KR101572222B1 - Anti-dark circle composition comprising formononetin or pharmaceutically acceptable salts thereof - Google Patents

Abstract

The present invention relates to a cosmetic composition for preventing or ameliorating dark circles comprising formalinetin or a pharmaceutically acceptable salt thereof as an active ingredient. In addition, the composition of the present invention exhibits a strong UGT1A1 expression effect and can improve dark circles without side effects.

Description

[0001] The present invention relates to a cosmetic composition for improving dark circles comprising formononetin or a pharmaceutically acceptable salt thereof,

The present invention relates to a cosmetic composition for improving dark circles. More particularly, the present invention relates to a cosmetic composition which alleviates the dark circles that appear under the eyes due to dark circles and has a small side effect.

UGT1A1 (UDP glucuronosyltransferase 1 family, polypeptide A1) is a human enzyme mainly expressed in liver and skin. It has a function to hydrolyze steroid, bilirubin, hormone and the like in the glucuronidation pathway.

Dark circles occur in the skin under the eyes mainly due to dark shadow or pigmentation on the eyes, skin around the eyes, and the causes are various. The cause of dark circles can be classified into physical factors and biological factors. The physical factors of dark circles are the shadows caused by accumulation of abnormal fat in the fascia of the skin below the eyeball . In the case of biological factors, accumulation of melanin and changes in blood color due to deposition of bilirubin caused by weakening of the blood vessels are considered to be prominently displayed in the skin near the eye having a relatively thin thickness relative to other skin.

The pathological effects of dark circles have not been proven, but many people, such as harming healthy images and negatively affecting their appearance, are ranked dark circles as a cosmetic problem of eyes. This dark circle phenomenon is recognized as an important problem to be solved for cosmetics.

At present, the way to treat dark circles exists in response to each cause. In the case of the pouch type skin tissue, which is a physical cause, there is the inhale or dispersion of the fat or the removal of the tissue due to the surgical operation. However, accessibility is not easy due to the trouble of the external activity due to the operation and cost problems. Also, this surgical procedure can only be used to remove dark circles due to physical causes. In addition, the most commonly used way to treat dark circles in a cosmetic way is to mask the makeup cosmetics such as foundation or concealer. In addition, dark circles by melanin are similar to those of existing whitening cosmetics, but there is no countermeasure against deposition of hemoglobin decomposition materials.

Accordingly, in the present invention, screening was conducted on various natural material extracts in consideration of the above situation, and a material for increasing the expression of UGT1A1, which is a decomposition product of bilirubin, which is a by-product of decomposition of hemoglobin, was selected.

SUMMARY OF THE INVENTION The present invention provides a cosmetic composition having excellent dark circles improvement effect.

In particular, the present invention provides a cosmetic composition using a natural herbal medicine extract, which has few side effects and is safe and has an excellent effect of improving dark circles.

The present invention provides a cosmetic composition for preventing and / or improving dark circles comprising formalinetin or a pharmaceutically acceptable salt thereof in order to solve the above technical problem.

The inventors of the present invention have found through experiments that the formononetin or a pharmaceutically acceptable salt thereof can alleviate the dark circles under the eyes and have found that the improvement of the dark circles of the formononetin or its pharmaceutically acceptable salt or And to provide a new use for prevention.

Further, the present invention provides a composition which can relieve dark circles symptoms occurring on the skin under the eyes by further increasing the expression of UGT1A1 which is complexed with bilirubin present in the skin when applied to the skin, thereby further preventing the symptoms.

As used herein, the term "prevention" means to improve the flow of blood flow under the eyes and to prevent the occurrence of dark circles by increasing decomposition of bilirubin in the skin, and also to prevent the occurrence of dark circles It is a term used in meaning.

As used herein, the term " improvement "refers to an improvement in the blood flow and relaxation of the under-eye area, so that the composition of the present invention is used before the composition of the present invention is used, Is a term used in a broad sense.

The formula of the formononetin of the present invention is C ₁₆ H ₁₂ O ₄ And a molecular weight of 284.26, which can be represented by the following formula (1).

[Chemical Formula 1]

The compound can be isolated from a plant containing licorice (licorice), but the present invention is not limited to the method for obtaining the formononetin. The formononetin according to the present invention can be chemically synthesized by a method known in the art, or a commercially available substance can be used.

