagt cgacctgcag aagcttgcct cgagcagcgc 1380 tgctcgagag atctacgggt ggcatccctg tgacccctcc ccagtgcctc tcctggccct 1440 ggaagttgcc actccagtgc ccaccagcct tgtcctaata aaattaagtt gcatcatttt 1500 gtctgactag gtgtccttct ataatattat ggggtggagg ggggtggtat ggagcaaggg 1560 gcaagttggg aagacaacct gtagggcctg cggggtctat tgggaaccaa gctggagtgc 1620 agtggcacaa tcttggctca ctgcaatctc cgcctcctgg gttcaagcga ttctcctgcc 1680 tcagcctccc gagttgttgg gattccaggc atgcatgacc aggctcagct aatttttgtt 1740 tttttggtag agacggggtt tcaccatatt ggccaggctg gtctccaact cctaatctca 1800 ggtgatctac ccaccttggc ctcccaaatt gctgggatta caggcgtgaa ccactgctcc 1860 cttccctgtc cttctgattt tgtaggtaac cacgtgcgga ccgagcggcc gcaggaaccc 1920 ctagtgatgg agttggccac tccctctctg cgcgctcgct cgctcactga ggccgggcga 1980 ccaaaggtcg cccgacgccc gggctttgcc cgggcggcct cagtgagcga gcgagcgcgc 2040 agctgcctgc aggggcgcct gatgcggtat tttctcctta cgcatctgtg cggtatttca 2100 caccgcatac gtcaaagcaa ccatagtacg cgccctgtag cggcgcatta agcgcggcgg 2160 gtgtggtggt tacgcgcagc gtgaccgcta cacttgccag cgccctagcg cccgctcctt 2220 tcgctttctt cccttccttt ctcgccacgt tcgccggctt tccccgtcaa gctctaaatc 2280 gggggctccc tttagggttc cgatttagtg ctttacggca cctcgacccc aaaaaacttg 2340 atttgggtga tggttcacgt agtgggccat cgccctgata gacggttttt cgccctttga 2400 cgttggagtc cacgttcttt aatagtggac tcttgttcca aactggaaca acactcaacc 2460 ctatctcggg ctattctttt gatttataag ggattttgcc gatttcggcc tattggttaa 2520 aaaatgagct gatttaacaa aaatttaacg cgaattttaa caaaatatta acgtttacaa 2580 ttttatggtg cactctcagt acaatctgct ctgatgccgc atagttaagc cagccccgac 2640 acccgccaac acccgctgac gcgccctgac gggcttgtct gctcccggca tccgcttaca 2700 gacaagctgt gaccgtctcc gggagctgca tgtgtcagag gttttcaccg tcatcaccga 2760 aacgcgcgag acgaaagggc ctcgtgatac gcctattttt ataggttaat gtcatgataa 2820 taatggtttc ttagacgtca ggtggcactt ttcggggaaa tgtgcgcgga acccctattt 2880 gtttattttt ctaaatacat tcaaatatgt atccgctcat gagacaataa ccctgataaa 2940 tgcttcaata atattgaaaa aggaagagta tgagtattca acatttccgt gtcgccctta 3000 ttcccttttt tgcggcattt tgccttcctg tttttgctca cccagaaacg ctggtgaaag 3060 taaaagatgc tgaagatcag ttgggtgcac gagtgggtta catcgaactg gatctcaaca 3120 gcggtaagat ccttgagagt tttcgccccg aagaacgttt tccaatgatg agcactttta 3180 aagttctgct atgtggcgcg gtattatccc gtattgacgc cgggcaagag caactcggtc 3240 gccgcataca ctattctcag aatgacttgg ttgagtactc accagtcaca gaaaagcatc 3300 ttacggatgg catgacagta agagaattat gcagtgctgc cataaccatg agtgataaca 3360 ctgcggccaa cttacttctg acaacgatcg gaggaccgaa ggagctaacc gcttttttgc 3420 acaacatggg ggatcatgta actcgccttg atcgttggga accggagctg aatgaagcca 3480 taccaaacga cgagcgtgac accacgatgc ctgtagcaat ggcaacaacg ttgcgcaaac 3540 tattaactgg cgaactactt actctagctt cccggcaaca attaatagac tggatggagg 3600 cggataaagt tgcaggacca cttctgcgct cggcccttcc ggctggctgg tttattgctg 3660 ataaatctgg agccggtgag cgtgggtctc gcggtatcat tgcagcactg gggccagatg 3720 gtaagccctc ccgtatcgta gttatctaca cgacggggag tcaggcaact atggatgaac 3780 gaaatagaca gatcgctgag ataggtgcct cactgattaa gcattggtaa ctgtcagacc 3840 aagtttactc atatatactt tagattgatt taaaacttca tttttaattt aaaaggatct 3900 aggtgaagat cctttttgat aatctcatga ccaaaatccc ttaacgtgag ttttcgttcc 3960 actgagcgtc agaccccgta gaaaagatca aaggatcttc ttgagatcct ttttttctgc 4020 gcgtaatctg ctgcttgcaa acaaaaaaac caccgctacc agcggtggtt tgtttgccgg 4080 atcaagagct accaactctt tttccgaagg taactggctt cagcagagcg cagataccaa 4140 atactgtcct tctagtgtag ccgtagttag gccaccactt caagaactct gtagcaccgc 4200 ctacatacct cgctctgcta atcctgttac cagtggctgc tgccagtggc gataagtcgt 4260 gtcttaccgg gttggactca agacgatagt taccggataa ggcgcagcgg tcgggctgaa 4320 cggggggttc gtgcacacag cccagcttgg agcgaacgac ctacaccgaa ctgagatacc 4380 tacagcgtga gctatgagaa agcgccacgc ttcccgaagg gagaaaggcg gacaggtatc 4440 cggtaagcgg cagggtcgga acaggagagc gcacgaggga gcttccaggg ggaaacgcct 4500 ggtatcttta tagtcctgtc gggtttcgcc acctctgact tgagcgtcga tttttgtgat 4560 gctcgtcagg ggggcggagc ctatggaaaa acgccagcaa cgcggccttt ttacggttcc 4620 tggccttttg ctggcctttt gctcacatgt 4650 <210> 2 <211> 200 <212> DNA <213> Artificial Sequence <220> <223> mGluR6 promoter <400> 2 gatctccaga tggctaaact tttaaatcat gaatgaagta gatattacca aattgctttt 60 tcagcatcca tttagataat catgtttttt gcctttaatc tgttaatgta gtgaattaca 120 gaaatacatt tcctaaatca ttacatcccc caaatcgtta atctgctaaa gtacatctct 180 ggctcaaaca agactggttg 200 <210> 3 <211> 1718 <212> DNA <213> Artificial Sequence <220> <223> Chr2-YFP <400> 3 ccaccatgga ctatggcggc gctttgtctg ccgtcggacg cgaacttttg ttcgttacta 60 atcctgtggt ggtgaacggg tccgtcctgg tccctgagga tcaatgttac tgtgccggat 120 ggattgaatc tcgcggcacg aacggcgctc agaccgcgtc aaatgtcctg cagtggcttg 180 cagcaggatt cagcattttg ctgctgatgt tctatgccta ccaaacctgg aaatctacat 240 gcggctggga ggagatctat gtgtgcgcca ttgaaatggt taaggtgatt ctcgagttct 300 tttttgagtt taagaatccc tctatgctct accttgccac aggacaccgg gtgcagtggc 360 tgcgctatgc agagtggctg ctcacttgtc ctgtcatcct tatccgcctg agcaacctca 420 ccggcctgag caacgactac agcaggagaa ccatgggact ccttgtctca gacatcggga 480 ctatcgtgtg gggggctacc agcgccatgg caaccggcta tgttaaagtc atcttctttt 540 gtcttggatt gtgctatggc gcgaacacat tttttcacgc cgccaaagca tatatcgagg 600 gttatcatac tgtgccaaag ggtcggtgcc gccaggtcgt gaccggcatg gcatggctgt 660 ttttcgtgag ctggggtatg ttcccaattc tcttcatttt ggggcccgaa ggttttggcg 720 tcctgagcgt ctatggctcc accgtaggtc acacgattat tgatctgatg agtaaaaatt 780 gttgggggtt gttgggacac tacctgcgcg tcctgatcca cgagcacata ttgattcacg 840 gagatatccg caaaaccacc aaactgaaca tcggcggaac ggagatcgag gtcgagactc 900 tcgtcgaaga cgaagccgag gccggagccg tgccagcggc cgccaagagc aggatcacca 960 gcgagggcga gtacatcccc ctggaccaga tcgacatcaa cgtggtgagc aagggcgagg 1020 agctgttcac cggggtggtg cccatcctgg tcgagctgga cggcgacgta aacggccaca 1080 agttcagcgt gtccggcgag ggcgagggcg atgccaccta cggcaagctg accctgaagt 1140 tcatctgcac caccggcaag ctgcccgtgc cctggcccac cctcgtgacc accttcggct 1200 acggcctgca gtgcttcgcc cgctaccccg accacatgaa gcagcacgac ttcttcaagt 1260 ccgccatgcc cgaaggctac gtccaggagc gcaccatctt cttcaaggac gacggcaact 1320 acaagacccg cgccgaggtg aagttcgagg gcgacaccct ggtgaaccgc atcgagctga 1380 agggcatcga cttcaaggag gacggcaaca tcctggggca caagctggag tacaactaca 1440 acagccacaa cgtctatatc atggccgaca agcagaagaa cggcatcaag gtgaacttca 1500 agatccgcca caacatcgag gacggcagcg tgcagctcgc cgaccactac cagcagaaca 1560 cccccatcgg cgacggcccc gtgctgctgc ccgacaacca ctacctgagc taccagtccg 1620 ccctgagcaa agaccccaac gagaagcgcg atcacatggt cctgctggag ttcgtgaccg 1680 ccgccgggat cactctcggc atggacgagc tgtacaag 1718 <210> 4 <211> 1083 <212> DNA <213> Artificial Sequence <220> <223> nlsCre <400> 4 atgagcggcc ctccaaaaaa gaagagaaag gtagaagacc cgggcggccg catgtccaat 60 ttactgaccg tacaccaaaa tttgcctgca ttaccggtcg atgcaacgag tgatgaggtt 120 cgcaagaacc tgatggacat gttcagggat cgccaggcgt tttctgagca tacctggaaa 180 atgcttctgt ccgtttgccg gtcgtgggcg gcatggtgca agttgaataa ccggaaatgg 240 tttcccgcag aacctgaaga tgttcgcgat tatcttctat atcttcaggc gcgcggtctg 300 gcagtaaaaa ctatccagca acatttgggc cagctaaaca tgcttcatcg tcggtccggg 360 ctgccacgac caagtgacag caatgctgtt tcactggtta tgcggcggat ccgaaaagaa 420 aacgttgatg ccggtgaacg tgcaaaacag gctctagcgt tcgaacgcac tgatttcgac 480 caggttcgtt cactcatgga aaatagcgat cgctgccagg atatacgtaa tctggcattt 540 ctggggattg cttataacac cctgttacgt atagccgaaa ttgccaggat cagggttaaa 600 gatatctcac gtactgacgg tgggagaatg ttaatccata ttggcagaac gaaaacgctg 660 gttagcaccg caggtgtaga gaaggcactt agcctggggg taactaaact ggtcgagcga 720 tggatttccg tctctggtgt agctgatgat ccgaataact acctgttttg ccgggtcaga 780 aaaaatggtg ttgccgcgcc atctgccacc agccagctat caactcgcgc cctggaaggg 840 atttttgaag caactcatcg attgatttac ggcgctaagg atgactctgg tcagagatac 900 ctggcctggt ctggacacag tgcccgtgtc ggagccgcgc gagatatggc ccgcgctgga 960 gtttcaatac cggagatcat gcaagctggt ggctggacca atgtaaatat tgtcatgaac 1020 tatatccgta