KR101592653B1 - Methods for Screening Antimicrobial Agents against Staphylococcus warneri - Google Patents

Abstract

TECHNICAL FIELD The present invention relates to a method of screening an antimicrobial agent capable of controlling microorganisms causing odor in an air conditioner, and a method of removing odor in an air conditioner. The odor-inducing microorganisms in the air conditioning system of the present invention can be used for the development of a novel antimicrobial agent or the development of a fragrance for blocking the odor by identifying the chemical properties of the metabolites of the microorganism. Further, the present invention has various industrial advantages such as being capable of being used in an air conditioner to preliminarily prepare an environment in which the microorganism can not be inhabited and to fundamentally remove the cause of the odor.

Description

Methods for Screening Antimicrobial Agents against Staphylococcus warneri < RTI ID = 0.0 >

TECHNICAL FIELD The present invention relates to a method of screening an antimicrobial agent capable of controlling microorganisms causing odor in an air conditioner, and a method of removing odor in an air conditioner.

Clean air is recognized as the basis for human health and well-being, and unpleasant odors or contaminated air act as a major factor impeding a pleasant environment. For example, unsatisfactory indoor air quality in enclosed conditions is caused by two important factors: One is the indoor air pollutant generated directly from the constituent material itself (building or vehicle) constituting the enclosed environment, and the other factor is the smell generated by the material generated by human activity or from the outside.

Air conditioning system is a system that optimizes the indoor environment by lowering indoor temperature by aiming to harmonize air temperature, humidity, air flow and cleanliness in buildings, vehicles, railways, ships, and aircraft. These air conditioning systems are increasing in penetration rate due to the improvement of living standards. There have been many improvements in the basic functions due to the increase of the air conditioning system, but there are still many problems to solve due to the environmental aspect for the indoor air quality.

In air conditioning systems, air-conditioner odor is known to be attributed to fungi and the metabolites of bacteria, but specific data on the types of fungi and bacteria and how the microorganisms specifically secrete certain metabolites have yet to be found It is in a state that it is not.

In the structure of the air conditioner, all the air passing through the blower passes through the evaporator core. When heat exchange is performed between the cold refrigerant and the air, condensation condensation phenomenon occurs on the evaporator surface depending on the temperature difference. Is provided with a good environment for fungi and bacteria to form and propagate. When fungi and bacteria are proliferated on the EVA core exposed to the outside air, volatile organic compounds (mVOCs) of the microorganisms are generated as the metabolites of the bacteria that have proliferated on the surface of the EVA core, and air passing through the EVA core is blown into the room The volatile organic compounds generated by the microorganisms may expose the room to odors caused by fungi and bacteria during long-term use.

The EVA core surface, which generates bad odors, is covered with biofilm according to long-term use. They are composed of bacteria, cell clusters and EPS. EPS is composed of protein, polysaccharide, polyuronic acid, Nucletic, and Lipid. On the surface of EVA core, various bacteria and fungi multiply as biofilm, and organic compounds (mVOCs) by microorganisms are emitted as metabolites. Among the various factors of the odor, it is known as the scavenging odor.

Various types of fragrances are commercially available to remove the odor. However, it is often the case that the fungi and germs living in the EVA core can not be fundamentally removed, but merely temporarily serve to dilute an unpleasant smell. Antimicrobial agents have not yet been developed to act specifically on certain fungi or bacteria in the eva core, and are sold only because of the antimicrobial activity against common pathogens.

Accordingly, the present invention provides an antimicrobial agent capable of forming a pleasant indoor air environment by specifically isolating and preventing the fungi and bacteria of the eva core from being specifically blocked or preventing the propagation thereof, and a technique capable of removing unpleasant odors using the antimicrobial agent This is an urgent situation.

It should be understood that the foregoing description of the background art is merely for the purpose of promoting an understanding of the background of the present invention and is not to be construed as adhering to the prior art already known to those skilled in the art.

The present inventors have sought to identify microorganisms that live in an air conditioner and cause odor and to find a way to effectively control them. As a result, the inventors succeeded in separating 12 kinds of malodorous microorganisms forming the biofilm in the air conditioner, and when they were controlled, it was confirmed that odor caused by the air conditioner can be significantly blocked, thereby completing the present invention.

It is therefore an object of the present invention is a microorganism that causes the odor in the air conditioner Staphylococcus And a method for screening antimicrobial agents against Staphylococcus warneri .

Another object of the present invention is to provide a malodor generating microorganism in an air conditioner.

Another object of the present invention is to provide a method for inhibiting the growth of a malodor-inducing microorganism in an air conditioner, which comprises the step of applying or spraying an antibacterial agent in the air conditioner.

It is still another object of the present invention to provide a method of removing odor in an air conditioner, which comprises separating or killing odor-inducing microorganisms from the air conditioning apparatus.

It is still another object of the present invention to provide a method for removing odor in an air conditioner, which comprises suppressing the growth of odor-inducing microorganisms in the air conditioner.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

According to one aspect of the present invention, the present invention provides a method for screening an antimicrobial agent for a microorganism that causes an odor in an air conditioner comprising the steps of:

(a) Staphylococcus and staphylococcus , the odor-inducing microorganisms in the air conditioning system, warneri ) or a culture thereof;

(b) contacting the microorganism with a sample to be analyzed;

(c) measuring whether the growth of the microorganism is inhibited or the offensive odor is reduced; And

(d) determining that the sample has antimicrobial activity against the microorganism when the growth of the microorganism is inhibited or the occurrence of odor is reduced.