The term "pharmaceutically acceptable salts " of the present invention refers to salts prepared with little or no toxicity or with acids or bases. When the compound of the present invention is relatively acidic, the base addition salts may be obtained by contacting a neutral form of such compound with a sufficient amount of the desired base and an appropriate inert solvent. Pharmaceutically acceptable base addition salts include, but are not limited to, salts formed with sodium, potassium, calcium, ammonium, magnesium or organic amino. Where the compounds of the present invention are relatively basic, acid addition salts can be obtained by contacting neutral forms of such compounds with a sufficient amount of the desired acid and a suitable inert solvent. Pharmaceutically acceptable acid addition salts include those derived from organic acids such as propionic acid, isobutyric acid, oxalic acid, malic acid, malonic acid, benzoic acid, succinic acid, sueric, fumaric acid, mandelic acid, phthalic acid, benzenesulfonic acid, Phosphoric acid, monohydrogencarbonic acid, phosphoric acid, monohydrogenphosphoric acid, dihydrogenphosphoric acid, sulfuric acid, monohydrogensulfuric acid, hydrogen iodide, phosphorous acid, And the like, but are not limited thereto. But are not limited to, salts of amino acids such as arginate and analogs of organic acids such as glucuronic or galactunoric acids.

The formononetin of the present invention may exist in unsolvated form as well as solvated form including form of hydrate, ethanol, and the like. The formononetin of the present invention may exist in crystalline or amorphous form, and all such physical forms are included within the scope of the present invention.

The formononetin of the present invention may also be present in the form of a pro-drug. In particular, prodrugs that can be separated into formononetin, which is in active form by esterase or amidase present in the skin, may be used. Specifically, in order to control the hydrophilicity / lipophilicity, the skin absorbency, the solubility and the pharmacokinetics of the formononetin, alkyl having 1 to 6 carbon atoms, alkenyl having 1 to 6 carbon atoms, haloalkyl group having 1 to 6 carbon atoms, An alkoxyalkyl group having 1 to 6 carbon atoms, an alkoxyalkyl or alkoxyalkoxyalkyl group having 1 to 6 carbon atoms, a phenacyl group, a phenacyl group substituted with an alkyl having 1 to 6 carbon atoms, an alkoxy and an alkyl moiety each having 1 to 6 carbon atoms Substituents such as an alkoxycarbonylalkyl group, a cyanoalkyl group having 1 to 6 carbon atoms, and an alkylthioalkyl group having 1 to 6 carbon atoms in each alkyl moiety may be linked to one another by an ester bond or an amide bond. Such prodrugs can be made by methods well known in the art, such as those described in BURGER'S MEDICAL CHEMISTRY AND DRUG DISCOVERY, 172-178, 949-982 (Manfred E. Wolffed., 5th ed. .

The present inventors have evaluated the expression ability of UGT1A1 enzyme to improve dark circles using formononetin, and as a result, it has been confirmed that formononetin and its pharmaceutically acceptable salt exhibit a potent UGT1A1 expression effect.

The cosmetic composition of the present invention may contain 0.0005 to 10% by weight, preferably 0.001 to 5% by weight, of formononetin or a pharmaceutically acceptable salt thereof, based on the total weight of the composition.

When the content of the formononetin or its pharmaceutically acceptable salt is less than 0.0005% by weight, the expression of UGT1A1 is difficult to expect, and when it exceeds 10% by weight, no marked effect is expected as an increasing content.

The cosmetic composition containing the formononetin of the present invention or a pharmaceutically acceptable salt thereof may be prepared as a cosmetic composition according to a conventional method for producing a cosmetic composition.

In addition, the cosmetic composition according to the present invention may contain components commonly used in addition to the formononetine, and examples thereof include moisturizers, thickeners, surfactants, oil bases, preservatives, antioxidants, Etc., as well as a chemical component for doubling the dark circle improvement effect by the above formononetin can be compounded in an appropriate amount.

The cosmetic composition according to the present invention may be prepared in any form conventionally produced in the art, and may be in the form of solution, suspension, emulsion, paste, gel, cream, lotion, soap, surfactant- , But is not limited thereto. More specifically, it can be manufactured in the form of a soft lotion, a nutritional lotion, a nutritional cream, a massage cream, an essence, an eye cream, a cleansing cream, a cleansing foam, a cleansing water, a pack, a spray or a powder.

The preferred formulations of the present invention are lotions, creams, and essence formulations in which the ingredients are uniformly dispersed in the cosmetic composition and the effect of the present invention is best exhibited.