acctggatag tgaaacaggg gcaatggtgc gcctgctgga agatggcgat 1080 tag 1083 <210> 5 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> 2A <400> 5 ggaagcggag ctactaactt cagcctgctg aagcaggctg gagacgtgga ggagaaccct 60 ggacct 66 <210> 6 <211> 6251 <212> DNA <213> Artificial Sequence <220> <223> ON-AAV <400> 6 acatgtgagc aaaaggccag caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt 60 ttttccatag gctccgcccc cctgacgagc atcacaaaaa tcgacgctca agtcagaggt 120 ggcgaaaccc gacaggacta taaagatacc aggcgtttcc ccctggaagc tccctcgtgc 180 gctctcctgt tccgaccctg ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa 240 gcgtggcgct ttctcatagc tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct 300 ccaagctggg ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc ttatccggta 360 actatcgtct tgagtccaac ccggtaagac acgacttatc gccactggca gcagccactg 420 gtaacaggat tagcagagcg aggtatgtag gcggtgctac agagttcttg aagtggtggc 480 ctaactacgg ctacactaga aggacagtat ttggtatctg cgctctgctg aagccagtta 540 ccttcggaaa aagagttggt agctcttgat ccggcaaaca aaccaccgct ggtagcggtg 600 gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa gaagatcctt 660 tgatcttttc tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg 720 tcatgagatt atcaaaaagg atcttcacct agatcctttt aaattaaaaa tgaagtttta 780 aatcaatcta aagtatatat gagtaaactt ggtctgacag ttaccaatgc ttaatcagtg 840 aggcacctat ctcagcgatc tgtctatttc gttcatccat agttgcctga ctccccgtcg 900 tgtagataac tacgatacgg gagggcttac catctggccc cagtgctgca atgataccgc 960 gagacccacg ctcaccggct ccagatttat cagcaataaa ccagccagcc ggaagggccg 1020 agcgcagaag tggtcctgca actttatccg cctccatcca gtctattaat tgttgccggg 1080 aagctagagt aagtagttcg ccagttaata gtttgcgcaa cgttgttgcc attgctacag 1140 gcatcgtggt gtcacgctcg tcgtttggta tggcttcatt cagctccggt tcccaacgat 1200 caaggcgagt tacatgatcc cccatgttgt gcaaaaaagc ggttagctcc ttcggtcctc 1260 cgatcgttgt cagaagtaag ttggccgcag tgttatcact catggttatg gcagcactgc 1320 ataattctct tactgtcatg ccatccgtaa gatgcttttc tgtgactggt gagtactcaa 1380 ccaagtcatt ctgagaatag tgtatgcggc gaccgagttg ctcttgcccg gcgtcaatac 1440 gggataatac cgcgccacat agcagaactt taaaagtgct catcattgga aaacgttctt 1500 cggggcgaaa actctcaagg atcttaccgc tgttgagatc cagttcgatg taacccactc 1560 gtgcacccaa ctgatcttca gcatctttta ctttcaccag cgtttctggg tgagcaaaaa 1620 caggaaggca aaatgccgca aaaaagggaa taagggcgac acggaaatgt tgaatactca 1680 tactcttcct ttttcaatat tattgaagca tttatcaggg ttattgtctc atgagcggat 1740 acatatttga atgtatttag aaaaataaac aaataggggt tccgcgcaca tttccccgaa 1800 aagtgccacc tgacgtctaa gaaaccatta ttatcatgac attaacctat aaaaataggc 1860 gtatcacgag gccctttcgt ctcgcgcgtt tcggtgatga cggtgaaaac ctctgacaca 1920 tgcagctccc ggagacggtc acagcttgtc tgtaagcgga tgccgggagc agacaagccc 1980 gtcagggcgc gtcagcgggt gttggcgggt gtcggggctg gcttaactat gcggcatcag 2040 agcagattgt actgagagtg caccataaaa ttgtaaacgt taatattttg ttaaaattcg 2100 cgttaaattt ttgttaaatc agctcatttt ttaaccaata ggccgaaatc ggcaaaatcc 2160 cttataaatc aaaagaatag cccgagatag ggttgagtgt tgttccagtt tggaacaaga 2220 gtccactatt aaagaacgtg gactccaacg tcaaagggcg aaaaaccgtc tatcagggcg 2280 atggcccact acgtgaacca tcacccaaat caagtttttt ggggtcgagg tgccgtaaag 2340 cactaaatcg gaaccctaaa gggagccccc gatttagagc ttgacgggga aagccggcga 2400 acgtggcgag aaaggaaggg aagaaagcga aaggagcggg cgctagggcg ctggcaagtg 2460 tagcggtcac gctgcgcgta accaccacac ccgccgcgct taatgcgccg ctacagggcg 2520 cgtactatgg ttgctttgac gtatgcggtg tgaaataccg cacagatgcg taaggagaaa 2580 ataccgcatc aggcgcccct gcaggcagct gcgcgctcgc tcgctcactg aggccgcccg 2640 ggcaaagccc gggcgtcggg cgacctttgg tcgcccggcc tcagtgagcg agcgagcgcg 2700 cagagaggga gtggccaact ccatcactag gggttcctgc ggccgctcgg tccgcacgtg 2760 gttacctaca aaatcagaag gacagggaag ggagcagtgg ttcacgcctg taatcccagc 2820 aatttgggag gccaaggtgg gtagatcacc tgagattagg agttggagac cagcctggcc 2880 aatatggtga aaccccgtct ctaccaaaaa aacaaaaatt agctgagcct ggtcatgcat 2940 gcctggaatc ccaacaactc gggaggctga ggcaggagaa tcgcttgaac ccaggaggcg 3000 gagattgcag tgagccaaga ttgtgccact gcactccagc ttggttccca atagaccccg 3060 caggccctac aggttgtctt cccaacttgc cccttgctcc ataccacccc cctccacccc 3120 ataatattat agaaggacac ctagtcagac aaaatgatgc aacttaattt tattaggaca 3180 aggctggtgg gcactggagt ggcaacttcc agggccagga gaggcactgg ggaggggtca 3240 cagggatgcc acccgtagat ctctaatcgc catcttccag caggcgcacc attgcccctg 3300 tttcactatc caggttacgg atatagttca tgacaatatt tacattggtc cagccaccag 3360 cttgcatgat ctccggtatt gaaactccag cgcgggccat atctcgcgcg gctccgacac 3420 gggcactgtg tccagaccag gccaggtatc tctgaccaga gtcatcctta gcgccgtaaa 3480 tcaatcgatg agttgcttca aaaatccctt ccagggcgcg agttgatagc tggctggtgg 3540 cagatggcgc ggcaacacca ttttttctga cccggcaaaa caggtagtta ttcggatcat 3600 cagctacacc agagacggaa atccatcgct cgaccagttt agttaccccc aggctaagtg 3660 ccttctctac acctgcggtg ctaaccagcg ttttcgttct gccaatatgg attaacattc 3720 tcccaccgtc agtacgtgag atatctttaa ccctgatcct ggcaatttcg gctatacgta 3780 acagggtgtt ataagcaatc cccagaaatg ccagattacg tatatcctgg cagcgatcgc 3840 tattttccat gagtgaacga acctggtcga aatcagtgcg ttcgaacgct agagcctgtt 3900 ttgcacgttc accggcatca acgttttctt ttcggatccg ccgcataacc agtgaaacag 3960 cattgctgtc acttggtcgt ggcagcccgg accgacgatg aagcatgttt agctggccca 4020 aatgttgctg gatagttttt actgccagac cgcgcgcctg aagatataga agataatcgc 4080 gaacatcttc aggttctgcg ggaaaccatt tccggttatt caacttgcac catgccgccc 4140 acgaccggca aacggacaga agcattttcc aggtatgctc agaaaacgcc tggcgatccc 4200 tgaacatgtc catcaggttc ttgcgaacct catcactcgt tgcatcgacc ggtaatgcag 4260 gcaaattttg gtgtacggtc agtaaattgg acataggtcc agggttctcc tccacgtctc 4320 cagcctgctt cagcaggctg aagttagtag ctccgcttcc cttgtacagc tcgtccatgc 4380 cgagagtgat cccggcggcg gtcacgaact ccagcaggac catgtgatcg cgcttctcgt 4440 tggggtcttt gctcagggcg gactggtagc tcaggtagtg gttgtcgggc agcagcacgg 4500 ggccgtcgcc gatgggggtg ttctgctggt agtggtcggc gagctgcacg ctgccgtcct 4560 cgatgttgtg gcggatcttg aagttcacct tgatgccgtt cttctgcttg tcggccatga 4620 tatagacgtt gtggctgttg tagttgtact ccagcttgtg ccccaggatg ttgccgtcct 4680 ccttgaagtc gatgcccttc agctcgatgc ggttcaccag ggtgtcgccc tcgaacttca 4740 cctcggcgcg ggtcttgtag ttgccgtcgt ccttgaagaa gatggtgcgc tcctggacgt 4800 agccttcggg catggcggac ttgaagaagt cgtgctgctt catgtggtcg gggtagcggg 4860 cgaagcactg caggccgtag ccgaaggtgg tcacgagggt gggccagggc acgggcagct 4920 tgccggtggt gcagatgaac ttcagggtca gcttgccgta ggtggcatcg ccctcgccct 4980 cgccggacac gctgaacttg tggccgttta cgtcgccgtc cagctcgacc aggatgggca 5040 ccaccccggt gaacagctcc tcgcccttgc tcaccacgtt gatgtcgatc tggtccaggg 5100 ggatgtactc gccctcgctg gtgatcctgc tcttggcggc cgctggcacg gctccggcct 5160 cggcttcgtc ttcgacgaga gtctcgacct cgatctccgt tccgccgatg ttcagtttgg 5220 tggttttgcg gatatctccg tgaatcaata tgtgctcgtg gatcaggacg cgcaggtagt 5280 gtcccaacaa cccccaacaa tttttactca tcagatcaat aatcgtgtga cctacggtgg 5340 agccatagac gctcaggacg ccaaaacctt cgggccccaa aatgaagaga attgggaaca 5400 taccccagct cacgaaaaac agccatgcca tgccggtcac gacctggcgg caccgaccct 5460 ttggcacagt atgataaccc tcgatatatg ctttggcggc gtgaaaaaat gtgttcgcgc 5520 catagcacaa tccaagacaa aagaagatga ctttaacata gccggttgcc atggcgctgg 5580 tagcccccca cacgatagtc ccgatgtctg agacaaggag tcccatggtt ctcctgctgt 5640 agtcgttgct caggccggtg aggttgctca ggcggataag gatgacagga caagtgagca 5700 gccactctgc atagcgcagc cactgcaccc ggtgtcctgt ggcaaggtag agcatagagg 5760 gattcttaaa ctcaaaaaag aactcgagaa tcaccttaac catttcaatg gcgcacacat 5820 agatctcctc ccagccgcat gtagatttcc aggtttggta ggcatagaac atcagcagca 5880 aaatgctgaa tcctgctgca agccactgca ggacatttga cgcggtctga gcgccgttcg 5940 tgccgcgaga ttcaatccat ccggcacagt aacattgatc ctcagggacc aggacggacc 6000 cgttcaccac cacaggatta gtaacgaaca aaagttcgcg tccgacggca gacaaagcgc 6060 cgccatagtc ccatggtggg gatccccggg gaattcacgc gtgcggccgc aggaacccct 6120 agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg ccgggcgacc 6180 aaaggtcgcc cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc gagcgcgcag 6240 ctgcctgcag g 6251 <210> 7 <211> 390 <212> DNA <213> Artificial Sequence <220> <223> CHX10 promoter <400> 7 gaattcgaga agagcactgg ctggggctgc ttgcccgcta atcccagctg ccattaaaat 60 attaaagata aatctaatcg tctctttatc caaaataagc gacttttgtg tggggagaaa 120 acgtctaacc ccttaggagg agaattagtt ctaatgcatc aaatggaatt gctcgagatc 180 tgcgatctgc atctcaatta gtcagcaacc atagtcccgc ccctaactcc gcccatcccg 240 cccctaactc cgcccagttc cgcccattct ccgccccatc gctgactaat tttttttatt 300 tatgcagagg ccgaggccgc ctcggcctct gagctattcc agaagtagtg aggaggcttt 360 tttggaggcc taggcttttg caaaaagctt 390 <210> 8 <211> 1652 <212> DNA <213> Artificial Sequence <220> <223> NpHR-mCherry <400> 8 ccaccatgac agagaccctg cctcccgtga ccgagagtgc cgtggccctt caagccgagg 60 ttacccaaag ggagttgttc gagttcgtgc tgaacgaccc tttgcttgca agcagtctct 120 atatcaacat cgcacttgca ggactgagta tactgctgtt cgtttttatg acccgaggac 180 tcgatgatcc acgggcaaaa cttattgctg tgtcaaccat ccttgtgcct gtcgtcagca 240 ttgcctccta cactggattg gcgagcggcc tgacaatttc cgttcttgaa atgccagcgg 300 gccattttgc agaaggcagc tcagtgatgc tgggaggaga agaggtagat ggtgtagtca 360 ccatgtgggg acggtatctc acctgggcac tttccacgcc catgattctc ctcgctctgg 420 gtctcctggc cggaagcaat gctacaaagc tcttcacagc tatcactttc gatatcgcta 480 tgtgcgtgac tggccttgcc gcggccctga ctacctcctc ccacctcatg agatggttct 540 ggtacgctat cagttgtgca tgctttctgg tggtcttgta tatcctgctg gtggagtggg 600 cacaggacgc caaagccgcg ggaaccgctg acatgttcaa taccctgaag ctgttgacag 660 tagtgatgtg gctggggtat ccaattgtgt gggctcttgg agtcgagggt atcgcggtgt 720 tgcccgttgg ggtgacgagc tggggatatt ctttcctgga tatcgtggca aagtacattt 780 tcgcattctt gctcctgaac tatctgacgt caaacgaatc tgtcgtgtcc ggcagcattt 840 tggatgttcc atctgcttct gggaccccgg ctgatgatgc ggccgccaag agcaggatca 900 ccagcgaggg cgagtacatc cccctggacc agatcgacat caacgtggtg agcaagggcg 960 aggaggataa catggccatc atcaaggagt tcatgcgctt caaggtgcac atggagggct 1020 ccgtgaacgg ccacgagttc gagatcgagg gcgagggcga gggccgcccc tacgagggca 1080 cccagaccgc caagctgaag gtgaccaagg gtggccccct gcccttcgcc tgggacatcc 1140 tgtcccctca gttcatgtac ggctccaagg cctacgtgaa gcaccccgcc gacatccccg 1200 actacttgaa gctgtccttc cccgagggct tcaagtggga gcgcgtgatg aacttcgagg 1260 acggcggcgt ggtgaccgtg acccaggact cctccctgca ggacggcgag ttcatctaca 1320 aggtgaagct gcgcggcacc aacttcccct ccgacggccc cgtaatgcag aagaagacca 1380 tgggctggga ggcctcctcc gagcggatgt accccgagga cggcgccctg aagggcgaga 1440 tcaagcagag gctgaagctg aaggacggcg gccactacga cgctgaggtc aagaccacct 1500 acaaggccaa gaagcccgtg cagctgcccg gcgcctacaa cgtcaacatc aagttggaca 1560 tcacctccca caacgaggac tacaccatcg tggaacagta cgaacgcgcc gagggccgcc 1620 actccaccgg cggcatggac gagctgtaca ag 1652 <210> 9 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> loxP <400> 9 ataacttcgt atagcataca ttatacgaag ttat 34 <210> 10 <211> 5530 <212> DNA <213> Artificial Sequence <220> <223> OFF-AAV <400> 10 cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcaaag cccgggcgtc 60 gggcgacctt tggtcgcccg gcctcagtga gcgagcgagc gcgcagagag ggagtggcca 120 actccatcac taggggttcc tgcggccgca cgcgtgaatt cgagaagagc actggctggg 180 gctgcttgcc cgctaatccc agctgccatt aaaatattaa agataaatct aatcgtctct 240 ttatccaaaa taagcgactt ttgtgtgggg agaaaacgtc taacccctta ggaggagaat 300 tagttctaat gcatcaaatg gaattgctcg agatctgcga tctgcatctc aattagtcag 360 caaccatagt cccgccccta actccgccca tcccgcccct aactccgccc agttccgccc 420 attctccgcc ccatcgctga ctaatttttt ttatttatgc agaggccgag gccgcctcgg 480 cctctgagct attccagaag tagtgaggag gcttttttgg aggcctaggc ttttgcaaaa 540 agcttataac ttcgtatagc atacattata cgaagttatc caccatgaca gagaccctgc 600 ctcccgtgac cgagagtgcc gtggcccttc aagccgaggt tacccaaagg gagttgttcg 660 agttcgtgct gaacgaccct ttgcttgcaa gcagtctcta tatcaacatc gcacttgcag 720 gactgagtat actgctgttc gtttttatga cccgaggact cgatgatcca cgggcaaaac 780 ttattgctgt gtcaaccatc cttgtgcctg tcgtcagcat tgcctcctac actggattgg 840 cgagcggcct gacaatttcc gttcttgaaa tgccagcggg ccattttgca gaaggcagct 900 cagtgatgct gggaggagaa gaggtagatg gtgtagtcac catgtgggga cggtatctca 960 cctgggcact ttccacgccc atgattctcc tcgctctggg tctcctggcc ggaagcaatg 1020 ctacaaagct cttcacagct atcactttcg atatcgctat gtgcgtgact ggccttgccg 1080 cggccctgac tacctcctcc cacctcatga gatggttctg gtacgctatc agttgtgcat 1140 gctttctggt ggtcttgtat atcctgctgg tggagtgggc acaggacgcc aaagccgcgg 1200 gaaccgctga catgttcaat accctgaagc tgttgacagt agtgatgtgg ctggggtatc 1260 caattgtgtg ggctcttgga gtcgagggta tcgcggtgtt gcccgttggg gtgacgagct 1320 ggggatattc tttcctggat atcgtggcaa agtacatttt cgcattcttg ctcctgaact 1380 atctgacgtc aaacgaatct gtcgtgtccg gcagcatttt ggatgttcca tctgcttctg 1440 ggaccccggc tgatgatgcg gccgccaaga gcaggatcac cagcgagggc gagtacatcc 1500 ccctggacca gatcgacatc aacgtggtga gcaagggcga ggaggataac atggccatca 1560 tcaaggagtt catgcgcttc aaggtgcaca tggagggctc cgtgaacggc cacgagttcg 1620 agatcgaggg cgagggcgag ggccgcccct acgagggcac ccagaccgcc aagctgaagg 1680 tgaccaaggg tggccccctg cccttcgcct gggacatcct gtcccctcag ttcatgtacg 1740 gctccaaggc ctacgtgaag caccccgccg acatccccga ctacttgaag ctgtccttcc 1800 ccgagggctt caagtgggag cgcgtgatga acttcgagga cggcggcgtg gtgaccgtga 1860 cccaggactc ctccctgcag gacggcgagt tcatctacaa ggtgaagctg cgcggcacca 1920 acttcccctc cgacggcccc gtaatgcaga agaagaccat gggctgggag gcctcctccg 1980 agcggatgta ccccgaggac ggcgccctga agggcgagat caagcagagg ctgaagctga 2040 aggacggcgg ccactacgac gctgaggtca agaccaccta caaggccaag aagcccgtgc 2100 agctgcccgg cgcctacaac gtcaacatca agttggacat cacctcccac aacgaggact 2160 acaccatcgt ggaacagtac gaacgcgccg agggccgcca ctccaccggc ggcatggacg 2220 agctgtacaa gtgaataact tcgtatagca tacattatac gaagttatag atctacgggt 2280 ggcatccctg tgacccctcc ccagtgcctc tcctggccct ggaagttgcc actccagtgc 2340 ccaccagcct tgtcctaata aaattaagtt gcatcatttt gtctgactag gtgtccttct 2400 ataatattat ggggtggagg ggggtggtat ggagcaaggg gcaagttggg aagacaacct 2460 gtagggcctg cggggtctat tgggaaccaa gctggagtgc agtggcacaa tcttggctca 2520 ctgcaatctc cgcctcctgg gttcaagcga ttctcctgcc tcagcctccc gagttgttgg 2580 gattccaggc atgcatgacc aggctcagct aatttttgtt tttttggtag agacggggtt 2640 tcaccatatt ggccaggctg gtctccaact cctaatctca ggtgatctac ccaccttggc 2700 ctcccaaatt gctgggatta caggcgtgaa ccactgctcc cttccctgtc cttctgattt 2760 tgtaggtaac cacgtgcgga ccgagcggcc gcaggaaccc ctagtgatgg agttggccac 2820 tccctctctg cgcgctcgct cgctcactga ggccgggcga ccaaaggtcg cccgacgccc 2880 gggctttgcc cgggcggcct cagtgagcga gcgagcgcgc agctgcctgc aggggcgcct 2940 gatgcggtat tttctcctta cgcatctgtg cggtatttca caccgcatac gtcaaagcaa 3000 ccatagtacg cgccctgtag cggcgcatta agcgcggcgg gtgtggtggt tacgcgcagc 3060 gtgaccgcta cacttgccag cgccctagcg cccgctcctt tcgctttctt cccttccttt 3120 ctcgccacgt tcgccggctt tccccgtcaa gctctaaatc gggggctccc tttagggttc 3180 cgatttagtg ctttacggca cctcgacccc aaaaaacttg atttgggtga tggttcacgt 3240 agtgggccat cgccctgata gacggttttt cgccctttga cgttggagtc cacgttcttt 3300 aatagtggac tcttgttcca aactggaaca acactcaacc ctatctcggg ctattctttt 3360 gatttataag ggattttgcc gatttcggcc tattggttaa aaaatgagct gatttaacaa 3420 aaatttaacg cgaattttaa caaaatatta acgtttacaa ttttatggtg cactctcagt 3480 acaatctgct ctgatgccgc atagttaagc cagccccgac acccgccaac acccgctgac 3540 gcgccctgac gggcttgtct gctcccggca tccgcttaca gacaagctgt gaccgtctcc 3600 gggagctgca tgtgtcagag gttttcaccg tcatcaccga aacgcgcgag acgaaagggc 3660 ctcgtgatac gcctattttt ataggttaat gtcatgataa taatggtttc ttagacgtca 3720 ggtggcactt ttcggggaaa tgtgcgcgga acccctattt gtttattttt ctaaatacat 3780 tcaaatatgt atccgctcat gagacaataa ccctgataaa tgcttcaata atattgaaaa 3840 aggaagagta tgagtattca acatttccgt gtcgccctta ttcccttttt tgcggcattt 3900 tgccttcctg tttttgctca cccagaaacg ctggtgaaag taaaagatgc tgaagatcag 3960 ttgggtgcac gagtgggtta catcgaactg