The present inventors have sought to identify microorganisms that live in an air conditioner and cause odor and to find a way to effectively control them. As a result, it was confirmed that 12 kinds of malodorous microorganisms forming the biofilm in the air conditioner were successfully separated and the malodor generated in the air conditioner could be significantly blocked when they were controlled.

In the present specification, the term " air conditioner " is generally used to mean a system for comfortably maintaining temperature, humidity, cleanliness and flow of air in a space partially or entirely separated from the external environment. Preferable examples of the separated space may be an internal space partially or totally separated from the outside such as inside of a building or inside of a vehicle, a railroad, a ship, an aircraft, and the like. A preferable example of the air conditioner is an air conditioner.

In the air conditioner, all the air passing through the blower passes through the eva core, and the condensation condensation phenomenon according to the temperature difference is continued on the surface of the eva core, so that the environment becomes good for the growth of the microorganisms. (Biofilm) is formed. At this time, the microorganisms metabolize various substances in the air, which are indoor and outdoor, as nutrients, and the odor is generated by the volatile organic compounds (mVOCs) generated as a result of metabolism.

Biofilm is a type of community surrounded by microorganisms, which is surrounded by a single membrane. The membrane protects microorganisms from external environment and supplies nutrients. Exopolymeric substances (EPS) are used as constituents of membranes, and they contain various components such as proteins, polysaccharides, polyuronic acids, nucleic acids and lipids. On the surface of EVA cores, various microorganisms proliferate as nutrients, So that the odor is discharged.

The present inventors isolated odor-causing microorganisms from the above-mentioned EVA cores. As a result of culturing these microorganisms, a dominant strain was isolated and cultured among the microorganisms forming the colonies. Methods for isolating and culturing the dominant strains can be carried out by various methods known in the art. For example, dominant microorganisms can be selected through a morphological approach such as dilution ratio, color, size and shape of colonies.

The dominant microorganism micro tumefaciens spp, methyl tumefaciens in the microorganism is Sphingomonas comprises a microorganism of the genus or Staphylococcus spp, preferably a micro tumefaciens spp 2 species (micro tumefaciens Tricot tese fun tikum (Microbacterium trichothecenolyticum) or micro tumefaciens Playa Beth kenseu (Microbacterium flavescens)), 4 jong tumefaciens spp methyl (methyl bacterium Solarium Dankook Enschede (Methylobacterium dankookense), under the bacterium as methyl Solarium Pillows blood (Methylobacterium phyllosphaerae), a bacterium methyl Solarium Tadeom (Methylobacterium tardum) bacterium or a methyl Solarium radio Toledo lance (Methylobacterium radiotolerans)), Sphingomonas spp four kinds (four Sphingomonas Dokdo system (Sphingomonas dokdonensis ), Sphingomonas Ginsenoside free CD Tansu (Sphingomonas ginsenosidimutans), Sphingomonas coves (Sphingomonas humi ) or Sphingomonas Nice Melo (Sphingomonas melonis ) or two microorganisms of the genus Staphylococcus ( Staphylococcus Hominis Sub speaker system hoe varnish (Staphylococcus hominis subsp. Hominis) or Staphylococcus Ren and Li (Staphylococcus warneri ).

These microorganisms were deposited at the Korean Microorganism Conservation Center on Feb. 26, 2013 and assigned the following deposit number: Microbacterium Tricot Teseoliticum HKMC-112 (Accession No: KCCM11395P), micro tumefaciens Plabesque HKMC-104 (Accession No: KCCM11387P), a bacterium methyl Solarium A station HKMC-101 (Accession No .: KCCM11384P), methyl < RTI ID = 0.0 > Under the pillos HKMC-102 (Accession No: KCCM11385P), a bacterium methyl Solarium Tadam HKMC-103 (Accession No .: KCCM11386P), methyl < RTI ID = 0.0 > Radio Tolerance HKMC-111 (Accession No .: KCCM11394P), Sphingomonas Dokdo Nessis HKMC-105 (Accession No .: KCCM11388P), Sphingomonas Jinsenosidymutans HKMC-106 (Accession No .: KCCM11389P), Sphingo Monas Fumi HKMC-107 (Accession No .: KCCM11390P), Sphingomonas Melonness HKMC-108 (Accession No .: KCCM11391P), Staphylococcus Hominis Subspecies Hominis HKMC-109 (Accession No .: KCCM11392P) and Staphylococcus Andrew Lee HKMC-110 (Accession No .: KCCM11393P).

These odor-inducing microorganisms have various industrial usefulness. For example, the present invention can be used to develop a novel antimicrobial agent capable of inhibiting the growth of the microorganism, and to develop a fragrance for blocking offensive odors by identifying the chemical properties of the metabolite of the microorganism. In addition, an environment in which the microorganisms can not be habituated in the air conditioner can be prepared in advance to fundamentally remove the cause of the odor.

The sample used in the antibiotic screening method of the present invention is to confirm whether or not the microorganisms have antimicrobial activity. For example, if a particular sample is Staphylococcus And Having the antimicrobial activity in Ren Li, the sample is Staphylococcus And it can be screened as a biocide for Rene Lee.