Compositions containing the formononetin of the present invention or a pharmaceutically acceptable salt thereof may have an effect on prevention and improvement of dark circles.

Particularly, the composition containing the formononetin of the present invention or a pharmaceutically acceptable salt thereof is excellent in the improvement of color change caused by bilirubin and pigment deposition phenomenon among the symptoms of dark circles.

The composition of the present invention was found to be superior in clinical improvement of under-eye brightness.

The composition of the present invention is excellent in prevention and improvement of dark circles while having few side effects.

1 is a schematic diagram of a vector for expression of luciferase comprising a promoter region (-890 to +80) of UGT1A1.
FIG. 2 is a graph showing luciferase activity measured to determine the expression level of UGT1A1 according to the concentration of formononetin.
FIG. 3 is a graph showing the amount of mRNA expression in the test group treated with formalinine by quantifying the mRNA expression level of the negative control group at 1.0.

Hereinafter, the present invention will be described in more detail with reference to the following examples. However, the embodiments according to the present invention can be modified into various other forms, and the scope of the present invention should not be construed as being limited to the above-described embodiments. The embodiments of the present invention are provided by way of example to facilitate a specific understanding of the present invention.

The formononetin used in the following examples of the present invention was purchased from Sigma.

<Example 1> Evaluation of transcription activation of UGT1A1

Similar to human skin cells, HepG2, a cell line expressing UGT1A1, was subcultured in Dulbecco's modified Eagle's medium (DMEM; Invitrogen, USA) containing steroid hormone-free fetal bovine serum (5% charcoal stripped FBS). A reporter vector was constructed to investigate the promoter activity of UGT1A1. For this, the promoter region (-890 ~ + 80) of UGT1A1 was first amplified from human genomic DNA using PCR, and the primers used at this time were shown in Table 1.

Sequence Forward TTTGGTACCTTTGATAAATTGTGGGGCAA Reverse AAAGGTACCCCCCCTCCCTCTGCCTCTTA

The amplified DNA was cut using KpnI and NcoI restriction enzymes and cloned into a pGL3 vector expressing firefly luciferase, which is shown in Fig.

The vector was injected into HepG2 cells via transfection.

The prepared plasmid vector and a plasmid always expressing Renilla luciferase were used in a promoter assay in combination with a DNA mixture in a ratio of 40: 1. 2 x 10 ⁵ HepG2 cells were plated on a 24 well plate and incubated for 18 hours. 1 ㎍ of the plasmid gene UGT1A1 reporter was transiently transformed using GenJet ^TM reagent (SignaGen, USA) according to the manufacturer's instructions Transient transfection. The cells were incubated for 24 hours, washed with phosphate buffered saline (PBS), and then added with formalin (5, 10 ppm) in DMEM medium without fetal bovine serum. The negative control (Mock) was treated with the same amount of solvent and the positive control was treated with 200 μM / ml of 6,7-dimethylesculrtin, which was used to increase the expression of UGT1A1 through the thesis. After incubation for 24 hours, the cells were washed with phosphate buffer solution, and the cells were lysed with a cell lysis buffer. Then, the supernatant was extracted using a centrifuge to obtain a Luciferase assay, and then the cells were treated with Perkin Elmer Victor 3 The luminescence was measured and shown in Fig.

As shown in FIG. 2, the formononetin according to the present invention shows a high degree of Firefly luciferase activity by increasing the expression of UGT1A1 to a significant extent. The measurements corrected firefly luciferase levels to renilla luciferase levels.

<Example 2> Regulatory effect of UGT1A1 gene expression

HepG2 cells were cultured in Biotechnology Research Institute, and Dermal basal cell media (DBCM, ATCC, USA) was used. 8 x 10 ⁵ cells were plated on a 6-well plate and cultured for 18 hours, followed by treatment with formononetin at a concentration of 10 ppm for 24 hours. Cells were harvested and washed with PBS. Total RNA was extracted using RNeasy mini kit (Qiagen, Germany), and 1 μg of RNA was quantitatively analyzed using GeneAmp ^® RNA PCR kit (Applied Biosystems, USA) reverse transcription). Reverse transcription was performed using a Mycycler ^® PCR instrument (Biorad, USA).