gatctcaaca gcggtaagat ccttgagagt 4020 tttcgccccg aagaacgttt tccaatgatg agcactttta aagttctgct atgtggcgcg 4080 gtattatccc gtattgacgc cgggcaagag caactcggtc gccgcataca ctattctcag 4140 aatgacttgg ttgagtactc accagtcaca gaaaagcatc ttacggatgg catgacagta 4200 agagaattat gcagtgctgc cataaccatg agtgataaca ctgcggccaa cttacttctg 4260 acaacgatcg gaggaccgaa ggagctaacc gcttttttgc acaacatggg ggatcatgta 4320 actcgccttg atcgttggga accggagctg aatgaagcca taccaaacga cgagcgtgac 4380 accacgatgc ctgtagcaat ggcaacaacg ttgcgcaaac tattaactgg cgaactactt 4440 actctagctt cccggcaaca attaatagac tggatggagg cggataaagt tgcaggacca 4500 cttctgcgct cggcccttcc ggctggctgg tttattgctg ataaatctgg agccggtgag 4560 cgtgggtctc gcggtatcat tgcagcactg gggccagatg gtaagccctc ccgtatcgta 4620 gttatctaca cgacggggag tcaggcaact atggatgaac gaaatagaca gatcgctgag 4680 ataggtgcct cactgattaa gcattggtaa ctgtcagacc aagtttactc atatatactt 4740 tagattgatt taaaacttca tttttaattt aaaaggatct aggtgaagat cctttttgat 4800 aatctcatga ccaaaatccc ttaacgtgag ttttcgttcc actgagcgtc agaccccgta 4860 gaaaagatca aaggatcttc ttgagatcct ttttttctgc gcgtaatctg ctgcttgcaa 4920 acaaaaaaac caccgctacc agcggtggtt tgtttgccgg atcaagagct accaactctt 4980 tttccgaagg taactggctt cagcagagcg cagataccaa atactgtcct tctagtgtag 5040 ccgtagttag gccaccactt caagaactct gtagcaccgc ctacatacct cgctctgcta 5100 atcctgttac cagtggctgc tgccagtggc gataagtcgt gtcttaccgg gttggactca 5160 agacgatagt taccggataa ggcgcagcgg tcgggctgaa cggggggttc gtgcacacag 5220 cccagcttgg agcgaacgac ctacaccgaa ctgagatacc tacagcgtga gctatgagaa 5280 agcgccacgc ttcccgaagg gagaaaggcg gacaggtatc cggtaagcgg cagggtcgga 5340 acaggagagc gcacgaggga gcttccaggg ggaaacgcct ggtatcttta tagtcctgtc 5400 gggtttcgcc acctctgact tgagcgtcga tttttgtgat gctcgtcagg ggggcggagc 5460 ctatggaaaa acgccagcaa cgcggccttt ttacggttcc tggccttttg ctggcctttt 5520 gctcacatgt 5530 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer 1 <400> 11 tcgcgtgcgg ccgcaggaac 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer 2 <400> 12 gaattccccg gggatcctct 20 <210> 13 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 gaattcgatc tccagatggc taaact 26 <210> 14 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 gaattccaac cagtcttgtt tgagcc 26 <210> 15 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 ggatccccac catgggacta tggcggc 27 <210> 16 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 ggatcccttg tacagctcgt ccatgc 26 <210> 17 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Primer for pxCan-Cre <400> 17 agatctatga gcggccctcc aaaaaa 26 <210> 18 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Primer for pxCan-Cre <400> 18 agatctctaa tcgccatctt ccagcaggc 29 <210> 19 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> Primer for site-directed mutagenesis of 2A sequence sepxCan-Cre <400> 19 caggctggag acgtggagga gaaccctgga cctatgagcg gccctccaaa aaa 53 <210> 20 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> Primer for CHX10 promoter <400> 20 cttcagcagg ctgaagttag tagctccgct tcccttgtac agctcgtcca tgc 53 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer for site-directed mutagenesis of 2A sequence sepxCan-Cre <400> 21 gaattcgaga agagcactgg 20 <210> 22 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Primer for CHX10 promoter <400> 22 gaattcaagc tttttgcaaa agccta 26 <210> 23 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Primer for NpHR-mCherry <400> 23 ggatccccac catggacaga gaccctg 27 <210> 24 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Primer for NpHR-mCherry <400> 24 ggatcctcac ttgtacagct cgtcca 26 <210> 25 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Primer for site-dorected mutagenesis inserting loxP <400> 25 acattatacg aagttataga tctacgggtg gcatccc 37 <210> 26 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Primer for site-dorected mutagenesis inserting loxP <400> 26 atgctatacg aagttattca cttgtacagc tcgtcca 37 <210> 27 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Primer for site-dorected mutagenesis inserting loxP <400> 27 acattatacg aagttatcca ccatgacaga gaccctg 37 <210> 28 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Primer for site-dorected mutagenesis inserting loxP <400> 28 atgctatacg aagttaaagc tttttgcaaa agccta 36 <110> Korea Institute of Science and Technology <120> A method for selective gene expression in the retinal ON / OFF bipolar cell <130> PN102204 <160> 28 <170> Kopatentin 2.0 <210> 1 <211> 4650 <212> DNA <213> Artificial Sequence <220> <223> pAAV-MCS <400> 1 cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcaaag cccgggcgtc 60 gggcgacctt tggtcgcccg gcctcagtga gcgagcgagc gcgcagagag ggagtggcca 120 actccatcac taggggttcc tgcggccgca cgcgtggagc tagttattaa tagtaatcaa 180 ttacggggtc attagttcat agcccatata tggagttccg cgttacataa cttacggtaa 240 atggcccgcc tggctgaccg cccaacgacc cccgcccatt gacgtcaata atgacgtatg 300 ttcccatagt aacgtcaata gggactttcc attgacgtca atgggtggag tatttacggt 360 aaactgccca cttggcagta catcaagtgt atcatatgcc aagtacgccc cctattgacg 420 tcaatgacgg taaatggccc gcctggcatt atgcccagta catgacctta tgggactttc 480 ctacttggca gtacatctac gtattagtca tcgctattac catggtgatg cggttttggc 540 agtacatcaa tgggcgtgga tagcggtttg actcacgggg atttccaagt ctccacccca 600 ttgacgtcaa tgggagtttg ttttgcacca aaatcaacgg gactttccaa aatgtcgtaa 660 caactccgcc ccattgacgc aaatgggcgg taggcgtgta cggtgggagg tctatataag 720 cagagctcgt ttagtgaacc gtcagatcgc ctggagacgc catccacgct gttttgacct 780 ccatagaaga caccgggacc gatccagcct ccgcggattc gaatcccggc cgggaacggt 840 gcattggaac gcggattccc cgtgccaaga gtgacgtaag taccgcctat agagtctata 900 ggcccacaaa aaatgctttc ttcttttaat atactttttt gtttatctta tttctaatac 960 tttccctaat ctctttcttt cagggcaata atgatacaat gtatcatgcc tctttgcacc 1020 attctaaaga ataacagtga taatttctgg gttaaggcaa tagcaatatt tctgcatata 1080 aatatttctg catataaatt gtaactgatg taagaggttt catattgcta atagcagcta 1140 caatccagct accattctgc ttttatttta tggttgggat aaggctggat tattctgagt 1200 ccaagctagg cccttttgct aatcatgttc atacctctta tcttcctccc acagctcctg 1260 ggcaacgtgc tggtctgtgt gctggcccat cactttggca aagaattggg attcgaacat 1320 cgattgaatt ccccggggat cctctagagt cgacctgcag aagcttgcct cgagcagcgc 1380 tgctcgagag atctacgggt ggcatccctg tgacccctcc ccagtgcctc tcctggccct 1440 ggaagttgcc actccagtgc ccaccagcct tgtcctaata aaattaagtt gcatcatttt 1500 gtctgactag gtgtccttct ataatattat ggggtggagg ggggtggtat ggagcaaggg 1560 gcaagttggg aagacaacct gtagggcctg cggggtctat tgggaaccaa gctggagtgc 1620 agtggcacaa tcttggctca ctgcaatctc cgcctcctgg gttcaagcga ttctcctgcc 1680 tcagcctccc gagttgttgg gattccaggc atgcatgacc aggctcagct aatttttgtt 1740 tttttggtag agacggggtt tcaccatatt ggccaggctg gtctccaact cctaatctca 1800 ggtgatctac ccaccttggc ctcccaaatt gctgggatta caggcgtgaa ccactgctcc 1860 cttccctgtc cttctgattt tgtaggtaac cacgtgcgga ccgagcggcc gcaggaaccc 1920 ctagtgatgg agttggccac tccctctctg cgcgctcgct cgctcactga ggccgggcga 1980 ccaaaggtcg cccgacgccc gggctttgcc cgggcggcct cagtgagcga gcgagcgcgc 2040 agctgcctgc aggggcgcct gatgcggtat tttctcctta cgcatctgtg cggtatttca 2100 cccgcatac gtcaaagcaa ccatagtacg cgccctgtag cggcgcatta agcgcggcgg 2160 gtgtggtggt tacgcgcagc gtgaccgcta cacttgccag cgccctagcg cccgctcctt 2220 tcgctttctt cccttccttt ctcgccacgt tcgccggctt tccccgtcaa gctctaaatc 2280 gggggctccc tttagggttc cgatttagtg ctttacggca cctcgacccc aaaaaacttg 2340 atttgggtga tggttcacgt agtgggccat cgccctgata gacggttttt cgccctttga 2400 cgttggagtc cacgttcttt aatagtggac tcttgttcca aactggaaca acactcaacc 2460 ctatctcggg ctattctttt gatttataag ggattttgcc gatttcggcc tattggttaa 2520 aaaatgagct gatttaacaa aaatttaacg cgaattttaa caaaatatta acgtttacaa 2580 ttttatggtg cactctcagt acaatctgct ctgatgccgc atagttaagc cagccccgac 2640 acccgccaac acccgctgac gcgccctgac gggcttgtct