The antimicrobial agent determined by the screening method of the present invention preferably has antimicrobial activity against Staphylococcus and Renerie, and more preferably, it may have antimicrobial activity against other microorganisms in addition to the above microorganisms.

For example, some antimicrobial agents may have antimicrobial activity against all of the 12 microorganisms, and other antimicrobial agents may have no antimicrobial activity against one or some species. In addition, the antimicrobial activity of antimicrobial agents having antimicrobial activity against all of the above 12 types of microorganisms may vary depending on the type of each microorganism (see Tables 8 and 9).

According to a preferred embodiment of the present invention, the antibacterial agent identified by the screening method of the present invention is Staphylococcus Andrew Lee HKMC-110 (Accession No .: KCCM11393P).

According to a preferred embodiment of the present invention, the sample to be screened includes a mixture of a biological compound, a compound and a biological preparation containing genetic information such as a mixture of a single compound and a compound, an extract of an animal or a plant, a nucleotide, a polypeptide and the like.

According to another aspect of the present invention, there is provided a malodor generating microorganism in an air conditioner.

The odor-inducing microorganism is preferably a staphylococcus And more preferably, Staphylococcus deposited with Deposit No. KCCM11393P Andrew Lee HKMC-110.

According to still another aspect of the present invention, there is provided a method for inhibiting the growth of an odor-inducing microorganism in an air conditioner, comprising the step of applying or spraying an antibacterial agent in an air conditioner.

Antibacterial agents available in the present invention include Staphylococcus Lee and Ren or all of the antibacterial agent in, or can be identified as having an antibacterial activity against the microorganisms may be applied including the same. The antimicrobial agent is applied or sprayed in an air conditioner to produce odor-causing staphylococcus And the like. The application or spraying may be carried out in various forms known in the art, such as suspensions in the form of gas phase, liquid phase, gel phase or solid suspension.

Further, the application or injection may be carried out over part or all of the inner surface or the inner structure of the air conditioner, and is preferably applied or sprayed onto the eva core in the air conditioner. Inhibition of the above-mentioned growth has already been reported in the case of Staphylococcus Andrew Lee Or microorganisms or coated or sprayed in a state forming a bio-film containing the same, Staphylococcus And / or microorganisms containing the same may be applied or sprayed to prevent growth before the biofilm is formed.

Eva cores usable in the present invention include all materials that can be used as EVA cores, preferably made of aluminum, an aluminum alloy, copper, or a copper alloy.

According to still another aspect of the present invention, there is provided a method for removing odor in an air conditioner, comprising the step of applying or spraying an antibacterial agent in an air conditioner.

The smell removal of the present invention includes removal of all or a part of the smell, and includes coating or spraying before the generation of the malodor in order to prevent the smell.

Various microorganisms are growing in the air conditioner, and these microorganisms can be classified into microorganisms that cause bad odors and microorganisms that do not cause bad odors. Therefore, when the antimicrobial agent specifically acts only on the microorganisms causing the malodor, or has the growth inhibitory activity on all or a part of the dominant species among the microorganisms causing the malodor, the malodor of the air conditioner may be completely or partially removed or improved .

According to another aspect of the invention there is provided a Staphylococcus odor-causing microorganisms in the air conditioner And separating or killing the wreathery from the air conditioner.

Separation or death of the present invention can be carried out by physical, chemical and biological methods in whole or in part of the microorganism or the microorganism containing the microorganism. As a physical method, the microorganism or the microorganisms including the microorganism can be artificially separated or killed by using a physical device. In chemical methods, the microorganism or the microorganisms containing the microorganism can be artificially separated or killed using an antibacterial or fungicide. And the biological method may be separated or killed by using a biological agent toxic to the microorganism or other microorganisms competing for survival with the microorganism, but the present invention is not limited thereto.

According to still another aspect of the present invention, there is provided a method for removing odor in an air conditioner, comprising the step of suppressing the growth of Staphylococcus and Reneri , which are odor-inducing microorganisms, in the air conditioner.

The features and advantages of the present invention are summarized as follows:

(i) The present invention provides a microorganism causing an odor in an air conditioner.

(Ii) The present invention also provides a method for screening an antimicrobial agent capable of controlling the microorganism.

(Iii) In addition, the present invention provides a method for controlling the microorganisms to remove the odor in the air conditioner.

(Iv) The odor-inducing microorganisms in the air conditioning system of the present invention can be used for developing a new antimicrobial agent or developing a fragrance for blocking offensive odors by identifying the chemical properties of the metabolites of the microorganism. Further, the present invention has various industrial advantages such as being capable of being used in an air conditioner to preliminarily prepare an environment in which the microorganism can not be inhabited and to fundamentally remove the cause of the odor.

1 is a photograph showing a specimen sampled from an eva core of a malodorous used car.
FIG. 2 is a diagram illustrating a method of testing an antimicrobiality according to the present invention.
FIG. 3 is a view showing a state where a combination of high-purity odorless microorganisms is cultured using an aluminum pin, which is a material of Eva core.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

Example

Example 1: Selection of the odor-causing dominant microorganisms

1. Securing odor vehicle and separation of air conditioner

The inventors of the present invention have found 10 kinds of used cars that smell bad odors in season (winter season: 2-3 months, summer season: 6-7 months) in order to identify the cause of odor generated in an enclosed environment such as a car interior (Fig. 1). Fig. 1 (a) is a graph showing the results of the experiment. Fig. 2 (a) is a graph showing the relationship between the biofilm and the biofilm.

