KR101589193B1 - Primer set for detecting Staphylococcus pasteuri and detecting method using the same - Google Patents

Abstract

The present invention is concerned only species-specific detection using the primer pair, and relates to a detecting method using the same, and more particularly Staphylococcus (Staphylococcus) in Staphylococcus Pas Terry (Staphylococcus pasteuri) of species (species) belonging to the (genus) And a method for detecting Staphylococcus pastyeri using the primer pair. By using the primer pair according to the present invention, it is expected that Staphylococcus pastilleri can be species-specifically detected in a short time with excellent efficiency and can be used in various fields such as agricultural products or medicine fields.

Description

TECHNICAL FIELD The present invention relates to a primer pair for detection of Staphylococcus species,

The present invention relates to a primer for detecting Staphylococcus pastyeri, and a method for detecting Staphylococcus pastilleri contained in agricultural products, etc. using the primer.

Staphylococcus is a microorganism called Staphylococcus or Staphylococcus. It is widely distributed in nature and normally exists in the skin, mucous membrane, upper urinary tract, urinary tract, digestive system of healthy person, However, it can easily infect the human body through the skin wound or respiratory tract. Various species belonging to the genus of the Staphylococcus genus often cause serious illnesses, especially those present in fresh vegetables and foods, which can lead to food poisoning if ingested by foodstuffs contaminated with Staphylococcus do.

In particular, Staphylococcus pasteuri is a gram-positive bacterium belonging to the Staphylococcus genus. Beta-toxin, and is present in animals and in the surrounding environment including humans. Staphylococcus pasteuris causes sepsis, food poisoning, and the like.

Therefore, many attempts have been made to identify bacteria including Staphylococcus, among which the 16S rRNA PCR method, which amplifies the 16S ribosome region of all bacteria and analyzes the base sequence of the amplified product, to be. However, since 16S rRNA PCR takes a long time to analyze the nucleotide sequence, it is difficult to expect a rapid result.

Therefore, in recent years, Streptococcus Im (Streptococci) of the Gram-positive bacteria to complement existing identification methods, Enterobacter nose Im (Enterococci), Staphylococcus Im exceeds presence of manganese, which depends (Staphylococci) oxide or the like in the disproportionation enzyme (manganese- dependent superoxide dismutase, sod A) primer pairs based on the gene site.

However, Staphylococcus has a high sod A homology between species, and it is difficult to detect only Staphylococcus pastilleri species-specifically.

Therefore, object of the present invention is Staphylococcus (Staphylococcus) in Staphylococcus Pas Terry of species (species) belonging to the (genus) (Staphylococcus The present invention also provides a pair of primers for detecting starch in a short period of time, and a method for detecting Staphylococcus pastilleri using the same.

The invention as above to achieve the same object, the present invention is Terry Staphylococcus Paz, including PA237 pair of primers represented by the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2 in an aspect (Staphylococcus pasteuri ).

The primer pair provided in the present invention was developed so that only Staphylococcus pasteuri could be detected species-specifically by PCR (see Table 2), and the primer pair was introduced into a genus other than the genus Staphylococcus (See Table 4, Fig. 4), and even when they are mixed with other species belonging to the genus Staphylococcus, only Staphylococcus pastilleri is specifically detected (See Table 2, Fig. 2). In addition, belonging to Staphylococcus species can be effectively detected regardless of the specific strain (see Table 3, FIG. 3).

In addition, the primer pair according to the present invention was constructed to amplify the manganese-dependent superoxide dismutase ( sod A) gene of Staphylococcus sp. Manganese-dependent superoxide dismutase ( sod A) It is possible.

The PA237 F primer represented by the nucleotide sequence of SEQ ID NO: 1 is a forward primer and the PA237 R primer represented by the nucleotide sequence of SEQ ID NO: 2 is a reverse primer.

In the context of the present invention, the term "primer" refers to a single-stranded oligonucleotide sequence complementary to the nucleic acid strand to be copied, and may serve as a starting point for the synthesis of the primer extension product. In the design of the primer, there are various restrictions such as the ratio of A, G, C and T content of the primer, prevention of formation of primer complexes (dimer) and prohibition of repeating the same base sequence three times or more. template, the amount of DNA, the concentration of the primer, the concentration of dNTP, the concentration of Mg ^{2 +} , the reaction temperature, and the reaction time.