gctcccggca tccgcttaca 2700 gacaagctgt gaccgtctcc gggagctgca tgtgtcagag gttttcaccg tcatcaccga 2760 aacgcgcgag acgaaagggc ctcgtgatac gcctattttt ataggttaat gtcatgataa 2820 taatggtttc ttagacgtca ggtggcactt ttcggggaaa tgtgcgcgga acccctattt 2880 gtttattttt ctaaatacat tcaaatatgt atccgctcat gagacaataa ccctgataaa 2940 tgcttcaata atattgaaaa aggaagagta tgagtattca acatttccgt gtcgccctta 3000 ttcccttttt tgcggcattt tgccttcctg tttttgctca cccagaaacg ctggtgaaag 3060 taaaagatgc tgaagatcag ttgggtgcac gagtgggtta catcgaactg gatctcaaca 3120 gcggtaagat ccttgagagt tttcgccccg aagaacgttt tccaatgatg agcactttta 3180 aagttctgct atgtggcgcg gtattatccc gtattgacgc cgggcaagag caactcggtc 3240 gccgcataca ctattctcag aatgacttgg ttgagtactc accagtcaca gaaaagcatc 3300 ttacggatgg catgacagta agagaattat gcagtgctgc cataaccatg agtgataaca 3360 ctgcggccaa cttacttctg acaacgatcg gaggaccgaa ggagctaacc gcttttttgc 3420 acaacatggg ggatcatgta actcgccttg atcgttggga accggagctg aatgaagcca 3480 taccaaacga cgagcgtgac accacgatgc ctgtagcaat ggcaacaacg ttgcgcaaac 3540 tattaactgg cgaactactt actctagctt cccggcaaca attaatagac tggatggagg 3600 cggataaagt tgcaggacca cttctgcgct cggcccttcc ggctggctgg tttattgctg 3660 ataaatctgg agccggtgag cgtgggtctc gcggtatcat tgcagcactg gggccagatg 3720 gtaagccctc ccgtatcgta gttatctaca cgacggggag tcaggcaact atggatgaac 3780 gaaatagaca gatcgctgag ataggtgcct cactgattaa gcattggtaa ctgtcagacc 3840 aagtttactc atatatactt tagattgatt taaaacttca tttttaattt aaaaggatct 3900 aggtgaagat cctttttgat aatctcatga ccaaaatccc ttaacgtgag ttttcgttcc 3960 actgagcgtc agaccccgta gaaaagatca aaggatcttc ttgagatcct ttttttctgc 4020 gcgtaatctg ctgcttgcaa acaaaaaaac caccgctacc agcggtggtt tgtttgccgg 4080 atcaagagct accaactctt tttccgaagg taactggctt cagcagagcg cagataccaa 4140 atactgtcct tctagtgtag ccgtagttag gccaccactt caagaactct gtagcaccgc 4200 ctacatacct cgctctgcta atcctgttac cagtggctgc tgccagtggc gataagtcgt 4260 gtcttaccgg gttggactca agacgatagt taccggataa ggcgcagcgg tcgggctgaa 4320 cggggggttc gtgcacacag cccagcttgg agcgaacgac ctacaccgaa ctgagatacc 4380 tacagcgtga gctatgagaa agcgccacgc ttcccgaagg gagaaaggcg gacaggtatc 4440 cggtaagcgg cagggtcgga acaggagagc gcacgaggga gcttccaggg ggaaacgcct 4500 ggtatcttta tagtcctgtc gggtttcgcc acctctgact tgagcgtcga tttttgtgat 4560 gctcgtcagg ggggcggagc ctatggaaaa acgccagcaa cgcggccttt ttacggttcc 4620 tggccttttg ctggcctttt gctcacatgt 4650 <210> 2 <211> 200 <212> DNA <213> Artificial Sequence <220> <223> mGluR6 promoter <400> 2 gatctccaga tggctaaact tttaaatcat gaatgaagta gatattacca aattgctttt 60 tcagcatcca tttagataat catgtttttt gcctttaatc tgttaatgta gtgaattaca 120 gaaatacatt tcctaaatca ttacatcccc caaatcgtta atctgctaaa gtacatctct 180 ggctcaaaca agactggttg 200 <210> 3 <211> 1718 <212> DNA <213> Artificial Sequence <220> <223> Chr2-YFP <400> 3 ccaccatgga ctatggcggc gctttgtctg ccgtcggacg cgaacttttg ttcgttacta 60 atcctgtggt ggtgaacggg tccgtcctgg tccctgagga tcaatgttac tgtgccggat 120 ggattgaatc tcgcggcacg aacggcgctc agaccgcgtc aaatgtcctg cagtggcttg 180 cagcaggatt cagcattttg ctgctgatgt tctatgccta ccaaacctgg aaatctacat 240 gcggctggga ggagatctat gtgtgcgcca ttgaaatggt taaggtgatt ctcgagttct 300 tttttgagtt taagaatccc tctatgctct accttgccac aggacaccgg gtgcagtggc 360 tgcgctatgc agagtggctg ctcacttgtc ctgtcatcct tatccgcctg agcaacctca 420 ccggcctgag caacgactac agcaggagaa ccatgggact ccttgtctca gacatcggga 480 ctatcgtgtg gggggctacc agcgccatgg caaccggcta tgttaaagtc atcttctttt 540 gtcttggatt gtgctatggc gcgaacacat tttttcacgc cgccaaagca tatatcgagg 600 gttatcatac tgtgccaaag ggtcggtgcc gccaggtcgt gaccggcatg gcatggctgt 660 ttttcgtgag ctggggtatg ttcccaattc tcttcatttt ggggcccgaa ggttttggcg 720 tcctgagcgt ctatggctcc accgtaggtc acacgattat tgatctgatg agtaaaaatt 780 gttgggggtt gttgggacac tacctgcgcg tcctgatcca cgagcacata ttgattcacg 840 gagatatccg caaaaccacc aaactgaaca tcggcggaac ggagatcgag gtcgagactc 900 tcgtcgaaga cgaagccgag gccggagccg tgccagcggc cgccaagagc aggatcacca 960 gcgagggcga gtacatcccc ctggaccaga tcgacatcaa cgtggtgagc aagggcgagg 1020 agctgttcac cggggtggtg cccatcctgg tcgagctgga cggcgacgta aacggccaca 1080 agttcagcgt gtccggcgag ggcgagggcg atgccaccta cggcaagctg accctgaagt 1140 tcatctgcac caccggcaag ctgcccgtgc cctggcccac cctcgtgacc accttcggct 1200 acggcctgca gtgcttcgcc cgctaccccg accacatgaa gcagcacgac ttcttcaagt 1260 ccgccatgcc cgaaggctac gtccaggagc gcaccatctt cttcaaggac gacggcaact 1320 acaagacccg cgccgaggtg aagttcgagg gcgacaccct ggtgaaccgc atcgagctga 1380 agggcatcga cttcaaggag gacggcaaca tcctggggca caagctggag tacaactaca 1440 acagccacaa cgtctatatc atggccgaca agcagaagaa cggcatcaag gtgaacttca 1500 agatccgcca caacatcgag gacggcagcg tgcagctcgc cgaccactac cagcagaaca 1560 cccccatcgg cgacggcccc gtgctgctgc ccgacaacca ctacctgagc taccagtccg 1620 ccctgagcaa agaccccaac gagaagcgcg atcacatggt cctgctggag ttcgtgaccg 1680 ccgccgggat cactctcggc atggacgagc tgtacaag 1718 <210> 4 <211> 1083 <212> DNA <213> Artificial Sequence <220> <223> nlsCre <400> 4 atgagcggcc ctccaaaaaa gaagagaaag gtagaagacc cgggcggccg catgtccaat 60 ttactgaccg tacaccaaaa tttgcctgca ttaccggtcg atgcaacgag tgatgaggtt 120 cgcaagaacc tgatggacat gttcagggat cgccaggcgt tttctgagca tacctggaaa 180 atgcttctgt ccgtttgccg gtcgtgggcg gcatggtgca agttgaataa ccggaaatgg 240 tttcccgcag aacctgaaga tgttcgcgat tatcttctat atcttcaggc gcgcggtctg 300 gcagtaaaaa ctatccagca acatttgggc cagctaaaca tgcttcatcg tcggtccggg 360 ctgccacgac caagtgacag caatgctgtt tcactggtta tgcggcggat ccgaaaagaa 420 aacgttgatg ccggtgaacg tgcaaaacag gctctagcgt tcgaacgcac tgatttcgac 480 caggttcgtt cactcatgga aaatagcgat cgctgccagg atatacgtaa tctggcattt 540 ctggggattg cttataacac cctgttacgt atagccgaaa ttgccaggat cagggttaaa 600 gatatctcac gtactgacgg tgggagaatg ttaatccata ttggcagaac gaaaacgctg 660 gttagcaccg caggtgtaga gaaggcactt agcctggggg taactaaact ggtcgagcga 720 tggatttccg tctctggtgt agctgatgat ccgaataact acctgttttg ccgggtcaga 780 cctggaaggg 840 atttttgaag caactcatcg attgatttac ggcgctaagg atgactctgg tcagagatac 900 ctggcctggt ctggacacag tgcccgtgtc ggagccgcgc gagatatggc ccgcgctgga 960 gtttcaatac cggagatcat gcaagctggt ggctggacca atgtaaatat tgtcatgaac 1020 tatatccgta acctggatag tgaaacaggg gcaatggtgc gcctgctgga agatggcgat 1080 tag 1083 <210> 5 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> 2A <400> 5 ggaagcggag ctactaactt cagcctgctg aagcaggctg gagacgtgga ggagaaccct 60 ggacct 66 <210> 6 <211> 6251 <212> DNA <213> Artificial Sequence <220> <223> ON-AAV <400> 6 acatgtgagc aaaaggccag caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt 60 ttttccatag gctccgcccc cctgacgagc atcacaaaaa tcgacgctca agtcagaggt 120 ggcgaaaccc gacaggacta taaagatacc aggcgtttcc ccctggaagc tccctcgtgc 180 gctctcctgt tccgaccctg ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa 240 gcgtggcgct ttctcatagc tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct 300 ccaagctggg ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc ttatccggta 360 actatcgtct tgagtccaac ccggtaagac acgacttatc gccactggca gcagccactg 420 gtaacaggat tagcagagcg aggtatgtag gcggtgctac agagttcttg aagtggtggc 480 ctaactacgg ctacactaga aggacagtat ttggtatctg cgctctgctg aagccagtta 540 ccttcggaaa aagagttggt agctcttgat ccggcaaaca aaccaccgct ggtagcggtg 600 gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa gaagatcctt 660 tgatcttttc tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg 720 tcatgagatt atcaaaaagg atcttcacct agatcctttt aaattaaaaa tgaagtttta 780 aatcaatcta aagtatatat gagtaaactt ggtctgacag ttaccaatgc ttaatcagtg 840 aggcacctat ctcagcgatc tgtctatttc gttcatccat agttgcctga ctccccgtcg 900 tgtagataac tacgatacgg gagggcttac catctggccc cagtgctgca atgataccgc 960 gagacccacg ctcaccggct ccagatttat cagcaataaa ccagccagcc ggaagggccg 1020 agcgcagaag tggtcctgca actttatccg cctccatcca gtctattaat tgttgccggg 1080 aagctagagt aagtagttcg