No. Vehicle mileage season One 89,000 km Winter season
(2-3 months) 2 70,000 km 3 10,300 km 4 37,100 km 5 149,970 km 6 35,000 km Summer
(June-July) 7 28,000 km 8 42,000 km 9 110,000 km 10 90,000 km

2. Eva Core  Sample Sampling

The EVA core obtained from the used odors 1 to 10 was refrigerated at 4 ° C. until the EVA core sample was used, and then sealed with a polyethylene bag. In order to isolate and cultivate the microorganisms, 5 g of each sample was collected using a sterilized long nose plier at an arbitrary site including the front part and the rear part of each EVA core (FIG. 1).

3. Microbial Tally

The elimination of the microorganism from the sample collected from the EVA core proceeded through the following procedure:

① Mix the samples extracted from Eva core and put them in a stirrer.

② Add sterilized 1 × PBS (Phosphate Buffed Saline) (200 ml) to the agitator.

③ Mixed sample and PBS are stirred for 30 seconds.

④ Place the stirrer in ice for 1 minute.

⑤ Repeat steps 3 to 4 above twice.

⑥ Centrifuge the suspension at 13,000 rpm for 3 minutes at 4 ° C.

⑦ Take only the supernatant and transfer it to a new tube.

⑧ Wet the sterilized cotton swab with the supernatant and wipe the surface of the Eva core sample several times.

⑨ The wiped swab should be vortexed with only the head part in the supernatant.

⑩ Mix the precipitate obtained in ⑥ above with the mixture ⑨ and use it as the inoculum solution.

The above processes (1) to (10) were physically removed from the EVA cores mounted on the vehicle types 1 to 10 to isolate the microorganisms.

4. Separation of odor-inducing microorganisms and selection of dominant species

The separation of airborne germs is generally accomplished by heterotrophic culture of aerobic heterotrophic bacteria, commonly referred to as general germs. The bacterial isolates were cultured for 14 days at 28-30 ℃ using PTYG agar medium and R2A agar medium (PTYG agar medium was 0.25 g (Difco), 0.25 g (Difco), 0.2 g of Tryptone and 0.5 g of Yeast extract (Difco), Glucose 0.5 g (Difco), MgSO ₄ 30 mg (Sigma), CaCl ₂ 3 mg (Sigma) and Bacto agar 15 mg (Difco) were added to 980 ml of distilled water and adjusted to pH 7.0. The R2A agar medium was used as a yeast extract 0.5 g (Difco), 0.5 g of Proteose peptone No. 3 (Difco), 0.5 g of casamino acids (Difco), 0.5 g of Dextrose (Difco), 0.5 g of Soluble starch ), Sodium pyruvate 0.3 g (Difco), Dipotassium sulfate 0.3 g (Difco), Magnesium sulfate 0.05 g (Difco) and Bacto agar 15 g (Difco) were added to 980 ml of distilled water and the pH was adjusted to 7.2 After sterilization of Kanamycin, Ampicillin and Chloramphenicol at a concentration of 100 ppm, the medium temperature was 50 ℃. To prepare an antibiotic culture medium.

In order to separate and cultivate the dominant strains, several dominant strains were selected through a morphological approach such as dilution ratio, colony color, size and shape.

Separation Separate fungi and bacteria from the culture medium.

② Inoculate various bacterial strains of different morphology into a complex medium using a loop and isolate them pure.

③ Select the best growth medium among the inoculated medium and subculture.

④ The mold is separated from the end of the hypha using scalpel and then inoculated into the complex medium.

⑤ Select the medium that has the best growth among the medium inoculated with the fungal strain and subculture.

5. Dominance  Identification of microorganisms

For accurate identification of the isolated microorganism, 16s rRNA identification including the following steps was performed.

a) REP - PCR  Through pattern analysis Fingerprints investigation

REP-PCR is a molecular biologic method for analyzing the structure of bacterial chromosomes. It is a fingerprinting method that distinguishes each bacterial strain from other bacteria. To perform REP-PCR, genetic characteristics were analyzed according to the following procedures.

(One) Cell lysis  step

1) Transfer 2.5 μl of Lyse-N-Go PCR Reagent (Thermo) into PCR tube.

② Pipet the colonies on a clean bench and pipet into the upper tubes. Be careful not to get enough amount of solution to pour.

③ Cultivate in PCR machine according to manufacturer's instructions.

(2) PCR reaction

Using the components listed in Table 2 below, pre-denaturation was carried out at 93 ° C for 7 minutes, denaturation at 92 ° C for 1 minute and annealing at 51.5 ° C And denaturation, cooling, and extension at 65 ° C for 8 minutes in an extension step were repeated 33 times to perform PCR amplification.