The primer pair according to the present invention may also include a base sequence in which one or more bases have been deleted, substituted or added to the base sequences shown in SEQ ID NOS: 1 and 2. Further, the primer pair according to the present invention may include additional features that do not change the basic properties. That is, the base sequence can be modified using many means known in the art. Examples of such modifications include, but are not limited to, methylation, capping, substitution of one or more nucleotides into nucleotides, and uncharged linkages such as phosphonates, phosphotriesters, phosphoramidates or carbamates, phosphorothioates or phosphorodithioates Or the like can be transformed into a charged nucleus. The nucleic acid may be at least one of a protein such as a nuclease, a toxin, an antibody, a signal peptide, a poly-L-lysine, an intercalating agent such as acridine or psoralen, a chelating agent such as a metal, a radioactive metal, And may have additional covalently bonded moieties.

In addition, the base sequence of the primer pair according to the present invention can be modified using a label capable of directly or indirectly providing a detectable signal. The primer pair may comprise a label that can be detected using spectroscopic, photochemical, biochemical, immunochemical or chemical means. Useful markers include ³² P, fluorescent dyes, electron dense reagents, enzymes (that is generally used in ELISAS), biotin, or haptens and proteins or antiserum possible the monoclonal antibodies used.

The primer pairs according to the present invention can be obtained by cloning and restriction cleavage of appropriate sequences and digestion with diethylphosphate such as the phosphotriester method of Narang et al. (1979, Meth, Enzymol. 68: 90-99), Beaucage Can be chemically synthesized using any other well-known method including direct chemical synthesis methods such as the pamoate method (1981, Tetrahedron Lett. 22: 1859-1862), and the solid support method of U.S. Patent No. 4458066 .

When the amplification reaction is performed using the primer pair according to the present invention, the target sequence, that is, the sod A gene can be amplified. Methods for amplifying a target nucleic acid include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification system, Strand displacement amplification or amplification through a replicase or any other suitable method for amplifying nucleic acid molecules known in the art are possible.

Among them, "polymerase chain reaction (PCR)" is a method of amplifying a target nucleic acid from a pair of primers that specifically bind to a target nucleic acid using a polymerase. Such PCR methods are well known in the art, and commercially available kits may be used.

In the present invention, the amplified target sequence may be labeled with a detectable labeling substance. In one embodiment, the labeling material can be, but is not limited to, a fluorescent, phosphorescent or radioactive substance. When the radioactive isotope such as 32P or 35S is added to the PCR reaction solution, the amplification product is synthesized and the radioactivity is incorporated into the amplification product, so that the amplification product can be labeled as radioactive.

The present invention provides, in another aspect, a PCR kit for detecting Staphylococcus pastyeri, comprising a composition for detecting Staphylococcus pastoris comprising a pair of PA237 primers represented by the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2 .

The kit may further include reagents for DNA extraction, amplification, and product detection, and instructions thereto, as well as, but not limited to, the primer pair. For example, a DNA extraction reagent, a deoxynucleotide, a reagent necessary for performing a DNA amplification reaction, a thermostable DNA polymerase, a buffer, and dNTP may be included. The primer pair and the reagents for DNA extraction, amplification and product detection can be provided in a plastic tube in a lyophilized state.

In another aspect, the present invention provides a PCR method for detection of Staphylococcus pasteuria using a pair of PA237 primers represented by the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2.

More specifically, 1) extracting the DNA of the analysis sample; 2) performing PCR from the DNA of step 1) using the primer pair; and 3) separating the PCR product of step 2) by electrophoresis to identify the PCR product.

The sample Staphylococcus Pas Terry It can contain all doubt that the inclusion of (Staphylococcus pasteuri), for example, Staphylococcus Pas Terry (Staphylococcus pasteuri itself, an agricultural commodity expected to contain Staphylococcus pasteuri, Staphylococcus pasteuri ), human-containing animal-derived tissue expected to be infected, and the like.