ccagttaata gtttgcgcaa cgttgttgcc attgctacag 1140 gcatcgtggt gtcacgctcg tcgtttggta tggcttcatt cagctccggt tcccaacgat 1200 caaggcgagt tacatgatcc cccatgttgt gcaaaaaagc ggttagctcc ttcggtcctc 1260 cgatcgttgt cagaagtaag ttggccgcag tgttatcact catggttatg gcagcactgc 1320 ataattctct tactgtcatg ccatccgtaa gatgcttttc tgtgactggt gagtactcaa 1380 ccaagtcatt ctgagaatag tgtatgcggc gaccgagttg ctcttgcccg gcgtcaatac 1440 gggataatac cgcgccacat agcagaactt taaaagtgct catcattgga aaacgttctt 1500 cggggcgaaa actctcaagg atcttaccgc tgttgagatc cagttcgatg taacccactc 1560 gtgcacccaa ctgatcttca gcatctttta ctttcaccag cgtttctggg tgagcaaaaa 1620 caggaaggca aaatgccgca aaaaagggaa taagggcgac acggaaatgt tgaatactca 1680 tactcttcct ttttcaatat tattgaagca tttatcaggg ttattgtctc atgagcggat 1740 acatatttga atgtatttag aaaaataaac aaataggggt tccgcgcaca tttccccgaa 1800 aagtgccacc tgacgtctaa gaaaccatta ttatcatgac attaacctat aaaaataggc 1860 gtatcacgag gccctttcgt ctcgcgcgtt tcggtgatga cggtgaaaac ctctgacaca 1920 tgcagctccc ggagacggtc acagcttgtc tgtaagcgga tgccgggagc agacaagccc 1980 gtcagggcgc gtcagcgggt gttggcgggt gtcggggctg gcttaactat gcggcatcag 2040 agcagattgt actgagagtg caccataaaa ttgtaaacgt taatattttg ttaaaattcg 2100 cgttaaattt ttgttaaatc agctcatttt ttaaccaata ggccgaaatc ggcaaaatcc 2160 cttataaatc aaaagaatag cccgagatag ggttgagtgt tgttccagtt tggaacaaga 2220 gtccactatt aaagaacgtg gactccaacg tcaaagggcg aaaaaccgtc tatcagggcg 2280 atggcccact acgtgaacca tcacccaaat caagtttttt ggggtcgagg tgccgtaaag 2340 cactaaatcg gaaccctaaa gggagccccc gatttagagc ttgacgggga aagccggcga 2400 acgtggcgag aaaggaaggg aagaaagcga aaggagcggg cgctagggcg ctggcaagtg 2460 tagcggtcac gctgcgcgta accaccacac ccgccgcgct taatgcgccg ctacagggcg 2520 cgtactatgg ttgctttgac gtatgcggtg tgaaataccg cacagatgcg taaggagaaa 2580 ataccgcatc aggcgcccct gcaggcagct gcgcgctcgc tcgctcactg aggccgcccg 2640 ggcaaagccc gggcgtcggg cgacctttgg tcgcccggcc tcagtgagcg agcgagcgcg 2700 cagagaggga gtggccaact ccatcactag gggttcctgc ggccgctcgg tccgcacgtg 2760 gttacctaca aaatcagaag gacagggaag ggagcagtgg ttcacgcctg taatcccagc 2820 aatttgggag gccaaggtgg gtagatcacc tgagattagg agttggagac cagcctggcc 2880 aatatggtga aaccccgtct ctaccaaaaa aacaaaaatt agctgagcct ggtcatgcat 2940 gcctggaatc ccaacaactc gggaggctga ggcaggagaa tcgcttgaac ccaggaggcg 3000 gagattgcag tgagccaaga ttgtgccact gcactccagc ttggttccca atagaccccg 3060 caggccctac aggttgtctt cccaacttgc cccttgctcc ataccacccc cctccacccc 3120 ataatattat agaaggacac ctagtcagac aaaatgatgc aacttaattt tattaggaca 3180 aggctggtgg gcactggagt ggcaacttcc agggccagga gaggcactgg ggaggggtca 3240 cagggatgcc acccgtagat ctctaatcgc catcttccag caggcgcacc attgcccctg 3300 tttcactatc caggttacgg atatagttca tgacaatatt tacattggtc cagccaccag 3360 cttgcatgat ctccggtatt gaaactccag cgcgggccat atctcgcgcg gctccgacac 3420 gggcactgtg tccagaccag gccaggtatc tctgaccaga gtcatcctta gcgccgtaaa 3480 tcaatcgatg agttgcttca aaaatccctt ccagggcgcg agttgatagc tggctggtgg 3540 cagatggcgc ggcaacacca ttttttctga cccggcaaaa caggtagtta ttcggatcat 3600 cagctacacc agagacggaa atccatcgct cgaccagttt agttaccccc aggctaagtg 3660 ccttctctac acctgcggtg ctaaccagcg ttttcgttct gccaatatgg attaacattc 3720 tcccaccgtc agtacgtgag atatctttaa ccctgatcct ggcaatttcg gctatacgta 3780 acagggtgtt ataagcaatc cccagaaatg ccagattacg tatatcctgg cagcgatcgc 3840 tattttccat gagtgaacga acctggtcga aatcagtgcg ttcgaacgct agagcctgtt 3900 ttgcacgttc accggcatca acgttttctt ttcggatccg ccgcataacc agtgaaacag 3960 cattgctgtc acttggtcgt ggcagcccgg accgacgatg aagcatgttt agctggccca 4020 aatgttgctg gatagttttt actgccagac cgcgcgcctg aagatataga agataatcgc 4080 gaacatcttc aggttctgcg ggaaaccatt tccggttatt caacttgcac catgccgccc 4140 acgaccggca aacggacaga agcattttcc aggtatgctc agaaaacgcc tggcgatccc 4200 tgaacatgtc catcaggttc ttgcgaacct catcactcgt tgcatcgacc ggtaatgcag 4260 gcaaattttg gtgtacggtc agtaaattgg acataggtcc agggttctcc tccacgtctc 4320 cagcctgctt cagcaggctg aagttagtag ctccgcttcc cttgtacagc tcgtccatgc 4380 cgagagtgat cccggcggcg gtcacgaact ccagcaggac catgtgatcg cgcttctcgt 4440 tggggtcttt gctcagggcg gactggtagc tcaggtagtg gttgtcgggc agcagcacgg 4500 ggccgtcgcc gatgggggtg ttctgctggt agtggtcggc gagctgcacg ctgccgtcct 4560 cgatgttgtg gcggatcttg aagttcacct tgatgccgtt cttctgcttg tcggccatga 4620 tatagacgtt gtggctgttg tagttgtact ccagcttgtg ccccaggatg ttgccgtcct 4680 ccttgaagtc gatgcccttc agctcgatgc ggttcaccag ggtgtcgccc tcgaacttca 4740 cctcggcgcg ggtcttgtag ttgccgtcgt ccttgaagaa gatggtgcgc tcctggacgt 4800 agccttcggg catggcggac ttgaagaagt cgtgctgctt catgtggtcg gggtagcggg 4860 cgaagcactg caggccgtag ccgaaggtgg tcacgagggt gggccagggc acgggcagct 4920 tgccggtggt gcagatgaac ttcagggtca gcttgccgta ggtggcatcg ccctcgccct 4980 cgccggacac gctgaacttg tggccgttta cgtcgccgtc cagctcgacc aggatgggca 5040 ccaccccggt gaacagctcc tcgcccttgc tcaccacgtt gatgtcgatc tggtccaggg 5100 ggatgtactc gccctcgctg gtgatcctgc tcttggcggc cgctggcacg gctccggcct 5160 cggcttcgtc ttcgacgaga gtctcgacct cgatctccgt tccgccgatg ttcagtttgg 5220 tggttttgcg gatatctccg tgaatcaata tgtgctcgtg gatcaggacg cgcaggtagt 5280 gtcccaacaa cccccaacaa tttttactca tcagatcaat aatcgtgtga cctacggtgg 5340 agccatagac gctcaggacg ccaaaacctt cgggccccaa aatgaagaga attgggaaca 5400 taccccagct cacgaaaaac agccatgcca tgccggtcac gacctggcgg caccgaccct 5460 ttggcacagt atgataaccc tcgatatatg ctttggcggc gtgaaaaaat gtgttcgcgc 5520 catagcacaa tccaagacaa aagaagatga ctttaacata gccggttgcc atggcgctgg 5580 tagcccccca cacgatagtc ccgatgtctg agacaaggag tcccatggtt ctcctgctgt 5640 agtcgttgct caggccggtg aggttgctca ggcggataag gatgacagga caagtgagca 5700 gccactctgc atagcgcagc cactgcaccc ggtgtcctgt ggcaaggtag agcatagagg 5760 gattcttaaa ctcaaaaaag aactcgagaa tcaccttaac catttcaatg gcgcacacat 5820 agatctcctc ccagccgcat gtagatttcc aggtttggta ggcatagaac atcagcagca 5880 aaatgctgaa tcctgctgca agccactgca ggacatttga cgcggtctga gcgccgttcg 5940 tgccgcgaga ttcaatccat ccggcacagt aacattgatc ctcagggacc aggacggacc 6000 cgttcaccac cacaggatta gtaacgaaca aaagttcgcg tccgacggca gacaaagcgc 6060 cgccatagtc ccatggtggg gatccccggg gaattcacgc gtgcggccgc aggaacccct 6120 agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg ccgggcgacc 6180 aaaggtcgcc cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc gagcgcgcag 6240 ctgcctgcag g 6251 <210> 7 <211> 390 <212> DNA <213> Artificial Sequence <220> <223> The CHX10 promoter <400> 7 gaattcgaga agagcactgg ctggggctgc ttgcccgcta atcccagctg ccattaaaat 60 attaaagata aatctaatcg tctctttatc caaaataagc gacttttgtg tggggagaaa 120 acgtctaacc ccttaggagg agaattagtt ctaatgcatc aaatggaatt gctcgagatc 180 tgcgatctgc atctcaatta gtcagcaacc atagtcccgc ccctaactcc gcccatcccg 240 cccctaactc cgcccagttc cgcccattct ccgccccatc gctgactaat tttttttatt 300 tatgcagagg ccgaggccgc ctcggcctct gagctattcc agaagtagtg aggaggcttt 360 tttggaggcc taggcttttg caaaaagctt 390 <210> 8 <211> 1652 <212> DNA <213> Artificial Sequence <220> <223> NpHR-mCherry <400> 8 ccaccatgac agagaccctg cctcccgtga ccgagagtgc cgtggccctt caagccgagg 60 ttacccaaag ggagttgttc gagttcgtgc tgaacgaccc tttgcttgca agcagtctct 120 atatcaacat cgcacttgca ggactgagta tactgctgtt cgtttttatg acccgaggac 180 tcgatgatcc acgggcaaaa cttattgctg tgtcaaccat ccttgtgcct gtcgtcagca 240 ttgcctccta cactggattg gcgagcggcc tgacaatttc cgttcttgaa atgccagcgg 300 gccattttgc agaaggcagc tcagtgatgc tgggaggaga agaggtagat ggtgtagtca 360 ccatgtgggg acggtatctc acctgggcac tttccacgcc catgattctc ctcgctctgg 420 gtctcctggc cggaagcaat gctacaaagc tcttcacagc tatcactttc gatatcgcta 480 tgtgcgtgac tggccttgcc gcggccctga ctacctcctc ccacctcatg agatggttct 540 ggtacgctat cagttgtgca tgctttctgg tggtcttgta tatcctgctg gtggagtggg 600 cacaggacgc caaagccgcg ggaaccgctg acatgttcaa taccctgaag ctgttgacag 660 tagtgatgtg gctggggtat ccaattgtgt gggctcttgg agtcgagggt atcgcggtgt 720 tgcccgttgg ggtgacgagc