1) dNTP (2.5 mM each) 12.5 μl ② Gitschier buffer 5.0 μl ③ DMSO (100%) 2.5 μl ④ Autoclaved 3 ^o DW 0.3 μl (5) BOXA1R primer (50 pmole / l)
5'CTACGGCAAGGCGACGCTGACG 1.0 μl ⑥ BSA (10 mg / ml) 0.4 μl ⑦ Bacterial DNA 2.5 μl ⑧ Taq polymerase (Roche) (5 U / ㎕) 0.8 μl

step 1 93 ℃ 7 min step 2 92 ° C 1 min step 3 51.5 DEG C 1 min step 4 65 ℃ 8 min step 2,3,4: additional 33 cycles step 6 65 ℃ 16 min step 7 4 ℃

(3) Come 전공기

The DNA fragments amplified by each PCR were taken and 1.2 - 1.5% agarose gel with EtBr was used and 6 x dye was mixed with sample in 1: 5 ratio and as much as possible. Since most PCR products were between 100-1000 bp, a 100 bp ladder was loaded together and electrophoresed as slowly as possible (50 V) between the bromophenol blue and xylene cyanol dye to the middle of the entire gel. The same strain of the same DNA pattern on the gel was regarded as the same strain.

b) Air conditioning Dominance  16S of bacteria rRNA  Identification through gene analysis

The 16S rRNA (ribosomal ribonucleic acid) gene is used to identify bacterial genomic clusters and can be identified at the genus and species level of bacteria classified by REP-PCR.

(One) Cell lysis  step

① Transfer 5 μl of Lyse-N-Go PCR Reagent (Thermo) into PCR tube.

② Pipet the colonies on a clean bench and pipet into the upper tubes. The amount of the solution should be such that the solution becomes slightly cloudy.

③ Lysate in PCR machine according to manufacturer's instructions (Table 4).

Lysis Program Cycle Temperature (° C) Time (seconds) One 65 30 2 8 30 3 65 90 4 97 180 5 8 60 6 65 180

(2) 16S rRNA  gene PCR

PCR conditions (Total 50 ㎕): The remaining solutions except for DNA and Taq were mixed as necessary as shown in Table 5 below, and 44.5 ㎕ was added to the above lysis solution. Denaturation at 94 ° C for 1 minute, denaturation at 94 ° C for 1 minute, annealing at 55 ° C for 1 minute, extension step (extension) as described in Table 6, pre-denaturation at 94 ° C for 5 minutes, denaturation at 94 ° C for 1 minute, ) At 72 DEG C for 1 minute and 30 seconds, and denaturation, cooling and extension steps were performed 29 times to perform PCR amplification.

Autoclaved 3 ^o DW 22 μl 10xbuffer (Roche) 5 μl dNTP (Roche, 2.5 mM) 5 μl DMSO 5 μl BSA (10 mg / ml) 2.5 μl 27 mf (20 pmoles / l) 2.5 μl 1492 r (20 pmole / l) 2.5 μl DNA 5 μl Taq (Roche) 0.5 μl

step 1 94 ° C 5 min step 2 94 ° C 1 min step 3 55 ° C 1 min step 4 72 ℃ 1 min 30 sec Go to step 2: additional 29 cycles step 6 72 ℃ 10 min step 7 4 ℃ hold

(3) PCR 정화

The 16S rRNA gene PCR product was purified using the Qiaquick PCR purifcation kit according to the following procedure.

① Put 5 times PB buffer of PCR product.

② Divide the mixed solution in the QIAquick column.

③ Centrifuge for 1 minute to bind DNA and remove the mixed solution.

④ Add 750 μl of PE buffer to the QIAquick column for wash, centrifuge for 1 minute and remove the mixed solution.

⑤ Centrifuge again for 1 minute.

⑥ Move the QIAquick column to a new tube.

⑦ To extract DNA, add 30 μl of EB buffer and leave for 1 minute.

⑧ Centrifuge for 1 minute to collect the DNA dissolved in EB in the tube.

As a result of the above-mentioned experiment, in order to confirm whether or not the odor of the purely isolated microorganisms was generated, the sensory evaluation was carried out by culturing in the following manner:

① Pure separation Separate the cultured microorganisms into liquid nutrient medium.

② The inoculated medium is incubated at 28 ℃ for 5-7 days.

③ Inoculate the solid nutrient medium with 100 ㎕ of cells cultured in liquid medium.

④ Spread the inoculated cells evenly using a spreader.

⑤ Seal the Petri dishes and incubate at 28 ℃ for 10 days.

The sensory evaluation was carried out using a panel of seven persons, and the odor-causing microorganisms were selected using the average value after evaluating the odor intensity using the 5-point scale method. Through identification of the 16S rRNA gene, 12 And they were deposited at the Korean Microorganism Conservation Center on February 26, 2013.

Accession number of 12 kinds of odor-causing microorganisms No. Identification number Microorganism name Accession number One HKMC-101 Methyl bromide A station
( Methylobacterium dankookense ) KCCM11384P 2 HKMC-102 Methyl bromide Under the pillos
( Methylobacterium phyllosphaerae ) KCCM11385P 3 HKMC-103 Methyl bromide Tadam
( Methylobacterium tardum ) KCCM11386P 4 HKMC-104 Microbacterium Plabesque
( Microbacterium flavescens ) KCCM11387P 5 HKMC-105 Sphingo Monas Dokdo Nessis
( Sphingomonas dokdonensis ) KCCM11388P 6 HKMC-106 Sphingo Monas Jinsenosidymutans
( Sphingomonas ginsenosideimutans ) KCCM11389P 7 HKMC-107 Sphingo Monas Fumi
( Sphingomonas humi ) KCCM11390P 8 HKMC-108 Sphingo Monas Melonness
( Sphingomonas melonis ) KCCM11391P 9 HKMC-109 Staphylococcus Hominis Subspecies Hominis
( Staphylococcus hominis subsp . hominis ) KCCM11392P 10 HKMC-110 Staphylococcus Andrew Lee
( Staphylococcus warneri ) KCCM11393P 11 HKMC-111 Methyl bromide Radio Tolerance
( Methylobacterium radiotolerans ) KCCM11394P 12 HKMC-112 Microbacterium Tricot Teseoliticum
( Microbacterium trichothecenolyticum ) KCCM11395P