The qualitative analysis in the step 3) can be confirmed by the electrophoresis as to whether or not the staphylococcus pasteuris is included in the sample through the band size of the PCR product.

With the primer pairs of the present invention, Staphylococcus (Staphylococcus) in Staphylococcus Pas Terry of species (species) belonging to the (genus) (Staphylococcus pasteuri can be detected within a short period of time at a species-specifically excellent efficiency.

Figure 1 shows a schematic diagram of a Staphylococci sod A gene.
Figure 2 shows the PCR results of Staphylococcus species. Each number refers to the microorganism shown in Table 2.
FIG. 3 is a schematic view of Staphylococcus pasteuri ). Each number refers to the microorganism shown in Table 3.
Figure 4 shows PCR results of strains belonging to various genus. Each number refers to the microorganism shown in Table 4.

Hereinafter, preferred embodiments of the present invention will be described in order to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the examples.

Example  1. Genome DNA  ( gDNA )

The microorganisms of the food glass were cultured in the culture medium and centrifuged at 13,000 rpm for 1 minute using a TOMY MX-301 centrifuge (TOMY KOGYO Co., Tokyo, Japan) for the isolation of genomic DNA. Subsequently, genomic DNA was isolated according to the manufacturer's instructions using the G-spin ™ Genomic DNA Extraction Kit (iNtRON Biotechnology Inc., Seongnam, Korea). The purity of the separated genomic DNA was measured by determining the A 260 / A 280 ratio using a spectrophotometer (UV-1601 Spectrophotometer Shimadzu, Japan). Genomic DNA with the A 260 / A 280 ratio greater than 1.8 was selected and the optical density was measured at 260 nm.

Example  2. PCR Implementation of

Example  2-1. Staphylococcus Pastry ( Staphylococcus pasteuri ) Specific Primer pair  making

Based on the nucleotide sequence of the manganese-dependent superoxide dismutase ( sod A) gene region of Staphylococcus pasteuria (Genbank Accession No. AJ343953, Genbank Accession No. AJ343920) (SEQ ID NO: 1: 5'-GCTAATTTAGACAGTGTACCTTCTG-3 ') and a reverse primer PA237-R (SEQ ID NO: 2: 5'-GCCCGTTATTTACTACTAACCA-3') were constructed. These primer pairs specifically recognize the Staphylococcus paclitaxel sodA gene. The size of the PCR amplification product using these primer pairs is 237 bp and the Tm is 61 ° C (Table 1).

Strain Primer Sequence (5'-3`) size (bp) Tm
(° C) Staphylococcus pasteuri PA237 F GCTAATTTAGACAGTGTACCTTCTG 237 61 PA237 R GCCCGTTATTTACTACTAACCA

Example  2-2. making Primer pair  Identification of Species Specificity

(One) Staphylococcus  genus( genus ) Of various species belonging to species ) PCR

Using the primer pairs in Table 1 above, the species belonging to the genus Staphylococcus corresponding to the following Table 2 were named C1000 PCR was performed using a thermocycler (Bio-Rad Laboratories, Inc., CA, USA) and each reaction was confirmed using the Maxime PCR Premix Kit (i-starTaq) (iNtRON Biotechnology, Seongnam, Korea).

number strain One S. aureus ATCC 29213 2 S. capitis KACC 13242 3 S. caprae KACC 13251 4 S. carnosus KACC 13250 5 S.chromogenes KACC 13248 6 S.cohnii KACC 13237 7 S. epidermidis KACC 14822 8 S.equorum S-14 9 S. haemolyticus KACC 132389 10 S. pettenkoferi S-19 11 S. saprophyticus KACC 13235 12 S. simulans KACC 13241 13 S. warneri KACC 10785 14 S. xylosus KACC 13239 15 S. pasteuri KACC 13185

More specifically, 30 μl of the PCR reaction mixture containing the primer pair (10 pM) of Table 1 and the gDNA (100 ng) of each microorganism of Table 2 was denatured at 95 ° C for 5 minutes, 1 minute. 30 cycles were performed with one cycle at 61 ° C for 1 minute and 72 ° C for 30 seconds, followed by reaction at 72 ° C for 5 minutes. 10 μl of the obtained PCR product was mixed with Loading STAR (DyneBio Inc., Seongnam, Korea) at a volume ratio of 5: 1, electrophoresed on a 2% agarose gel, and the result was confirmed with a UV transilluminator. 2. That is, the results of PCR and electrophoresis on the microorganism list of Table 2 are shown in FIG. 2 indicate the microorganisms shown in Table 2, and the ladder used is a 100 bp DNA Ladder (Bioneer, Daejeon, Korea).