tggggatatt ctttcctgga tatcgtggca aagtacattt 780 tcgcattctt gctcctgaac tatctgacgt caaacgaatc tgtcgtgtcc ggcagcattt 840 tggatgttcc atctgcttct gggaccccgg ctgatgatgc ggccgccaag agcaggatca 900 ccagcgaggg cgagtacatc cccctggacc agatcgacat caacgtggtg agcaagggcg 960 aggaggataa catggccatc atcaaggagt tcatgcgctt caaggtgcac atggagggct 1020 ccgtgaacgg ccacgagttc gagatcgagg gcgagggcga gggccgcccc tacgagggca 1080 cccagaccgc caagctgaag gtgaccaagg gtggccccct gcccttcgcc tgggacatcc 1140 tgtcccctca gttcatgtac ggctccaagg cctacgtgaa gcaccccgcc gacatccccg 1200 actacttgaa gctgtccttc cccgagggct tcaagtggga gcgcgtgatg aacttcgagg 1260 acggcggcgt ggtgaccgtg acccaggact cctccctgca ggacggcgag ttcatctaca 1320 aggtgaagct gcgcggcacc aacttcccct ccgacggccc cgtaatgcag aagaagacca 1380 tgggctggga ggcctcctcc gagcggatgt accccgagga cggcgccctg aagggcgaga 1440 tcaagcagag gctgaagctg aaggacggcg gccactacga cgctgaggtc aagaccacct 1500 acaaggccaa gaagcccgtg cagctgcccg gcgcctacaa cgtcaacatc aagttggaca 1560 tcacctccca caacgaggac tacaccatcg tggaacagta cgaacgcgcc gagggccgcc 1620 actccaccgg cggcatggac gagctgtaca ag 1652 <210> 9 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> loxP <400> 9 ataacttcgt atagcataca ttatacgaag ttat 34 <210> 10 <211> 5530 <212> DNA <213> Artificial Sequence <220> <223> OFF-AAV <400> 10 cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcaaag cccgggcgtc 60 gggcgacctt tggtcgcccg gcctcagtga gcgagcgagc gcgcagagag ggagtggcca 120 actccatcac taggggttcc tgcggccgca cgcgtgaatt cgagaagagc actggctggg 180 gctgcttgcc cgctaatccc agctgccatt aaaatattaa agataaatct aatcgtctct 240 ttatccaaaa taagcgactt ttgtgtgggg agaaaacgtc taacccctta ggaggagaat 300 tagttctaat gcatcaaatg gaattgctcg agatctgcga tctgcatctc aattagtcag 360 caaccatagt cccgccccta actccgccca tcccgcccct aactccgccc agttccgccc 420 attctccgcc ccatcgctga ctaatttttt ttatttatgc agaggccgag gccgcctcgg 480 cctctgagct attccagaag tagtgaggag gcttttttgg aggcctaggc ttttgcaaaa 540 agcttataac ttcgtatagc atacattata cgaagttatc caccatgaca gagaccctgc 600 ctcccgtgac cgagagtgcc gtggcccttc aagccgaggt tacccaaagg gagttgttcg 660 agttcgtgct gaacgaccct ttgcttgcaa gcagtctcta tatcaacatc gcacttgcag 720 gactgagtat actgctgttc gtttttatga cccgaggact cgatgatcca cgggcaaaac 780 ttattgctgt gtcaaccatc cttgtgcctg tcgtcagcat tgcctcctac actggattgg 840 cgagcggcct gacaatttcc gttcttgaaa tgccagcggg ccattttgca gaaggcagct 900 cagtgatgct gggaggagaa gaggtagatg gtgtagtcac catgtgggga cggtatctca 960 cctgggcact ttccacgccc atgattctcc tcgctctggg tctcctggcc ggaagcaatg 1020 ctacaaagct cttcacagct atcactttcg atatcgctat gtgcgtgact ggccttgccg 1080 cggccctgac tacctcctcc cacctcatga gatggttctg gtacgctatc agttgtgcat 1140 gctttctggt ggtcttgtat atcctgctgg tggagtgggc acaggacgcc aaagccgcgg 1200 gaaccgctga catgttcaat accctgaagc tgttgacagt agtgatgtgg ctggggtatc 1260 caattgtgtg ggctcttgga gtcgagggta tcgcggtgtt gcccgttggg gtgacgagct 1320 ggggatattc tttcctggat atcgtggcaa agtacatttt cgcattcttg ctcctgaact 1380 atctgacgtc aaacgaatct gtcgtgtccg gcagcatttt ggatgttcca tctgcttctg 1440 ggaccccggc tgatgatgcg gccgccaaga gcaggatcac cagcgagggc gagtacatcc 1500 ccctggacca gatcgacatc aacgtggtga gcaagggcga ggaggataac atggccatca 1560 tcaaggagtt catgcgcttc aaggtgcaca tggagggctc cgtgaacggc cacgagttcg 1620 agatcgaggg cgagggcgag ggccgcccct acgagggcac ccagaccgcc aagctgaagg 1680 tgaccaaggg tggccccctg cccttcgcct gggacatcct gtcccctcag ttcatgtacg 1740 gctccaaggc ctacgtgaag caccccgccg acatccccga ctacttgaag ctgtccttcc 1800 ccgagggctt caagtgggag cgcgtgatga acttcgagga cggcggcgtg gtgaccgtga 1860 cccaggactc ctccctgcag gacggcgagt tcatctacaa ggtgaagctg cgcggcacca 1920 acttcccctc cgacggcccc gtaatgcaga agaagaccat gggctgggag gcctcctccg 1980 agcggatgta ccccgaggac ggcgccctga agggcgagat caagcagagg ctgaagctga 2040 aggacggcgg ccactacgac gctgaggtca agaccaccta caaggccaag aagcccgtgc 2100 agctgcccgg cgcctacaac gtcaacatca agttggacat cacctcccac aacgaggact 2160 acaccatcgt ggaacagtac gaacgcgccg agggccgcca ctccaccggc ggcatggacg 2220 agctgtacaa gtgaataact tcgtatagca tacattatac gaagttatag atctacgggt 2280 ggcatccctg tgacccctcc ccagtgcctc tcctggccct ggaagttgcc actccagtgc 2340 ccaccagcct tgtcctaata aaattaagtt gcatcatttt gtctgactag gtgtccttct 2400 ataatattat ggggtggagg ggggtggtat ggagcaaggg gcaagttggg aagacaacct 2460 gtagggcctg cggggtctat tgggaaccaa gctggagtgc agtggcacaa tcttggctca 2520 ctgcaatctc cgcctcctgg gttcaagcga ttctcctgcc tcagcctccc gagttgttgg 2580 gattccaggc atgcatgacc aggctcagct aatttttgtt tttttggtag agacggggtt 2640 tcaccatatt ggccaggctg gtctccaact cctaatctca ggtgatctac ccaccttggc 2700 ctcccaaatt gctgggatta caggcgtgaa ccactgctcc cttccctgtc cttctgattt 2760 tgtaggtaac cacgtgcgga ccgagcggcc gcaggaaccc ctagtgatgg agttggccac 2820 tccctctctg cgcgctcgct cgctcactga ggccgggcga ccaaaggtcg cccgacgccc 2880 gggctttgcc cgggcggcct cagtgagcga gcgagcgcgc agctgcctgc aggggcgcct 2940 gatgcggtat tttctcctta cgcatctgtg cggtatttca caccgcatac gtcaaagcaa 3000 ccatagtacg cgccctgtag cggcgcatta agcgcggcgg gtgtggtggt tacgcgcagc 3060 gtgaccgcta cacttgccag cgccctagcg cccgctcctt tcgctttctt cccttccttt 3120 ctcgccacgt tcgccggctt tccccgtcaa gctctaaatc gggggctccc tttagggttc 3180 cgatttagtg ctttacggca cctcgacccc aaaaaacttg atttgggtga tggttcacgt 3240 agtgggccat cgccctgata gacggttttt cgccctttga cgttggagtc cacgttcttt 3300 aatagtggac tcttgttcca aactggaaca acactcaacc ctatctcggg ctattctttt 3360 gatttataag ggattttgcc gatttcggcc tattggttaa aaaatgagct gatttaacaa 3420 aaatttaacg cgaattttaa caaaatatta acgtttacaa ttttatggtg cactctcagt 3480 acaatctgct ctgatgccgc atagttaagc cagccccgac acccgccaac acccgctgac 3540 gcgccctgac gggcttgtct gctcccggca tccgcttaca gacaagctgt gaccgtctcc 3600 gggagctgca tgtgtcagag gttttcaccg tcatcaccga aacgcgcgag acgaaagggc 3660 ctcgtgatac gcctattttt ataggttaat gtcatgataa taatggtttc ttagacgtca 3720 ggtggcactt ttcggggaaa tgtgcgcgga acccctattt gtttattttt ctaaatacat 3780 tcaaatatgt atccgctcat gagacaataa ccctgataaa tgcttcaata atattgaaaa 3840 aggaagagta tgagtattca acatttccgt gtcgccctta ttcccttttt tgcggcattt 3900 tgccttcctg tttttgctca cccagaaacg ctggtgaaag taaaagatgc tgaagatcag 3960 ttgggtgcac gagtgggtta catcgaactg gatctcaaca gcggtaagat ccttgagagt 4020 tttcgccccg aagaacgttt tccaatgatg agcactttta aagttctgct atgtggcgcg 4080 gtattatccc gtattgacgc cgggcaagag caactcggtc gccgcataca ctattctcag 4140 aatgacttgg ttgagtactc accagtcaca gaaaagcatc ttacggatgg catgacagta 4200 agagaattat gcagtgctgc cataaccatg agtgataaca ctgcggccaa cttacttctg 4260 acaacgatcg gaggaccgaa ggagctaacc gcttttttgc acaacatggg ggatcatgta 4320 actcgccttg atcgttggga accggagctg aatgaagcca taccaaacga cgagcgtgac 4380 accacgatgc ctgtagcaat ggcaacaacg ttgcgcaaac tattaactgg cgaactactt 4440 actctagctt cccggcaaca attaatagac tggatggagg cggataaagt tgcaggacca 4500 cttctgcgct cggcccttcc ggctggctgg tttattgctg ataaatctgg agccggtgag 4560 cgtgggtctc gcggtatcat tgcagcactg gggccagatg gtaagccctc ccgtatcgta 4620 gttatctaca cgacggggag tcaggcaact atggatgaac gaaatagaca gatcgctgag 4680 ataggtgcct cactgattaa gcattggtaa ctgtcagacc aagtttactc atatatactt 4740 tagattgatt taaaacttca tttttaattt aaaaggatct aggtgaagat cctttttgat 4800 aatctcatga ccaaaatccc ttaacgtgag ttttcgttcc actgagcgtc agaccccgta 4860 gaaaagatca aaggatcttc ttgagatcct ttttttctgc gcgtaatctg ctgcttgcaa 4920 acaaaaaaac caccgctacc agcggtggtt tgtttgccgg atcaagagct accaactctt 4980 tttccgaagg taactggctt cagcagagcg cagataccaa atactgtcct tctagtgtag 5040 ccgtagttag gccaccactt caagaactct gtagcaccgc ctacatacct cgctctgcta 5100 atcctgttac cagtggctgc tgccagtggc gataagtcgt gtcttaccgg gttggactca 5160 agacgatagt taccggataa ggcgcagcgg tcgggctgaa cggggggttc gtgcacacag 5220 cccagcttgg agcgaacgac ctacaccgaa ctgagatacc tacagcgtga gctatgagaa 5280 agcgccacgc ttcccgaagg gagaaaggcg gacaggtatc cggtaagcgg cagggtcgga 5340 acaggagagc gcacgaggga gcttccaggg