Example  2: Evaluation of antibacterial activity against selected odor-inducing microorganisms

1. Experimental process

The present inventors evaluated antimicrobial activity against the dominant microorganisms selected in Example 1 using various commercially available antimicrobial agents. The antibacterial agents used in the present invention are as follows:

A Antimicrobial agent: Fiber deodorant purchased from Korea PENG Corporation

B Antimicrobial agent: Hand cleaning agent purchased from Paru Co., Ltd.

C Antimicrobial agent: Mass production antimicrobial agent containing 45 to 50% of methyl alcohol, 1 to 5% of chromium sulfate (CAS 10101-53-8), 1 to 5%

D Antimicrobial agent: Cationic antimicrobial agent (Parkarizing, Japan)

E Antimicrobial agent: An isothiazolin antimicrobial agent (Parkarizing, Japan) containing methylisothiazolinone (CAS 26172-55-4), bronopol (CAS 52-51-7)

The evaluation of antibacterial activity was carried out through the following steps:

① Preparation of sterilized filter paper

② Preparation of 5 kinds of antimicrobial agents (Control group: no antimicrobial agent, experimental group: antimicrobial agent A, antimicrobial agent B, antimicrobial agent C, antimicrobial agent D and antimicrobial agent E)

③ Put filter paper in antibacterial agent

④ Apply each odor-inducing microorganism to the nutrient medium

⑤ Put the filter paper containing each antimicrobial agent in the nutrient medium to which odor-inducing microorganism is applied

⑥ Culture at 28 to 30 ℃ for 5 days

⑦ Measurement of growth inhibition zone

The growth inhibition zone was measured by using a vernier caliper to measure the diameter of the growth inhibition zone. The specific method is as shown in FIG.

2. Experimental results

The results of measuring the diameter of the growth inhibition zone for 12 kinds of odor-inducing microorganisms through the above method are shown in Table 8 below.

Diameter of growth inhibition zone (unit: mm) No . Microorganism name ( Depositor ) Antimicrobial agent  No A B C D E One Methylobacterium dankookense HKMC-101 0 18.3 22.3 27.3 29.5 36.1 2 Methylobacterium phyllosphaerae HKMC-102 0 18.3 11.6 35.3 47.3 45.3 3 Methylobacterium tardum HKMC-103 0 0 0 0 43 38.3 4 Microbacterium flavescens HKMC-104 0 19.6 14 28 19.1 33.9 5 Sphingomonas dokdonensis HKMC-105 0 15 11.6 21.7 16.2 39.1 6 Sphingomonas ginsenosideimutans HKMC-106 0 0 11.3 17.6 21.8 31.1 7 Sphingomonas humi HKMC-107 0 11.6 14.3 22.5 19.1 36.1 8 Sphingomonas melonis HKMC-108 0 17 11 31.6 22.6 37.3 9 Staphylococcus hominis subsp . hominis HKMC-109 0 0 0 25.6 28.6 54 10 Staphylococcus warnery HKMC-110 0 0 0 33.3 17 38.6 11 Methylobacterium radiotolerans HKMC-111 0 17.6 0 23.3 28.1 31 12 Microbacterium trichothecenolyticum HKMC-112 0 19 18.3 20.6 18.5 32.3

The antimicrobial activity of the cationic antimicrobial agent (antimicrobial agent D) and the isothiazoline antimicrobial agent (antimicrobial agent E) in comparison with the massive antibacterial agent (antimicrobial agent C) is shown in Table 9 below.

Comparison of antimicrobial activity between cationic antibiotics and isothiazolesin antimicrobials compared to mass-produced antimicrobials No . Microorganism name ( Depositor ) Antimicrobial agent  D Antimicrobial agent  E One Methylobacterium dankookense HKMC-101 8.1% 32.2% 2 Methylobacterium phyllosphaerae HKMC-102 34% 28.3% 3 Methylobacterium tardum HKMC-103 43% 38.3% 4 Microbacterium flavescens HKMC-104 -31.8% 21% 5 Sphingomonas dokdonensis HKMC-105 -25.3% 80.1% 6 Sphingomonas ginsenosideimutans HKMC-106 23.8% 76.7% 7 Sphingomonas humi HKMC-107 -15.1% 60.4% 8 Sphingomonas melonis HKMC-108 -28.5% 18% 9 Staphylococcus hominis subsp . hominis HKMC-109 11.7% 110.9% 10 Staphylococcus warnery HKMC-110 -48.9% 15.9% 11 Methylobacterium radiotolerans HKMC-111 20.6% 33% 12 Microbacterium trichothecenolyticum HKMC-112 -10.2% 56.8%

As shown in Table 8-9, in the case of the antimicrobial agent A, methyl bromide Tadam , Sphingo Monas Jinsenoshidimutansu , Starpirokokusu Hominis Subspecies Hominis And Staphylococcus In case of Antimicrobial agent B, unlike antimicrobial agent A , sphingomonas Jin, but the antibacterial activity with respect to non-ginsenoside CD Tansu, bacterium methyl Solarium And did not exhibit any antibacterial activity against Radio Tolerance .