As a result, it was found that the primer pair in Table 1 amplified only when Staphylococcus pasteuri pathogens were included (No. 15 in Table 2, No. 15 in FIG. 2). That is, from the electrophoresis result of FIG. 2, it was found that the primer pair (PA237 F / PA237 R) of the present invention specifically amplified only Staphylococcus pasteuri pathogens.

(2) Staphylococcus Pastry ( Staphylococcus pasteuri) on  For the various strains belonging to PCR

Using the primer pairs shown in Table 1, various strains belonging to Staphylococcus pasteuri corresponding to the following Table 3 were cloned into C1000 PCR was performed using a thermocycler (Bio-Rad Laboratories, Inc., CA, USA) and each reaction was confirmed using the Maxime PCR Premix Kit (i-starTaq) (iNtRON Biotechnology, Seongnam, Korea).

number strain One Staphylococcus pastuer S-34 2 Staphylococcus pastuer S-35 3 Staphylococcus pastuer SS-1 4 Staphylococcus pastuer SS-32 5 Staphylococcus pastuer KACC 13185

More specifically, the microorganisms of Table 3 were subjected to PCR and electrophoresis in the same manner as in (1) above.

As a result, as shown in Fig. 3, the primer pair (PA237 F / PA237 R) in Table 1 was found to be 5 kinds of Staphylococcus pasteuri ) were all amplified. That is, the fasteners Terry (pasteuri) primer pairs of the present invention based on the results in Figure 3 of the genus Staphylococcus Im (Staphylococci) was obtained results sikindaneun species-specific amplification by.

(3) various genus genus ) As the target strain PCR

Using the primer pairs shown in Table 1, strains belonging to various genuses corresponding to the following Table 4 were cloned into C1000 PCR was performed using a thermocycler (Bio-Rad Laboratories, Inc., CA, USA) and each reaction was confirmed using the Maxime PCR Premix Kit (i-starTaq) (iNtRON Biotechnology, Seongnam, Korea).

number strain One Listeria monocytogenes ATCC 15313 2 Enterococcus faecalis KACC 11304 3 Bacillus cereus KCTC 1092 4 Streptococcus acidominimus KACC 13815 5 Salmonella enterica ATCC 19946 6 Yersinia enterocolitica ATCC 9610 7 Escherichia coli O157: H7 8 Staphylococcus aureus CCARM 3793 9 Staphylococcus pastier KACC 13185

More specifically, the microorganisms of Table 4 were subjected to PCR and electrophoresis in the same manner as in (1) above.

As a result, as shown in Fig. 4, the primer pair (PA237 F / PA237 R) of Table 1 was found to be staphylococcus pasteuri ) (9 times) amplification. That is, based on the results shown in FIG. 4, the primer pair of the present invention is staphylococci pasteuri ) was specifically amplified.

<110> Rural development administration <120> Primer set for detecting Staphylococcus pasteuri and detecting          method using the same <130> P13-151 <160> 1 <170> Kopatentin 2.0 <210> 1 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PA237 F <400> 1 gctaatttag acagtgtacc ttctg 25

Claims (4)

Staphylococcus pasteuri species comprising a pair of PA237 primers represented by the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2, . 2. The method according to claim 1, wherein the pair of PA237 primers amplify a manganese-dependent superoxide dismutase ( sod A) gene of Staphylococcus sp. Manganese dependent superoxide dismutase ( sod A) / RTI &gt; A PCR kit for detection of Staphylococcus pasteuria species, comprising a composition for detecting Staphylococcus pastoris according to claim 1. A PCR method for Staphylococcus pasteuria species-specific detection using a pair of PA237 primers represented by the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2.

Images