ggaaacgcct ggtatcttta tagtcctgtc 5400 gggtttcgcc acctctgact tgagcgtcga tttttgtgat gctcgtcagg ggggcggagc 5460 ctatggaaaa acgccagcaa cgcggccttt ttacggttcc tggccttttg ctggcctttt 5520 gctcacatgt 5530 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer 1 <400> 11 tcgcgtgcgg ccgcaggaac 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer 2 <400> 12 gaattccccg gggatcctct 20 <210> 13 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 gaattcgatc tccagatggc taaact 26 <210> 14 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 gaattccaac cagtcttgtt tgagcc 26 <210> 15 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 ggatccccac catgggacta tggcggc 27 <210> 16 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 ggatcccttg tacagctcgt ccatgc 26 <210> 17 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Primer for pxCan-Cre <400> 17 agatctatga gcggccctcc aaaaaa 26 <210> 18 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Primer for pxCan-Cre <400> 18 agatctctaa tcgccatctt ccagcaggc 29 <210> 19 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> Primer for site-directed mutagenesis of 2A sequence sepxCan-Cre <400> 19 caggctggag acgtggagga gaaccctgga cctatgagcg gccctccaaa aaa 53 <210> 20 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> Primer for CHX10 promoter <400> 20 cttcagcagg ctgaagttag tagctccgct tcccttgtac agctcgtcca tgc 53 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer for site-directed mutagenesis of 2A sequence sepxCan-Cre <400> 21 gaattcgaga agagcactgg 20 <210> 22 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Primer for CHX10 promoter <400> 22 gaattcaagc tttttgcaaa agccta 26 <210> 23 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Primer for NpHR-mCherry <400> 23 ggatccccac catggacaga gaccctg 27 <210> 24 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Primer for NpHR-mCherry <400> 24 ggatcctcac ttgtacagct cgtcca 26 <210> 25 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Primer for site-dorected mutagenesis inserting loxP <400> 25 acattatacg aagttataga tctacgggtg gcatccc 37 <210> 26 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Primer for site-dorected mutagenesis inserting loxP <400> 26 atgctatacg aagttattca cttgtacagc tcgtcca 37 <210> 27 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Primer for site-dorected mutagenesis inserting loxP <400> 27 acattatacg aagttatcca ccatgacaga gaccctg 37 <210> 28 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Primer for site-dorected mutagenesis inserting loxP <400> 28 atgctatacg aagttaaagc tttttgcaaa agccta 36
Claims (12)
CHX10 프로모터 또는 CaBP5 프로모터, 제2 표적 유전자 및 loxP 서열을 포함하는 제2 벡터를 포함하는, 이극세포에서 선택적 유전자 발현용 키트.a first vector comprising the mGluR6 promoter, the first target gene, and the Cre gene; And
A second vector comprising a CHX10 promoter or CaBP5 promoter, a second target gene, and a loxP sequence.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020130091597A KR101594421B1 (en) | 2013-08-01 | 2013-08-01 | A method for selective gene expression in the retinal ON/OFF bipolar cell |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020130091597A KR101594421B1 (en) | 2013-08-01 | 2013-08-01 | A method for selective gene expression in the retinal ON/OFF bipolar cell |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20150015779A KR20150015779A (en) | 2015-02-11 |
KR101594421B1 true KR101594421B1 (en) | 2016-02-18 |
Family
ID=52572945
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020130091597A KR101594421B1 (en) | 2013-08-01 | 2013-08-01 | A method for selective gene expression in the retinal ON/OFF bipolar cell |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR101594421B1 (en) |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20090281163A1 (en) | 2008-05-09 | 2009-11-12 | President And Fellows Of Harvard College | Regulatory elements that mediate retinal cell-specific gene expression |
US20120093772A1 (en) | 2008-05-20 | 2012-04-19 | Alan Horsager | Vectors for delivery of light sensitive proteins and methods of use |
-
2013
- 2013-08-01 KR KR1020130091597A patent/KR101594421B1/en active IP Right Grant
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20090281163A1 (en) | 2008-05-09 | 2009-11-12 | President And Fellows Of Harvard College | Regulatory elements that mediate retinal cell-specific gene expression |
US20120093772A1 (en) | 2008-05-20 | 2012-04-19 | Alan Horsager | Vectors for delivery of light sensitive proteins and methods of use |
Also Published As
Publication number | Publication date |
---|---|
KR20150015779A (en) | 2015-02-11 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
KR102370675B1 (en) | Improved methods for modification of target nucleic acids | |
CN111372943B (en) | Adenovirus and use thereof | |
AU2023270322A1 (en) | Compositions and methods for modifying genomes | |
KR100994610B1 (en) | Modified growth hormones | |
CN101939434B (en) | Dgat genes from yarrowia lipolytica for increased seed storage lipid production and altered fatty acid profiles in soybean | |
KR101471445B1 (en) | Transgene expression in avians | |
KR20130132405A (en) | Strains of agrobacterium modified to increase plant transformation frequency | |
KR20220012327A (en) | Methods and cells for production of phytocannabinoids and phytocannabinoid precursors | |
US10557149B1 (en) | Recombinantly-modified adeno-associated virus helper vectors and their use to improve the packaging efficiency of recombinantly-modified adeno-associated virus | |
KR20120034652A (en) | Method for generating a genetically modified microbe | |
CN101903046B (en) | Constructs containing multiple expression cassettes for cancer therapy | |
CN112679617B (en) | Mammal fusion protein display plasmid based on mesothelin anchoring, cell line and application | |
US20030180740A1 (en) | Differential expression screening method | |
CN101652475A (en) | In bird, carry out transgene expression | |
KR101523715B1 (en) | Stimulation system for neuro-modulation using hybrid stimulation | |
CN114874332B (en) | Use of modified RNF112 as a medicament for the treatment of ALS | |
KR101594421B1 (en) | A method for selective gene expression in the retinal ON/OFF bipolar cell | |
CN113355288B (en) | Preparation method and application of universal chimeric antigen receptor T cell for treating COVID-19 | |
KR20230110271A (en) | Olivetolic acid cyclase variants with improved activity for use in the production of plant cannabinoids | |
CN107058390A (en) | A kind of slow virus carrier, recombinant slow virus plasmid, virus and viral application | |
US20230174955A1 (en) | Monomeric proteins for hydroxylating amino acids and products | |
CN109517829B (en) | Reverse genetic operation system of swine atypical pestivirus GD2 strain and establishment method and application thereof | |
Hosseini | RAB-10 and the RAB-10 GAP, TBC-4, are Both Required for PLM Dendrite Termination in C. Elegans | |
JPH10212298A (en) | Histidine tag chlamydia pneumoniae antigen polypeptide fusion protein, its production, dna coding for the same fusion protein, recombinant vector containing the dna, transformant containing the recombinant vector, recombinant baculovirus, its production and production of anti-chlamydia pneumoniae antibody |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A201 | Request for examination | ||
E902 | Notification of reason for refusal | ||
E902 | Notification of reason for refusal | ||
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant | ||
FPAY | Annual fee payment |
Payment date: 20190201 Year of fee payment: 4 |
|
FPAY | Annual fee payment |
Payment date: 20200203 Year of fee payment: 5 |