In the case of the antibacterial agent C, methylobacterium It was confirmed that the antibacterial agents D and E exhibited antibacterial activity against all of the above 12 kinds of microorganisms. However, in the case of antibiotics D micro tumefaciens Playa Beth kenseu, Sphingomonas Dokdo your system, Sphingomonas coves, Sphingomonas Melonness , staphylococcus Warren Lee and Microbacterium Tricot tese fun of the antimicrobial activity of the antimicrobial agent tikum showed rather than falling C. Even if it is a microorganism belonging to the genus Methylobacterium, the antimicrobial agent E is methyl bromide A station And methyl < RTI ID = 0.0 & Antotuberculosis agent D is more effective than antimicrobial agent E in methylotrophic bacteria Under the pillos And methyl < RTI ID = 0.0 & The antimicrobial activity was more specific than the other antimicrobial agents.

Example  3: odor-inducing microorganism removed On Eva Core  Odor evaluation for

The present inventors have also found that a combination of odorless microorganisms other than the malodorous microorganisms of Example 1 among the dominant microorganisms living in the eva cores in order to reproduce the eva cores in which the bad odor microorganisms are removed or separated is referred to as an aluminum pin (Table 10, Fig. 3).

The odorless microorganisms were selected as the dominant species which did not cause malodour among the microorganisms forming colonies during culturing among the microorganisms in the above Eva core. The culture method was as follows.

① Pure isolation Separately cultivated microorganisms are inoculated into R2A medium.

② The inoculated medium is incubated at 28 ℃ for 5-7 days.

③ Prepare an aluminum pin (sterilized at 121 ℃ for 20 minutes).

④ Immerse each antimicrobial agent so that the surface is evenly coated.

⑤ Place the coated aluminum fins on the Patri dish.

⑥ Discard the supernatant by centrifuging 1 ml of the inoculated microorganism culture.

⑦ Add 1 ml of sterilized 1 x PBS and centrifuge again.

⑧ Repeat ⑦ above twice.

⑨ Add 100 μl of odorless microorganism washed with PBS to the middle of aluminum pin.

⑩ Inoculate on prepared aluminum fin and dry at room temperature.

⑪ Seal the Patry Dish and incubate at 28 ℃ for 1 month.

As a result, it was found that odor was not generated in the combination of Table 10 below one month later.

Deodorant results when cultured ectoparasite microorganisms with deodorant microorganisms removed Combination microbe Odor evaluation after 1 month One Methylobacterium brachiatum Odorless 2 Methylobacterium platani Odorless 3 Methylobacterium aquaticum  + Methylobacterium  platani Odorless 4 Methylobacterium platani  + Methylobacterium brachiatum Odorless 5 Methylobacterium aquaticum  + Methylobacterium  platani + Methylobacterium brachiatum Odorless 6 Methylobacterium aquaticum  + Methylobacterium  platani + Methylobacterium brachiatum  + Acinetobacter johnsonii Odorless 7 Methylobacterium aquaticum  + Methylobacterium  platani + Methylobacterium brachiatum  + Bacillus vietnamensis Odorless 8 Methylobacterium aquaticum  + Methylobacterium  platani + Methylobacterium brachiatum  + Brevibacillus invocatus Odorless 9 Methylobacterium aquaticum  + Methylobacterium  platani + Methylobacterium brachiatum  + Deinococcus ficus Odorless 10 Methylobacterium aquaticum  + Methylobacterium  platani + Methylobacterium brachiatum  + Leifsonia  left Odorless 11 Methylobacterium aquaticum  + Methylobacterium  platani + Methylobacterium brachiatum  + Methylobacterium komagatae Odorless 12 Methylobacterium aquaticum  + Methylobacterium  platani + Methylobacterium brachiatum  + Pseudomonas nitroreducens Odorless 13 Methylobacterium aquaticum  + Methylobacterium  platani + Methylobacterium brachiatum  + Sphingomonas aquatilis Odorless 14 Sphingomonas aquatilis  + Brevibacillus invocatus Odorless 15 Leifsonia left  + Methylobacterium komagatae Odorless 16 Acinetobacter johnsonii  + Sphingomonas aquatilis  + Methylobacterium komagatae Odorless 17 Pseudomonas nitroreducens Odorless 18 Acinetobacter johnsonii  + Pseudomonas nitroreducens Odorless 19 Brevibacillus invocatus  + Acinetobacter johnsonii  + Pseudomonas nitroreducens Odorless 20 Leifsonia left  + Pseudomonas nitroreducens Odorless 21 Brevibacillus invocatus  + Sphingomonas aquatilis  + Pseudomonas nitroreducens Odorless 22 Acinetobacter johnsonii  + Sphingomonas aquatilis  + Pseudomonas nitroreducens Odorless 23 Methylobacterium aquaticum  + Methylobacterium  komagatae + Bacillus vietnamensis  + Deinococcus  ficus Odorless 24 Methylobacterium aquaticum  + Methylobacterium  komagatae + Curtobacterium flaccumfaciens  + Deinococcus apachensis  + Bacillus subtilis subsp . subtilis Odorless 25 Methylobacterium aquaticum  + Methylobacterium  komagatae + Spirosoma linguale  + Sphingomonas  dokdonensis + Leifsonia left Odorless

As a result of the above experiment, when the malodor generating microorganisms in the air conditioner are removed by chemical or physical methods to form only the microorganisms which do not cause malodor, the odor generated in the air conditioner is significantly .