Quantitative real time PCR was performed using UGT1A1 and GAPDH Taqman ^® probe (Invitrogen, USA, HS02511055_S1, HS03929097_g1). Real-time PCR was performed using a CFX96 Touch ™ Real-Time PCR Detection System instrument (Biorad, USA). Experimental results obtained by real-time PCR were compared with those of the housekeeping gene Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) using the ΔΔCt method (Livak KJ, Schmittgen TD: Analysis of relative gene expression data using real- Delta Delta C (T)) Method, Methods, 25, 402-408 (2001). In addition, mRNA expression levels of the formalinin treatment group were quantified based on the mRNA expression level of the negative control group as 1.0 3.

&Lt; Preparation Example 1 >

Composition (% by weight) Production Example 1 Formononetine 1.0 Vaseline 2.0 Sesquioleic acid sorbitan 0.8 Polyoxyethylene oleylethyl 1.2 Methyl paraoxybenzoate Suitable amount Propylene glycol 5.0 ethanol 3.2 Carboxyvinyl polymer 18.0 Potassium hydroxide 0.1 Pigment Suitable amount incense Suitable amount Purified water to 100

As shown in Table 2, a nutritional lotion containing formononetin as an active ingredient was prepared by a conventional method.

&Lt; Preparation Example 2 > Preparation of essence

Composition (% by weight) Production Example 2 Formononetine 1.0 glycerin 10.0 Sodium hyaluronate aqueous solution (1%) 5.0 Polyoxyethylene hardened castor oil 1.0 Methyl paraoxybenzoate 0.1 Spices 0.05 Purified water to 100

Essences containing formononetin as an active ingredient were prepared according to a conventional method as shown in Table 3 above.

&Lt; Preparation Example 3 >

Composition (% by weight) Production Example 3 Formononetine 1.0 Stearic acid 15.0 Cetanol 1.0 Potassium hydroxide 0.7 glycerin 5.0 Propylene glycol 3.0 antiseptic Suitable amount incense Suitable amount Purified water to 100

As shown in Table 4, a cream containing formononetin as an active ingredient was prepared according to a conventional method.

&Lt; Preparation Example 4 > Preparation of pack

Composition (% by weight) Production Example 4 Formononetine One glycerin 5.0 Propylene glycol 4.0 Polyvinyl alcohol 15.0 ethanol 8.0 Polyoxyethylene oleylethyl 1.0 Methyl paraoxybenzoate 0.2 incense Suitable amount Pigment Suitable amount Purified water to 100

As shown in Table 5, a pack containing the formononetin as an active ingredient was prepared according to a conventional method.

Preparation Example 5 Preparation of ointment for external preparation for skin

Composition (% by weight) Production Example 5 Formononetine One Epipredelanol 0.2 Diethyl sebacate 8 Nonsense 5 Polyoxyethylene oleyl ether phosphate 6 Sodium benzoate One vaseline to 100

As shown in Table 6, ointments among external preparations for skin containing formononetin as an active ingredient were prepared according to a conventional method.

&Lt; Experimental Example 1 >

Experiments were conducted to measure the effect of improving the difference in the lightness of the eyes by using the products manufactured in the manufacturing examples. First, 25 subjects were sufficiently stabilized for 10 minutes, and then, using a Chromameter CR-400 (Minolta, Japan) Changes in the L ^* , a ^* , and b ^* values of the areas where the pigment under the eyes were deposited were measured. L * is the lightness axis, a * is the green / red axis, and b * is the blue / yellow axis. The results are shown in Table 7. The results are shown in Table 7. The results are shown in Table 7. The results are shown in Table 7 below. Respectively.

Brightness improvement ratio under eyes L ^* 17 (65.38%) a ^* 15 (57.69%) b ^* 18 (65.38%)

Table 7 shows the results of measurement of changes in L ^* , a ^* , and b ^* values at sites where pigment under the eyes is deposited. According to the results, it can be seen that the cosmetic composition containing the formononetin of the present invention is effective for improving the lightness difference under the eyes, and thus it is considered that it will be effective for the improvement of dark circles under the eyes.

Claims (4)

A cosmetic composition for preventing or improving dark circles comprising formalinetin or a cosmetically acceptable salt thereof as an active ingredient. The cosmetic composition according to claim 1, wherein the formononetin or a cosmetically acceptable salt thereof is contained in an amount of 0.0005 to 10% by weight based on the total weight of the composition. The cosmetic composition according to claim 1, wherein the formononetin or a cosmetically acceptable salt thereof increases the expression of UGT1A1 (UDP glucuronosyltransferase 1A1). A cosmetic composition for expressing UGT1A1 comprising formononetin or a cosmetically acceptable salt thereof as an active ingredient.

Images