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the present invention. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

Korea Microorganism Conservation Center (overseas) KCCM11384P 20130226 Korea Microorganism Conservation Center (overseas) KCCM11385P 20130226 Korea Microorganism Conservation Center (overseas) KCCM11386P 20130226 Korea Microorganism Conservation Center (overseas) KCCM11387P 20130226 Korea Microorganism Conservation Center (overseas) KCCM11388P 20130226 Korea Microorganism Conservation Center (overseas) KCCM11389P 20130226 Korea Microorganism Conservation Center (overseas) KCCM11390P 20130226 Korea Microorganism Conservation Center (overseas) KCCM11391P 20130226 Korea Microorganism Conservation Center (overseas) KCCM11392P 20130226 Korea Microorganism Conservation Center (overseas) KCCM11393P 20130226 Korea Microorganism Conservation Center (overseas) KCCM11394P 20130226 Korea Microorganism Conservation Center (overseas) KCCM11395P 20130226

Claims (20)

A method for screening an odor-reducing antimicrobial agent in an air conditioner for reducing the odor generated in an air conditioner of St Philo Koccus and René Rai ,
(a) preparing said Staphylococcus and Reneri or a culture thereof;
(b) contacting the sample with the Staphylococcus and Reneri or culture thereof;
(c) measuring inhibition of growth of Staphylococcus and Reneri ; And
(d) when the growth of Staphylococcus and Reneri is inhibited, determining that the sample has an antimicrobial activity to reduce odor in the air conditioner generated by Staphylococcus and Reneri ;
And a method for screening an odor-reducing antimicrobial agent in an air conditioner.
The screening method according to claim 1, wherein the air conditioner is an air conditioner.
The screening method according to claim 1, wherein the Staphylococcus and Renérie form a biofilm on an eva core in an air conditioner to cause malodor.
4. The screening method according to claim 3, wherein the eva core is made of aluminum, aluminum alloy, copper or copper alloy.
2. The screening method according to claim 1, wherein said Staphylococcus and Renerie are Staphylococcus and Renal HKMC-110 (Accession No .: KCCM11393P).
delete The method of claim 1 wherein the antimicrobial agent is Staphylococcus hoe Nice Nice screening rake sub speaker system characterized in that additionally holding the antimicrobial activity of the (Staphylococcus hominis subsp. Hominis).
The method of claim 7, wherein the Staphylococcus hoe varnish sub speaker system hoe Nice Nice Staphylococcus hoe sub-speaker system hoe varnish HKMC-109 (Accession No: KCCM11392P) a screening method characterized in that the.
delete The method of claim 1 wherein the antimicrobial agent is additionally a micro tumefaciens tricot tese fun tikum (Microbacterium trichothecenolyticum) and micro tumefaciens Plastic bath kenseu antimicrobial activity against micro tumefaciens spp least one selected from the group consisting of (Microbacterium flavescens) Or the like.
11. The method of claim 10, wherein the microbacterium Spp micro tumefaciens tricot tese fun tikum HKMC-112 (Accession No: KCCM11395P) and micro tumefaciens Plastic bath kenseu HKMC-104 (Accession No: KCCM11387P) a screening method characterized in that at least one selected from the group consisting of.
The method of claim 1 wherein the antimicrobial agent is Sphingomonas islets four cis (Sphingomonas dokdonensis), Sphingomonas ginsenoside CD-free Tansu (Sphingomonas ginsenosidimutans), Sphingomonas inlets (Sphingomonas humi) and Sphingomonas Mello varnish (Sphingomonas melonis Wherein the microorganism further has an antimicrobial activity against at least one microorganism belonging to the genus Sphingomonas selected from the group consisting of < RTI ID = 0.0 >
The method of claim 12, wherein the Sphingomonas in the microorganism Sphingomonas islets four cis HKMC-105 (Accession No: KCCM11388P), Sphingomonas ginsenoside CD-free Tansu HKMC-106 (Accession No: KCCM11389P), Sphingomonas trailing HKMC-107 (Accession No: KCCM11390P) and Sphingomonas Mello varnish HKMC-108 (Accession No: KCCM11391P) a screening method characterized in that at least one selected from the group consisting of.
The antimicrobial agent according to claim 1, wherein the antibacterial agent is selected from the group consisting of Methylobacterium dankookense, Methylobacterium phyllosphaerae, Methylobacterium radiotolerans, (Methylobacterium tardum) . ≪ RTI ID = 0.0 > 21. < / RTI >
15. The method of claim 14, wherein the methylobacterium Spp are methyl tumefaciens Dankook Enschede HKMC-101 (Accession No: KCCM11384P), under the bacterium as methyl Solarium Pillows blood HKMC-102 (Accession No: KCCM11385P), bacterium methyl Solarium radio Toledo lance HKMC-111 (accession number: KCCM11394P) and Methylobacterium tumeum HKMC-103 (Accession No .: KCCM11386P).
delete delete delete delete delete

Images